JPH07165796A - Signal peptide for expressing thrombomodulins - Google Patents

Abstract

PURPOSE:To obtain the subject signal peptide, having a specific amino acid sequence and capable of selectively providing only a thrombomodulin, manifesting anticoagulant actions, useful as an active ingredient of an anticoagulant and having an N-terminal amino acid sequence essential thereto. CONSTITUTION:This signal peptide for expressing thrombomodulins has an amino acid sequence expressed by the formula. The thrombomodulins having an N-terminal amino acid sequence essential thereto are obtained by joining a base sequence capable of coding the amino acid sequence of the signal peptide, synthesized according to a solid-phase synthetic method, etc., and used for expressing the thrombomodulins, a base sequence composed of an initiation codon, a liposome-binding site and a promoter to the upstream side of a base sequence capable of coding an amino acid sequence of the thrombomodulins, joining a termination codon and a base sequence capable of acting as a polyA addition signal to the downstream side of the base sequence capable of coding the thrombomodulins, synthesizing a recombinant vector, transducing the resultant recombinant vector into a host cell, transforming the host cell, then culturing the transformant cell and collecting the obtained product from the culture.

Description

Detailed Description of the Invention

[0001]

INDUSTRIAL APPLICABILITY The present invention can encode a novel signal peptide having an anticoagulant effect and the like and capable of selectively expressing thrombomodulins useful as a medicine, and an amino acid sequence of the signal peptide. DNA
Fragment, DNA fragment having a nucleotide sequence capable of encoding amino acid sequence of the signal peptide and thrombomodulin, recombinant vector containing the DNA fragment, transformant cell carrying the recombinant vector, and transformant cell The present invention relates to a method for producing thrombomodulins.

[0002]

2. Description of the Related Art Various studies have been conducted on the role of thrombin as a proteolytic enzyme in the blood coagulation system, and the mechanism of the coagulation system has been largely clarified.

Thrombin activates protein C, which is said to act on the anticoagulant system and fibrinolytic system in vivo, and that a factor which acts as a coenzyme on the mechanism is present in rabbit lung tissue extracts. Has been reported,
This factor is designated thrombomodulin [N.
L. Esmon et al. J. Biol. Che
m. , 257, (2), 859-864 (198).
2)]. Aoki et al. Reported a human thrombomodulin with a molecular weight of about 71,000 (non-reduced state) having similar properties, which was isolated from human placenta [Thromb. Re
s. , 37, 353-364 (1985)]. Also,
H. Ishii et al. Showed that a substance having the same activity as thrombomodulin was present in human plasma and urine, and that the molecular weight of the substance in plasma was about 63,000 and about 54,
000 is reported [J. Clin. In
vest. , 76, 2178-2181 (198)
5)]. Regarding urine-derived thrombomodulin, thereafter, those having a molecular weight of about 39,000 and about 31,000 (JP-A-63-146898), a molecular weight of about 56,
000 and about 63,000 (JP-A-3-8690)
No. 0), molecular weights of about 72,000 and about 79,000.
No .: UTM (Japanese Patent Laid-Open No. 3-218399), etc. have been reported.

On the other hand, K. Suzuki et al. Cