JPH07224097A - Interleukin-6 variant - Google Patents

Abstract

PURPOSE:To provide a human interleukin-6 (IL-6) variant, and to provide a method for producing the IL-6 variant by a recombination DNA technology. CONSTITUTION:An IL-6 variant which has at least a deletion selected from the deletion of the 5th Gly to the 19th Leu from the N-terminal, and the deletion of the 44th Cys to the 50th Cys from the N-terminal, and the deletion of the 73rd Cys to the 83rd Cys from the N-terminal in the amino acid sequence, a gene coding for the IL-6 variant, an expression vector containing the gene, and a method for producing the LI-6 variant, using a yeast (S. pombe) transformed with the expression vector are provided.

Description

Detailed Description of the Invention

[0001]

INDUSTRIAL APPLICABILITY The present invention was transformed with an interleukin-6 mutant having a specific deletion in the amino acid sequence, a DNA sequence encoding the same, an expression vector having the DNA sequence, and the expression vector. The present invention relates to a transformant and the above-mentioned interleukin-6 mutant using the transformant.

[0002]

2. Description of the Related Art Various cytokines involved in the proliferation and differentiation of cells have been reported in recent years, and have been applied to medical treatment. Among them, interleukin-6 (IL-6) has been identified by many researchers as BSF-
2, has been studied under the names such as IFNβ2. IL-6
Is a factor that is expressed in leukocytes, epithelial cells, fibroblasts, etc. and causes proliferation and differentiation of antibody-producing cells. IL-6
Has attracted attention as thrombopoietin that can exhibit platelet proliferating activity in cooperation with interleukin 3 together with B cell stimulating activity.

Studies on the gene sequence of IL-6 have been conducted by many researchers. Among them, Chernajovs
ky et al., 26K named interferon beta-2
The partial sequence of Da protein was clarified (Chernajovsky et
al, 1984, DNA, 3,297). Zilberstein et al. Have succeeded in determining the full length sequence (EMBO J., 1986, 5, 2529). On the other hand, Hirano et al. Determined the entire gene sequence of B cell stimulating factor (BSF-2) (Nature, 324, 73, 1986). Also Braken
Results of primary structure analysis of HGF by Hoff et al. (J. Immunol., 139,
4116, 1987) have revealed that HGF, IFNβ2, 26KDa protein and BSF-2 are the same substance.

[0004]

With respect to mass production of IL-6 having various physiological activities as described above, many developments have been made due to its usefulness in medicine. However, the amount of IL-6 produced in bacteria is not very high.
In addition, since there are four cysteine residues in the molecule, there is the possibility that undesired bonds between molecules or within the molecule can be freely formed. In particular, incorrect disulfide bond formation often occurs during purification. Is difficult to do and the recovery rate is decreasing.

As an IL-6 mutant containing no disulfide bond, an IL-6 mutant obtained by converting all four cysteine residues in IL-6 into serine residues is known (Tokuhokuhei 4). -503301 gazette). This mutant is produced by recombinant DNA technology using bacteria such as Escherichia coli. Although this mutant can avoid the problem caused by the above-mentioned cysteine residue, it is a relatively high-molecular-weight protein like IL-6, and its expression level was not sufficient.

On the other hand, conventionally, when producing useful proteins using microorganisms, Escherichia coli, Bacillus subtilis, yeast Saccharomyces cerevisiae and the like have been widely used as hosts for recombinant DNA. A method of introducing an expression vector containing a structural gene region encoding a heterologous protein of interest into such a host and producing a large amount of the target protein using this expression system has been extensively studied, and some of them have already been studied. It has been put to practical use in the production of proteins.

For the purpose of mass production of useful substances using recombinant DNA technology, selection of host cells is an important point. Therefore, it is important to expand the selection range of useful substance production hosts. At present, several systems other than the above host-vector system are known [Candida maltosa (J. Bacteriol., 167,561 (Takagi
Et al.), Bacillus amyloliquefa-ciens, Acetobacter ac
eti, Corynebacterium giutumicum, Pseudomonas puti
da etc.].

[0008]

DISCLOSURE OF THE INVENTION The present invention provides means for solving the problems caused by the disulfide bond, maintaining or increasing the activity thereof and lowering the molecular weight thereof, measures for increasing the expression level of IL-6, and the like. To do. Also, I
It provides a means for producing L-6 variants by recombinant DNA technology.

[0009]

[Means for Solving the Problems] The present inventors have made it possible to reduce the problems caused by disulfide bonds and to sufficiently solve the problems by deleting a specific portion of the amino acid sequence of natural human IL-6. It was found that the activity of IL-6 can be maintained or increased. This IL-6 variant can be used for the purpose of a platelet proliferating agent, an immunoglobulin production stimulating agent, and the like.

The present invention is based on the amino acid sequence of human interleukin-6, from Gly at the 5th position from the N-terminus.
Deletion up to the 9th Leu, 44th Cys from N-terminal
To the 50th Cys, and 7 from the N-terminus
An interleukin-6 mutant comprising an amino acid sequence having at least one deletion selected from the deletion from the 3rd Cys to the 83rd Cys.

The IL-6 mutant of the present invention has the characteristic that the original three-dimensional structure is well maintained by removing the loop of the polypeptide caused by the disulfide bond between two cysteine residues, In addition, the deletion at one other site has little effect on the activity. As a result, it is considered that the reduction of the molecular weight of the protein is performed at the same time and it becomes more effective as a drug.

Natural human IL-6 is a protein having 184 amino acid residues, and its amino acid sequence and its DNA sequence are known. The sequence is shown in FIG.
In this amino acid sequence, the 5th Gly from the N-terminal
To the 19th Leu, the 44th Cys to the 50th Cys from the N-terminus, and the 73rd Cys to the 83rd Cys from the N-terminus. The IL-6 mutant of the present invention has at least one of the deletions (the respective positions are indicated by underlined portions in FIG. 1).

As the activity data of the examples below show,
In particular, a deletion from the 5th Gly to the 19th Leu from the N-terminal (in addition, it may have a deletion from the 44th Cys to the 50th Cys from the N-terminal) IL
The -6 mutant has high activity. IL-6 having a deletion from Cys 44th to Cys 50th from the N-terminus
The variant has the next highest activity. The deletion from the 73rd Cys to the 83rd Cys from the N-terminal does not result in particularly high activity (particularly, in addition to those having 1-2 other deletions), deletion of this part Loss is believed to reduce the molecular weight of the protein and facilitate the production of IL-6 variants.

The preferred IL-6 variants of the present invention are:
Deletion from the 5th Gly to the 19th Leu from the N-terminal, and the 44th Cys to the 50th from the N-terminal
An IL-6 mutant having at least one deletion selected from deletions up to Cys. Particularly preferred present invention IL-
The 6 mutants consist of the 5th Gly from the N-terminal to the 19th
An IL having two deletions, a deletion up to Leu and a deletion from Cys 44th to Cys 50th from the N-terminus
-6 mutant.

The amino acid sequences of 7 kinds of IL-6 variants of the present invention and their DNA sequences are shown in SEQ ID NOS: 1 to 7 below.
The DNA sequence of the present invention is not limited to the DNA sequences listed in this sequence listing, but the DNA sequences listed in this sequence listing are preferred. In addition, Table 1 shows the names of IL-6 variants of the present invention produced in Examples, the deleted amino acid numbers, and the corresponding SEQ ID numbers in the sequence listing.

[0016]

[Table 1]

As described above, Cy at the 73rd position from the N-terminal
The deletion from s to Cys at position 83 does not bring particularly high activity, and it is considered that this portion should be present in terms of activity. In the case where the IL-6 variant of the present invention has a portion from the 73rd Cys to the 83rd Cys from the N-terminal, the problem due to the presence of a disulfide bond in this portion may sometimes arise from the known invention (special It is considered that the problem can be solved by applying (Table 4-503301). That is, all the cysteine residues in this portion can be converted to serine residues. The same applies to the IL-6 mutant of the present invention in which a portion from the 44th Cys to the 50th Cys from the N-terminal is present.

The IL-6 variant of the present invention can be produced by a well-known liquid phase synthesis method or solid phase synthesis method for peptides. However, considering that the molecular weight is relatively high, it is considered to be advantageous to produce the recombinant DNA technology. In view of such a current situation, the present inventor
IL-6 mutants lacking the above-mentioned constituent amino acids were constructed using NA technology and PCR method, and earnest studies were conducted on the productivity in cells, the improvement of stability, the increase of activity and the change of biological activity. The present inventors have found a method for producing the above-mentioned IL-6 mutant which meets the above-mentioned purpose by recombinant DNA technology.

The present invention provides a DNA sequence encoding the amino acid sequence of the above IL-6 variant for producing the above IL-6 variant by recombinant DNA technology, an expression vector having the DNA sequence, and the expression vector. The transformed transformant, and the above IL- using the transformant
The following invention relates to a method for producing 6 mutants.

A DNA sequence encoding the interleukin-6 variant. An expression vector having the above DNA sequence. A transformant transformed with the above expression vector. A method for producing an interleukin-6 mutant, which comprises culturing the above transformant in a medium, causing the interleukin-6 mutant to be produced and accumulated in the culture, and collecting this.

For the purpose of mass production of the IL-6 mutant, the present inventor has selected Schizosaccharomyces pombe [Sch.
pombe]. S.pombe is a yeast belonging to the genus Schizosaccharomyces. It is known that this yeast exhibits properties similar to those of animal cells among yeasts, and it has been reported that, for example, its sugar chain is similar to that of animal cells. As a result, the structurally stable IL-
It was possible to efficiently create 6 mutants. The present invention is
It is the above-mentioned expression vector capable of expressing in S.pombe, the above-mentioned transformant using S.pombe as a host, and a method for producing the above-mentioned IL-6 mutant using the transformant.

The production method by the recombinant DNA technology of the present invention makes it possible to further enhance or retain the physiological activity of IL-6, to have a more stable structure, and to express it in a large amount in fission yeast.

[0023] The expression vector of the present invention preferably contains, in addition to the DNA sequence encoding the IL-6 variant, an origin of replication that functions in a eukaryotic host, and a promoter region derived from an animal cell virus. Furthermore, the promoter region derived from this animal cell virus is SV4
It is preferably 0 or a promoter region derived from cytomegalovirus. In addition, the expression vector of the present invention further comprises a neomycin resistance gene region, LEU 2
It is preferable to include at least one of the gene region and the URA 3 gene region. D encoding an IL-6 variant
An expression vector having such a gene region excluding the NA sequence and a means for constructing the same are described in, for example, JP-A-5-15380, which is related to the inventors' invention.

The host microorganism transformed with the expression vector of the present invention is not limited to the above-mentioned fission yeast S.pombe, but bacteria such as Escherichia coli, yeasts other than fission yeast S.pombe,
Alternatively, it may be an animal cell or the like. However, as mentioned above, fission yeast S. pombe is most preferred.

Next, the present invention will be described in detail with reference to examples, but the examples are given for the purpose of specific recognition, and do not limit the present invention.

[0026]

EXAMPLES The methods and kits used in the following examples and reference examples were as follows unless otherwise stated. Purification and recovery of DNA: Glass bead method (using "DNA PREP" (trade name) manufactured by Asahi Glass Co., Ltd.). Ligation: Ligation kit (Takara Shuzo Co., Ltd.)
Used).

[Reference Example 1] [Preparation of vector pRL2M] The vector pcD4B (see Japanese Patent Laid-Open No. 15380/1993) prepared by a known method was digested with a restriction enzyme SacI, and the ends were blunted with T4 DNA polymerase. After digestion with the restriction enzyme BamHI, the nucleic acid fraction was collected by phenol extraction and ethanol precipitation.
Further, after agarose gel electrophoresis, DNA corresponding to about 4500 base pairs was purified by the glass bead method.

Separately, a vector pcDl containing the human lipocortin I gene (cDNA), also prepared by a known method
The restriction enzyme Xm for ipoI (see Japanese Patent Laid-Open No. 15380/1993)
After digestion with nI and BamHI, the nucleic acid fraction was collected by phenol extraction and ethanol precipitation. Further, after agarose gel electrophoresis, DNA corresponding to about 1300 base pairs was purified.

After ligating both DNAs, Escherichia coli DH5 (sold by Toyobo Co., Ltd.) was transformed. Prepare a vector from the resulting transformants and target the vector
Transformants with pRL2L (Figure 2) were screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed.

This lipocortin I expression vector pRL2L was digested with the restriction enzymes EcoRI and HidIII, extracted with phenol and precipitated with ethanol, and the band corresponding to about 5000 base pairs was cut out by agarose gel electrophoresis for purification.
Separately, the known vector pUC19 was modified with restriction enzymes EcoRI and Hi.
After digestion with dIII, phenol extraction and ethanol precipitation,
A band corresponding to about 60 base pairs was cut out by polyacrylamide gel electrophoresis and extracted and purified from the gel.

After ligation of these two fragments,
Target vector pRL2M by transforming Escherichia coli DH5
(FIG. 3) was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed.

[Reference Example 2] [Preparation of vector pTL2M] Using vector pRL2M as a template, oligodeoxyribonucleotide 5'-TTGACTAG
The target fragment was amplified by PCR using Taq polymerase with TTATTAATAGTA-3 ′ and oligodeoxyribonucleotide 5′-CTAGAATTCACATGTTTGAAAAAGTGTCTTTATC-3 ′ as synthetic primers. Restriction enzymes SpeI and EcoRI
The ends were adjusted with, and after phenol extraction and ethanol precipitation, a band corresponding to about 600 base pairs was cut out by agarose gel electrophoresis and purified by the glass bead method.

Separately, the vector pRL2M was digested with the restriction enzymes SpeI and EcoRI, extracted with phenol and precipitated with ethanol, and the band corresponding to about 4500 base pairs was excised and purified by agarose gel electrophoresis. After ligation of these two fragments, Escherichia coli DH5 was transformed and the desired vector pTL2M (FIG. 4) was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed.

[Reference Example 3] [Cloning of human IL-6 gene] "human periphe
human IL-6 cDNA from a cDNA library of "ral blood monocyte (LPS-activated)" (CLONETECH)
Was isolated by the oligonucleotide probe method. DN
A probe is T. Hirano et al. (Hirano, T. et al. Nature, 3
24, 73-76, 1986) and based on the gene sequence of human IL-6 determined by an automatic DNA synthesizer (Model 381A, Applied Biosystems).

The synthesized N-terminal probe was 5'CAA CAC CAG GAG CAG CCC CAG GGA GAA GGC AAC TGG.
ACC GAA GGC GCT 3 '(antisense corresponding to the nucleotide sequence No. 52-99 in the above literature), and the synthesized C-terminal probe was 5' ATG ACA ACT CAT CTC ATT CTG CGC AGC TTT AAG GAG
TTC CTG CAG TCC 3 '(corresponding to the nucleotide sequence No. 598-645 in the above literature).

Since the cDNA library was prepared using "λgt10" as a cloning vector, it was isolated by plaque hybridization using "C600" as the infectious E. coli. The specific isolation method is CLONE
The attached manual of TECH was followed.

First, 10 ml of a single colony of Escherichia coli "C600"
LB medium (0.5% yeast extract, 1% peptone, 1% NaCl)
After culturing overnight in SM buffer (0.1M NaCl, 8mM MgSO ₄ ·
SM buffer was added to 0.1 ml of phage library diluted 1/10 ⁵ with 7H ₂ O, 50 mM Tris-HCl pH7.5,0.01% gelatin) _.
After adding 0.3 ml and 0.6 ml of "C600" and shaking at 37 ° C for 20 minutes, 3 ml of LB agarose was added and immediately after mixing, the mixture was spread on an LB plate (90 mm petri dish) to prepare 10 sheets. 37 ° C
When the plate was allowed to stand overnight at about 10,000 plaques appeared on one plate.

After standing at 4 ° C. for 1 hour, a nitrocellulose filter was placed on the plate to make a replica. Then 1.5M
NaCl / 0.5M NaOH solution, 1.5M NaCl / 0.5M Tris-HCl pH
It was dipped in 8.0 solution, then washed 3 times with SSC (pH 7.0 buffer containing 0.15 M NaCl and 0.015 M sodium citrate), air dried and then dried at 80 ° C. in vacuo. After leaving it in the hybridization solution for 2 hours at room temperature,
³² P C end probe 65 ° C. overnight standing was added to the hybridization solution of the label, 10 min at 60 ° C. in the next day SSC, 50 ° C.
The filter was washed 3 to 4 times for 30 minutes, and repeated until it reached 100-200 cpm. Finally, it was air-dried and autoradiography was performed.

The second and third screenings were performed in the same manner. However, both N-terminal and C-terminal probes were used in the second and third screening. After the third screening, a single plaque having IL-6 was taken with a toothpick, suspended in 1 ml of SM buffer, spread on an LB plate, and completely lysed. Phage was collected by adding 4 ml of SM buffer, and E. coli "C600" was infected with 4 ml of NZYCM medium. From now on Molecular Cloning
The phage DNA was isolated according to the method described in 1. This is EcoR
After cutting with I, the IL-6 cDNA insert was isolated, and commercially available pUC19 (sold by Takara Shuzo Co., Ltd.) was cut with EcoRI and this IL-6 cDNA insert was ligated to obtain pAG9-8.
-1 was created.

Reference Example 4 Preparation of Human IL-6 Expression Vector Using the vector pAG9-8-1 containing the full length human IL-6 cDNA produced in Reference Example 3 as a template, oligodeoxyribonucleotide 5 ′ ATCGCATGCCAGTACCCCCAGGAGAAGA 3 ′
And oligodeoxyribonucleotide 5'TGAAAATCTT
The target fragment was amplified by PCR using TCT polymerase with CTCTCATCCG 3'as a synthetic primer.

The ends were adjusted with restriction enzymes SphI and HindIII, and after phenol extraction and ethanol precipitation, a band corresponding to about 1000 base pairs was cut out by agarose gel electrophoresis and purified by the glass bead method. Separately, the vector pTL2M prepared in Reference Example 2 was prepared using the restriction enzymes AflIII and HindIII.
After digestion with, extracted with phenol and precipitated with ethanol, a band corresponding to about 5000 base pairs was excised from agarose gel electrophoresis and purified by. After ligation of both fragments, Escherichia coli DH5 was transformed and the desired vector pTL26m (FIG. 5) was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed.

[Example 1] Preparation of IL-6 mutant (IL-6a ') gene and its expression vector (pTL26a') The following oligo DNA was synthesized. 1) 5'GCATGCCAGTACCACCAACCTCTTCAGAACGTATTGACAAACAG
ATTCGGTACATCCT 3'2) 5'CGTACGGTCATGGTGGTTGGAGAAGTCTTGCATAACTGTTTGTC
TAAGCCATGTAGGAGC 3 '

After phosphorylating 1) and 2) respectively (using Takara Kaination Kit sold by Takara Shuzo Co., Ltd.),
Annealing was carried out at 70 ° C. for 20 minutes using Klenow buffer. Also, the vector pTL2 prepared in Reference Example 4
6 m was digested with restriction enzymes TaqI and EcoRI, extracted with phenol and precipitated with ethanol, and then a band corresponding to about 900 base pairs was recovered by agarose gel electrophoresis (the same applies to the glass bead method).

The above-mentioned annealed DNA fragment and the fragment (Taq1, EcoR1 fragment) extracted from the gel were inserted (ligated) into the EcoR1 and SphI sites of the multicloning site of vector pUC19. After confirming the sequence of the part encoding IL-6, it was digested with EcoRI and SphI, extracted with phenol,
Approximately 96 from agarose gel electrophoresis after ethanol precipitation
The band corresponding to 0 base pairs was collected.

On the other hand, the vector pTL2M prepared in Reference Example 2
Was digested with restriction enzymes SphI and SpeI, extracted with phenol and precipitated with ethanol, and then a band of about 650 base pairs was recovered by agarose gel electrophoresis. In addition, pTL2M is added to SpeI and Ec
After digestion with oRI, phenol extraction and ethanol precipitation, a band of about 960 base pairs was collected by agarose gel electrophoresis. After ligating these three recovered fragments, Escherichia coli DH5 was transformed to screen the desired vector pTL26a '. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6a ′ are as shown in SEQ ID NO: 1 in the Sequence Listing.

[Example 2] Preparation of IL-6 variant (IL-6C1) gene and its expression vector (pTL26C1) The following oligo DNA was synthesized. 1) 5 'TTGACTAGTTATTAATAGTA 3' 2) 5 'TGTCTCCTTTCTCAGGGCTGA 3' 3) 5 'GAAAGCAGCAAAGAGGCACTG 3' 4) 5 'TAGCGGAGTGTATACTGGCT 3'

P using the vector pTL26m prepared in Reference Example 4 as a template and the above primers 1) and 2)
CR was performed. Chloroform treatment and ethanol precipitation were followed by blanching treatment (using Takara Branching Kit sold by Takara Shuzo Co., Ltd., the same applies below), followed by phenol, chloroform treatment and ethanol precipitation. Thereafter, a kination treatment was performed using T4 polynucleotide kinase, and ethanol precipitation was performed. Furthermore, after digestion with the restriction enzyme SpeI, agarose gel electrophoresis was performed, and a band corresponding to about 750 base pairs was recovered.
And

On the other hand, using the above primers 3) and 4), exactly the same procedure as above was carried out and agarose gel electrophoresis was carried out to recover a band corresponding to about 1600 base pairs, which was designated as fragment B.

Separately from these, the vector pTL2M prepared in Reference Example 2 was digested with SpeI and EcoRI, extracted with phenol, precipitated with ethanol, and then subjected to agarose gel electrophoresis.
A band of 960 base pairs was recovered. After ligating the recovered fragment and the above three fragments A and B, Escherichia coli DH5 was transformed and the desired vector pTL26C1 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6C1 are as shown in SEQ ID NO: 2 in the Sequence Listing.

[Example 3] IL-6 mutant (IL-6C2) gene and its expression vector
Preparation of (pTL26C2) The following oligo DNA was synthesized. 1) 5 'TTGACTAGTTATTAATAGTA 3' 2) 5 'TCCATCTTTTTCAGCCATCTT 3' 3) 5 'CTGGTGAAAATCATCACTGGT 3' 4) 5 'TAGCGGAGTGTATACTGGCT 3'

PCR was performed using the above-mentioned primers 1) and 2) with the pTL26m prepared in Reference Example 4 as a template. After chloroform treatment and ethanol precipitation, blanching treatment was performed, followed by phenol, chloroform treatment and ethanol precipitation. Thereafter, a kination treatment was performed using T4 polynucleotide kinase, and ethanol precipitation was performed. After digestion with the restriction enzyme SpeI, agarose gel electrophoresis was performed to collect a band corresponding to about 840 base pairs, which was designated as fragment A.

On the other hand, using the above primers 3) and 4), the same operation as described above was performed, and agarose gel electrophoresis was performed to recover a band corresponding to about 1500 base pairs, which was designated as fragment B.

Separately from this, the vector pTL2M prepared in Reference Example 2 was digested with SpeI and EcoRI, extracted with phenol, precipitated with ethanol, and then subjected to agarose gel electrophoresis.
A band of 960 base pairs was recovered. After ligating the recovered fragment and the above three fragments A and B, Escherichia coli DH5 was transformed and the desired vector pTL26C2 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6C2 are as shown in SEQ ID NO: 3 in the Sequence Listing.

[Example 4] IL-6 mutant (IL-6C3) gene and its expression vector
Preparation of (pTL26C3) The following oligo DNA was synthesized. 1) 5 'TTGACTAGTTATTAATAGTA 3' 2) 5 'TCCATCTTTTTCAGCCATCTT 3' 3) 5 'CTGGTGAAAATCATCACTGGT 3' 4) 5 'TAGCGGAGTGTATACTGGCT 3'

PCR was carried out using the above-mentioned primers 1) and 2) with the pTL2C1 prepared in Example 2 as a template. Chloroform treatment and ethanol precipitation were followed by blanching treatment to precipitate phenol, chloroform treatment and ethanol. Thereafter, a kination treatment was performed using T4 polynucleotide kinase, and ethanol precipitation was performed. After digestion with the restriction enzyme SpeI, agarose gel electrophoresis was performed to collect a band corresponding to about 800 base pairs, which was designated as fragment A.

On the other hand, using the above primers 3) and 4),
Using the vector pTL26m obtained in Reference Example 4 as a template, the same procedure as described above was performed, and agarose gel electrophoresis was performed to recover a band corresponding to about 1500 base pairs, which was designated as fragment B.

Separately, the vector pTL2M prepared in Reference Example 2 was digested with SpeI and EcoRI, extracted with phenol, precipitated with ethanol, and then subjected to agarose gel electrophoresis to obtain
A band of 960 base pairs was recovered. After ligating the recovered fragment and the above three fragments A and B, Escherichia coli DH5 was transformed and the desired vector pTL26C3 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6C3 are as shown in SEQ ID NO: 4 in the Sequence Listing.

[Example 5] Preparation of IL-6 mutant (IL-6a'C1) gene and its expression vector (pTL26a'C1)

PTL26a ′ obtained in Example 1 was digested with the restriction enzyme SpeI.
And digested with TaqI and then subjected to agarose gel electrophoresis to recover a band corresponding to about 680 base pairs. The pTL26C1 obtained in Example 2 was digested with restriction enzymes EcoRI and TaqI, and then subjected to agarose gel electrophoresis to recover a band corresponding to about 880 base pairs. Further, the vector pTL2M prepared in Reference Example 2 was digested with restriction enzymes SpeI and EcoRI, and then subjected to agarose gel electrophoresis to recover a band corresponding to about 4400 base pairs.

After ligating these three fragments, Escherichia coli DH5 was transformed with the desired pTL26a'C.
1 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6a'C1 are as shown in SEQ ID NO: 5 in the Sequence Listing.

[Example 6] Preparation of IL-6 mutant (IL-6a'C2) gene and its expression vector (pTL26a'C2)

PTL26a ′ obtained in Example 1 was digested with the restriction enzyme SpeI.
And digested with TaqI and then subjected to agarose gel electrophoresis to recover a band corresponding to about 680 base pairs. Further, pTL26C2 obtained in Example 3 was digested with restriction enzymes EcoRI and TaqI, and then subjected to agarose gel electrophoresis to recover a band corresponding to about 870 base pairs. Further, the vector pTL2M prepared in Reference Example 2 was digested with restriction enzymes SpeI and EcoRI, and then subjected to agarose gel electrophoresis to recover a band corresponding to about 4400 base pairs.

After ligating these three fragments, Escherichia coli DH5 was transformed with the desired vector.
pTL26a'C2 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6a'C2 are as shown in SEQ ID NO: 6 in Sequence Listing.

[Example 7] Preparation of IL-6 mutant (IL-6a'C3) gene and its expression vector (pTL26a'C3)

PTL26a ′ obtained in Example 1 was digested with the restriction enzyme SpeI.
And digested with TaqI and then subjected to agarose gel electrophoresis to recover a band corresponding to about 680 base pairs. Further, pTL26C3 obtained in Example 4 was digested with restriction enzymes EcoRI and TaqI and then subjected to agarose gel electrophoresis to recover a band corresponding to about 850 base pairs. Further, pTL2M prepared in Reference Example 2 was digested with restriction enzymes SpeI and EcoRI and then subjected to agarose gel electrophoresis to recover a band corresponding to about 4400 base pairs. After ligating these three fragments, Escherichia coli DH5 was transformed and the desired vector pTL26a'C3 was screened. From the confirmation of the partial base sequence and the construction of the restriction enzyme map, the target vector was confirmed. The structural gene portion and amino acid sequence of IL-6a'C3 are as shown in SEQ ID NO: 7 in the Sequence Listing.

Example 8 Expression of IL-6 and IL-6 variants

Leuine auxotrophic strain of S. pombe, leu1-32h
^- (ATCC 38399) was grown in a minimum medium to 0.8 × 10 ⁷ cells / ml. After collecting and washing the cells, suspend the cells in 0.1 molar lithium acetate (pH 5.0) so that the number of cells will be 10 ⁹ cells / ml, and then 30 ℃
And incubated for 60 minutes. Then the above suspension 100
Vector pAL7 (Okazaki, K.et.al.Nucleic Acids
Res.18,6485) was digested with PstI to obtain 1 μg of DNA, and 2 μg of each of the vectors obtained in Examples 1 to 7 was added to TE (Tris EDT).
A) Dissolve in 15 μl and add, add 290 μl of 50% (W / V) polyethylene glycol PEG4000 aqueous solution and mix well.
Incubation was performed at 30 ° C. for 60 minutes, 43 ° C. for 15 minutes, and room temperature for 10 minutes in that order.

PEG4000 was removed by centrifugation, and the culture solution was 1 μm.
suspended in l. From this, 100 μl was collected, 900 μl of culture medium was added, and the mixture was incubated at 32 ° C. for 30 minutes. home
300 μl was spread on minimal agar. After incubating at 32 ° C for 3 days, the transformant was transferred to a plate containing G418 (neomycin) and further cultured at 32 ° C for 5 days. The obtained one is a transformant of IL-6 and an IL-6 mutant.

These transformants were treated with 2% glucose, 1
% Yeast extract, 2% peptone, and G418 2
50 ml of liquid medium (YPD medium) containing 00 μg / ml at 32 ° C. for 3
Cultured for a day. Cells are planted in 1 liter of YPD medium from the culture solution to a concentration of about 10 ⁶ cells / ml. 32 ° C, 3
After culturing for one day, the cells were collected and washed, and a 50 mM Tris-HCl buffer solution (pH 7.
It was suspended in 5) and sonicated. 1% after ultrasonic crushing
After heat treatment at 80 ° C for 10 minutes in the presence of SDS, centrifugation is performed to collect the supernatant, and SDS-polyacrylamide gel electrophoresis (hereinafter referred to as SDS-PAGE) (TEFCO 16%
The state of expression was examined by using a gel).

A control S. was added at a position near the molecular weight of 15,000 to 21,000 corresponding to human IL-6 and IL-6 variant.
A clear band not found in the extract from pombe / pTL2M (control) was detected (Fig. 6). The expression level of each IL-6 mutant was 10 wt% or more of the total microbial cell protein as measured by a densitometer, and among them, the expression level of IL-6C1 and IL-6a'C1 was 25 wt%. Was confirmed to be increasing. Further, it was confirmed to be human IL-6 by Western blotting using an antibody specific to human IL-6 (Fig. 7).

FIG. 6 is an SDS-PAGE diagram of the yeast crude extract expressing each mutant, and the lanes 1 to 9 are as follows. 1; S.pombe / pTL2M (control) 2; S.pombe / pTL26m 3; S.pombe / pTL26a '4; S.pombe / pTL26a'C1 5; S.pombe / pTL26a'C2 6; S.pombe / pTL26a''C37; S.pombe / pTL26C1 8; S.pombe / pTL26C2 9; S.pombe / pTL26C3

FIG. 7 is a Western blotting diagram of a yeast crude extract expressing each mutant, and the lanes 1 to 9 are as follows. 1; S.pombe / pTL2M (control) 2; S.pombe / pTL26m 3; S.pombe / pTL26a '4; S.pombe / pTL26a'C1 5; S.pombe / pTL26a'C2 6; S.pombe / pTL26a''C37; S.pombe / pTL26C1 8; S.pombe / pTL26C2 9; S.pombe / pTL26C3

Example 9 Purification of IL-6 and IL-6 variants expressed in yeast

IL-6 and IL expressed in Example 8
The -6 mutant was purified as follows. Yeast expressing IL-6 and IL-6 variants had 50 mM Na
Suspend in a Tris-HCl (pH 7.5) buffer containing Cl and 1.5 mM EDTA, and centrifuge the supernatant at 1,000 rpm for 5 minutes.
A sedimentation was obtained by centrifugation at 15,000 rpm for 20 minutes. This fraction was solubilized with 6M guanidine hydrochloride and then desalted with Biogel p6. The void volume fraction was directly charged to reverse phase column chromatography using HPLC and purified IL
-6 and IL-6 variants were obtained.

After being adsorbed with an aqueous solution containing 0.1% TFA (trifluoroacetic acid), 30% acetonitrile was added.
The column was washed with a 0.1% TFA aqueous solution. The IL-6 and IL-6 variants were then eluted by increasing to 80%. The purity can be assayed by SDS-PAGE (using a TEFCO 16% gel), and a unique band was confirmed by Coomassie Brilliant Blue staining (Fig. 8).

FIG. 8 shows the SD of each purified IL-6 variant.
It is a S-PAGE figure, and each lane of 1-8 is as follows. 1; IL-6 (control) 2; IL-6C1 3; IL-6C2 4; IL-6C3 5; IL-6a'6;IL-6a'C17;IL-6a'C28;IL-6a'C3

Example 10 Biological activity of IL-6 and IL-6 variants

(1) Measurement of proliferative activity of 7TD1 cells Samples were diluted 10-fold in 100 μl of culture medium (RPMI1640: GABCO), and 2 × 10 ³ 7TD1 cells (mouse- (Mouse hybrid) was cultured at 37 ° C. for 4 days. Thereafter, the number of cells was measured using MTT (cell proliferation measurement kit: manufactured by CHEMICON).

(2) Production of fibrinogen from HepG2 2 × 10 ⁵ HepG2 cells (human hepatoma) were plated on a 24-well plate in an amount of 1 micromol of dexamethasone and 2% F.
After culturing for 24 hours using MEM medium containing CS (fetal bovine serum), the above medium containing various concentrations of the sample (5
The medium was replaced with 00 μl) and cultured for 18 hours, then replaced with a medium (400 μl) containing the same sample and further cultured for 6 hours, the culture was terminated, and the fibrinogen concentration produced in the medium was measured by an ELISA method.

(3) Measurement of proliferation promoting activity of megakaryocytes Bone marrow cells were collected from the femur of C57BL / 6 mice,
After removing adherent cells by treatment with Iscove's solution containing 10% horse serum for 45 minutes, 100 μl containing 10 ⁵ cells in 100 μl Iscove's solution containing 2-fold diluted sample
Iscove's solution was added and the cells were cultured at 37 ° C for 6 days. After completion of the culture, remove the supernatant and remove 180 μl of cell lysate (0.2% Triton X-100 / 1mM EDTA, 0.12M NaCl
mM HEPES buffer pH 7.5) was added, 20 μl of acetylthiocholine (final concentration 0.56 mM) was further added, and the mixture was allowed to stand at room temperature for 3 hours. Then, 20 μl of each was dispensed into a 96-well plate, and 20 μl of 0.4 mM 7-diethylamino-3-
(4'-Maleimidylphenyl) -4-methylcoumarin was added and 160 μl of diluted solution (0.2% TritonX-100,
After adding 50 mM sodium acetate (pH 5.0) containing 1 mM EDTA, the fluorescence intensity was measured (390 nmEX, 450 nm EM).

IL using the methods shown in (1) to (3)
The biological activity of -6 and IL-6 variants was measured.
The results are shown in Table 2. Each value in Table 2 is 50 of maximum activity
Represents the concentration of sample required to indicate%.

From now on, IL-6a ′, IL-6C1 and IL-6a′C1 are equivalent to or more than the activity of the natural type (2 to 8).
It can be seen that it succeeded in lowering the molecular weight while having double the activity. It was found that the region formed by the disulfide bond from Cys 44 to Cys 50 and the region from Gly 5 to Leu 19 had no direct effect on the activity. IL-6C2, IL-6C3, IL
The biological activities of -6a'C2 and IL-6a'C3 are significantly decreased. It is shown that the disulfide bond formed between Cys 73 and Cys 83 plays an important role in stabilizing natural IL-6 [indicated by "(IL-6)" in Table 2].

[0083]

[Table 2]

The above results can be summarized as follows.
By deleting 15 amino acids and / or the peptide loop formed by Cys-Cys, the molecular weight was successfully reduced while maintaining the activity equivalent to or higher than the natural type. IL-6C1 and IL-6a'C1 were successfully increased in production. This is probably because the amino acid having a codon that is not convenient for expression was removed. Purification efficiency was improved for mutants other than IL-6a ', which is due to the SH of Cys.
This is probably because the disulfide bond due to the group was removed, and thus the error in forming the tertiary structure was reduced. Also Cys
It is suggested that since the disulfide bond due to the SH group possessed by is possessed, it can exist stably in both oxidation / reduction state. Further, when produced using yeast, unlike the case of production in E. coli, there is no E. coli-derived impurity that causes side effects such as fever, and thus the safety is high.

[0085]

INDUSTRIAL APPLICABILITY As compared with natural IL-6, a low-molecular-weight IL-6 mutant was obtained, and its structural stability was improved. Moreover, it was possible to obtain an IL-6 mutant having a physiological activity equivalent to or higher than that of the natural type.

Also, using recombinant DNA technology, this
It was possible to produce L-6 variants. That is, yeast
This IL-6 mutant could be efficiently produced by S. pombe by using a novel vector that can be expressed in S. pombe, and the production amount could be increased.

[0087]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 507 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Denatured cDNA sequence CCA GTA CCA CCA ACC TCT TCA GAA CGT ATT GAC AAA CAG ATT CGG TAC 48 Pro Val Pro Pro Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr 1 5 10 15 ATC CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA TGT AAC AAG AGT 96 Ile Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Cys Asn Lys Ser 20 25 30 AAC ATG TGT GAA AGC AGC AAA GAG GCA CTG GCA GAA AAC AAC CTG AAC 144 Asn Met Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu Asn Asn Leu Asn 35 40 45 CTT CCA AAG ATG GCT GAA AAA GAT GGA TGC TTC CAA TCT GGA TTC AAT 192 Leu Pro Lys Met Ala Glu Lys Asp Gly Cys Phe Gln Ser Gly Phe Asn 50 55 60 GAG GAG ACT TGC CTG GTG AAA ATC ATC ACT GGT CTT TTG GAG TTT GAG 240 Glu Glu Thr Cys Leu Val Lys Ile Ile Thr Gly Leu Leu Glu Phe Glu 65 70 75 80 GTA TAC CTA GAG TAC CTC CAG AAC AGA TTT GAG AGT AGT GAG GAA CAA 288 Val Tyr Leu Glu Tyr Leu Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln 85 90 95 GCC AGA GCT GTC CAG ATG AGT ACA AAA GTC CTG ATC CAG TTC CTG CAG 336 Ala Arg Ala Val Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln 100 105 110 AAA AAG GCA AAG AAT CTA GAT GCA ATA ACC ACC CCT GAC CCA ACC ACA 384 Lys Lys Ala Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr 115 120 125 AAT GCC AGC CTG CTG ACG AAG CTG CAG GCA CAG AAC CAG TGG CTG CAG 432 Asn Ala Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln 130 135 140 GAC ATG ACA ACT CAT CTC ATT CTG CGC AGC TTT AAG GAG TTC CTG CAG 480 Asp Met Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu Phe Leu Gln 145 150 155 160 TCC AGC CTG AGG GCT CTT CGG CAA ATG 507 Ser Ser Leu Arg Ala Leu Arg Gln Met 165 SEQ ID NO: 2 Sequence length: 531 Sequence type: Nucleic acid Number of strands: Duplex topology: Linear Type of sequence: Other nucleic acid Modified cDNA sequence CCA GTA CCC CCA GGA GAA GAT TCC AAA GAT GTA GCC GCC CCA CAC AGA 48 Pro Val Pro Pro Gly Glu Asp Ser Lys Asp Val Ala Ala Pro His Arg 1 5 10 15 CAG CCA CTC ACC TCT TCA GAA CGA ATT GAC AAA CAA ATT CGG TAC ATC 96 Gln Pro Leu Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr Ile 20 25 30 CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA GAA AGC AGC AAA GAG 144 Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Glu Ser Ser Lys Glu 35 40 45 GCA CTG GCA GAA AAC AAC CTG AAC CTT CCA AAG ATG GCT GAA AAA GAT 192 Ala Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met Ala Glu Lys Asp 50 55 60 GGA TGC TTC CAA TCT GGA TTC AAT GAG GAG ACT TGC CTG GTG AAA ATC 240 Gly Cys Phe Gln Ser Gly Phe Asn Glu Glu Thr Cys Leu Val Lys Ile 65 70 75 80 ATC ACT GGT CTT TTG GAG TTT GAG GTA TAC CTA GAG TAC CTC CAG AAC 288 Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr Leu Glu Tyr Leu Gln Asn 85 90 95 AGA TTT GAG AGT AGT GAG GAA CAA GCC AGA GCT GTC CAG ATG AGT ACA 336 Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg Ala Val Gln Met Ser Thr 100 105 110 AAA GTC CTG ATC CAG TTC CTG CAG AAA AAG GCA AAG AAT CTA GAT GCA 384 Lys Val Leu Ile Gln Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp Ala 115 120 125 A TA ACC ACC CCT GAC CCA ACC ACA AAT GCC AGC CTG CTG ACG AAG CTG 432 Ile Thr Thr Pro Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr Lys Leu 130 135 140 CAG GCA CAG AAC CAG TGG CTG CAG GAC ATG ACA ACT CAT CTC ATT CTG 480 Gln Ala Gln Asn Gln Trp Leu Gln Asp Met Thr Thr His Leu Ile Leu 145 150 155 160 CGC AGC TTT AAG GAG TTC CTG CAG TCC AGC CTG AGG GCT CTT CGG CAA 528 Arg Ser Phe Lys Glu Phe Leu Gln Ser Ser Leu Arg Ala Leu Arg Gln 165 170 175 ATG 531 Met 177 SEQ ID NO: 3 Sequence length: 519 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Denatured cDNA sequence CCA GTA CCC CCA GGA GAA GAT TCC AAA GAT GTA GCC GCC CCA CAC AGA 48 Pro Val Pro Pro Gly Glu Asp Ser Lys Asp Val Ala Ala Pro His Arg 1 5 10 15 CAG CCA CTC ACC TCT TCA GAA CGA ATT GAC AAA CAA ATT CGG TAC ATC 96 Gln Pro Leu Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr Ile 20 25 30 CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA TGT AAC AAG AGT AAC 144 Leu Asp Gly Ile Ser Ala Leu Ar g Lys Glu Thr Cys Asn Lys Ser Asn 35 40 45 ATG TGT GAA AGC AGC AAA GAG GCA CTG GCA GAA AAC AAC CTG AAC CTT 192 Met Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu Asn Asn Leu Asn Leu 50 55 60 CCA AAG ATG GCT GAA AAA GAT GGA CTG GTG AAA ATC ATC ACT GGT CTT 240 Pro Lys Met Ala Glu Lys Asp Gly Leu Val Lys Ile Ile Thr Gly Leu 65 70 75 80 TTG GAG TTT GAG GTA TAC CTA GAG TAC CTC CAG AAC AGA TTT GAG AGT 288 Leu Glu Phe Glu Val Tyr Leu Glu Tyr Leu Gln Asn Arg Phe Glu Ser 85 90 95 AGT GAG GAA CAA GCC AGA GCT GTC CAG ATG AGT ACA AAA GTC CTG ATC 336 Ser Glu Glu Gln Ala Arg Ala Val Gln Met Ser Thr Lys Val Leu Ile 100 105 110 CAG TTC CTG CAG AAA AAG GCA AAG AAT CTA GAT GCA ATA ACC ACC CCT 384 Gln Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp Ala Ile Thr Thr Pro 115 120 125 GAC CCA ACC ACA AAT GCC AGC CTG CTG ACG AAG CTG CAG GCA CAG AAC 432 Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn 130 135 140 CAG TGG CTG CAG GAC ATG ACA ACT CAT CTC ATT CTG CGC AGC TTT AAG 480 Gln Trp Leu Gln Asp Met Thr Thr His Leu Ile Leu Arg Ser Phe Lys 145 150 155 160 GAG TTC CTG CAG TCC AGC CTG AGG GCT CTT CGG CAA ATG 519 Glu Phe Leu Gln Ser Ser Leu Arg Ala Leu Arg Gln Met 165 170 173 SEQ ID NO: 4 Sequence Length : 498 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Modified cDNA sequence CCA GTA CCC CCA GGA GAA GAT TCC AAA GAT GTA GCC GCC CCA CAC AGA 48 Pro Val Pro Pro Gly Glu Asp Ser Lys Asp Val Ala Ala Pro His Arg 1 5 10 15 CAG CCA CTC ACC TCT TCA GAA CGA ATT GAC AAA CAA ATT CGG TAC ATC 96 Gln Pro Leu Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr Ile 20 25 30 CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA GAA AGC AGC AAA GAG 144 Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Glu Ser Ser Lys Glu 35 40 45 GCA CTG GCA GAA AAC AAC CTG AAC CTT CCA AAG ATG GCT GAA AAA GAT 192 Ala Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met Ala Glu Lys Asp 50 55 60 GGA CTG GTG AAA ATC ATC ACT GGT CTT TTG GAG TTT GAG GTA TAC CTA 240 Gly Leu Val Lys Ile Ile Thr Gl y Leu Leu Glu Phe Glu Val Tyr Leu 65 70 75 80 GAG TAC CTC CAG AAC AGA TTT GAG AGT AGT GAG GAA CAA GCC AGA GCT 288 Glu Tyr Leu Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg Ala 85 90 95 GTC CAG ATG AGT ACA AAA GTC CTG ATC CAG TTC CTG CAG AAA AAG GCA 336 Val Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln Lys Lys Ala 100 105 110 AAG AAT CTA GAT GCA ATA ACC ACC CCT GAC CCA ACC ACA AAT GCC AGC 384 Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr Asn Ala Ser 115 120 125 CTG CTG ACG AAG CTG CAG GCA CAG AAC CAG TGG CTG CAG GAC ATG ACA 432 Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln Asp Met Thr 130 135 140 ACT CAT CTC ATT CTG CGC AGC TTT AAG GAG TTC CTG CAG TCC AGC CTG 480 Thr His Leu Ile Leu Arg Ser Phe Lys Glu Phe Leu Gln Ser Ser Leu 145 150 155 160 AGG GCT CTT CGG CAA ATG 498 Arg Ala Leu Arg Gln Met 165 166 SEQ ID NO: 5 Sequence length: 486 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Modified cDNA sequence CCA GTA CCC CCA ACC TCT TCA GAA CGA
ATT GAC AAA CAA ATT CGG TAC 48 Pro Val Pro Pro Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr 1 5 10 15 ATC CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA GAA AGC AGC AAA 96 Ile Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Glu Ser Ser Lys 20 25 30 GAG GCA CTG GCA GAA AAC AAC CTG AAC CTT CCA AAG ATG GCT GAA AAA 144 Glu Ala Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met Ala Glu Lys 35 40 45 GAT GGA TGC TTC CAA TCT GGA TTC AAT GAG GAG ACT TGC CTG GTG AAA 192 Asp Gly Cys Phe Gln Ser Gly Phe Asn Glu Glu Thr Cys Leu Val Lys 50 55 60 ATC ATC ACT GGT CTT TTG GAG TTT GAG GTA TAC CTA GAG TAC CTC CAG 240 Ile Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr Leu Glu Tyr Leu Gln 65 70 75 80 AAC AGA TTT GAG AGT AGT GAG GAA CAA GCC AGA GCT GTC CAG ATG AGT 288 Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg Ala Val Gln Met Ser 85 90 95 ACA AAA GTC CTG ATC CAG TTC CTG CAG AAA AAG GCA AAG AAT CTA GAT 336 Thr Lys Val Leu Ile Gln Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp 100 105 110 GC A ATA ACC ACC CCT GAC CCA ACC ACA AAT GCC AGC CTG CTG ACG AAG 384 Ala Ile Thr Thr Pro Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr Lys 115 120 125 CTG CAG GCA CAG AAC CAG TGG CTG CAG GAC ATG ACA ACT CAT CTC ATT 432 Leu Gln Ala Gln Asn Gln Trp Leu Gln Asp Met Thr Thr His Leu Ile 130 135 140 CTG CGC AGC TTT AAG GAG TTC CTG CAG TCC AGC CTG AGG GCT CTT CGG 480 Leu Arg Ser Phe Lys Glu Phe Leu Gln Ser Ser Leu Arg Ala Leu Arg 145 150 155 160 CAA ATG 486 Gln Met 162 SEQ ID NO: 6 Sequence length: 474 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid denaturation cDNA sequence CCA GTA CCC CCA ACC TCT TCA GAA CGA ATT GAC AAA CAA ATT CGG TAC 48 Pro Val Pro Pro Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr 1 5 10 15 ATC CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA TGT AAC AAG AGT 96 Ile Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Cys Asn Lys Ser 20 25 30 AAC ATG TGT GAA AGC AGC AAA GAG GCA CTG GCA GAA AAC AAC CTG AAC 144 Asn Met Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu Asn Asn Leu Asn 35 40 45 CTT CCA AAG ATG GCT GAA AAA GAT GGA CTG GTG AAA ATC ATC ACT GGT 192 Leu Pro Lys Met Ala Glu Lys Asp Gly Leu Val Lys Ile Ile Thr Gly 50 55 60 CTT TTG GAG TTT GAG GTA TAC CTA GAG TAC CTC CAG AAC AGA TTT GAG 240 Leu Leu Glu Phe Glu Val Tyr Leu Glu Tyr Leu Gln Asn Arg Phe Glu 65 70 75 80 AGT AGT GAG GAA CAA GCC AGA GCT GTC CAG ATG AGT ACA AAA GTC CTG 288 Ser Ser Glu Glu Gln Ala Arg Ala Val Gln Met Ser Thr Lys Val Leu 85 90 95 ATC CAG TTC CTG CAG AAA AAG GCA AAG AAT CTA GAT GCA ATA ACC ACC 336 Ile Gln Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp Ala Ile Thr Thr 100 105 110 CCT GAC CCA ACC ACA AAT GCC AGC CTG CTG ACG AAG CTG CAG GCA CAG 384 Pro Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr Lys Leu Gln Ala Gln 115 120 125 AAC CAG TGG CTG CAG GAC ATG ACA ACT CAT CTC ATT CTG CGC AGC TTT 432 Asn Gln Trp Leu Gln Asp Met Thr Thr His Leu Ile Leu Arg Ser Phe 130 135 140 AAG GAG TTC CTG CAG TCC AGC CTG AGG GCT CTT CGG CAA ATG 474 Lys Glu Phe Leu Gln Ser Ser Leu Arg Ala Leu Arg Gln Met 145 150 155 158 SEQ ID NO: 7 Sequence length: 453 Sequence type: Nucleic acid Strand number: Double stranded Topology: Linear Sequence type: Other nucleic acid Denatured cDNA sequence CCA GTA CCC CCA ACC TCT TCA GAA CGA ATT GAC AAA CAA ATT CGG TAC 48 Pro Val Pro Pro Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr 1 5 10 15 ATC CTC GAC GGC ATC TCA GCC CTG AGA AAG GAG ACA GAA AGC AGC AAA 96 Ile Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Glu Ser Ser Lys 20 25 30 GAG GCA CTG GCA GAA AAC AAC CTG AAC CTT CCA AAG ATG GCT GAA AAA 144 Glu Ala Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met Ala Glu Lys 35 40 45 GAT GGA CTG GTG AAA ATC ATC ACT GGT CTT TTG GAG TTT GAG GTA TAC 192 Asp Gly Leu Val Lys Ile Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr 50 55 60 CTA GAG TAC CTC CAG AAC AGA TTT GAG AGT AGT GAG GAA CAA GCC AGA 240 Leu Glu Tyr Leu Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg 65 70 75 80 GCT GTC CAG ATG AGT ACA AAA GTC CTG ATC CAG TTC CTG CAG AAA AAG 288 Ala Val Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln Lys Lys 85 90 95 GCA AAG AAT CTA GAT GCA ATA ACC ACC CCT GAC CCA ACC ACA AAT GCC 336 Ala Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr Asn Ala 100 105 110 AGC CTG CTG ACG AAG CTG CAG GCA CAG AAC CAG TGG CTG CAG GAC ATG 384 Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln Asp Met 115 120 125 ACA ACT CAT CTC ATT CTG CGC AGC TTT AAG GAG TTC CTG CAG TCC AGC 432 Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu Phe Leu Gln Ser Ser 130 135 140 CTG AGG GCT CTT CGG CAA ATG 453 Leu Arg Ala Leu Arg Gln Met 145 150 151

[Brief description of drawings]

FIG. 1 Amino acid sequence of human IL-6

[Fig.2] Vector construction of pRL2L

[Figure 3] Vector configuration diagram of pRL2M

[Figure 4] Vector configuration diagram of pTL2M

[Fig. 5] Vector configuration diagram of pTL26m

FIG. 6 SDS-polyacrylamide gel electrophoresis diagram

[Figure 7] Western blotting diagram

FIG. 8: SDS-polyacrylamide gel electrophoresis diagram

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12P 21/02 C 9282-4B // A61K 38/00 ABB ABY (C12N 1/19 C12R 1:85 ) (C12P 21/02 C12R 1:85) A61K 37/02 ABY

Claims (14)

[Claims] 1. In the amino acid sequence of human interleukin-6, 5th from the N-terminal Gly to 19th Le.
deletion up to u, deletion from Cys 44th to 50th Cys from N-terminus, and Cy 73rd from N-terminus
An interleukin-6 mutant comprising an amino acid sequence having at least one deletion selected from the deletion from s to the 83rd Cys. 2. In the amino acid sequence of human interleukin-6, 5th from the N-terminal Gly to 19th Le.
An interleukin-6 mutant consisting of an amino acid sequence having deletions up to u. 3. In the amino acid sequence of human interleukin-6, the 44th Cys to the 50th from the N-terminal
An interleukin-6 mutant consisting of an amino acid sequence having deletions up to Cys. 4. In the amino acid sequence of human interleukin-6, 5th from the N-terminal Gly to 19th Le.
An interleukin-6 variant consisting of an amino acid sequence having deletions up to u and deletions from Cys 44th to Cys 50th from the N-terminus. 5. An interleukin-6 mutant selected from claims 1 to 4, which is an interleukin-6 mutant obtained by recombinant DNA technology. 6. A DNA sequence encoding one interleukin-6 variant selected from claims 1-4. 7. An expression vector having the DNA sequence of claim 6. 8. The expression vector according to claim 7, which further comprises an origin of replication functional in a eukaryotic host, and a promoter region derived from an animal cell virus. 9. The eukaryotic host is the yeast Schizosaccharomyces
The expression vector of claim 8, which is Pombe (Schizosaccharomyces pombe). 10. The expression vector according to claim 8, wherein the promoter region derived from an animal cell virus is a promoter region derived from SV40 or cytomegalovirus. 11. A neomycin resistance gene region,
One expression vector selected from the claims 7 to 10, comprising at least one of the LEU 2 gene region and the URA 3 gene region. 12. A transformant transformed with one of the expression vectors selected from claims 8 to 11. 13. The transformant according to claim 12, wherein the host is the yeast Schizosaccharomyces pombe. 14. The transformant according to claim 12 or 13 is cultured in a medium, and the interleukin-6 variant according to any one of claims 1 to 4 is produced and accumulated in the culture.
Interleukin-6 characterized by collecting this
Method for producing mutant.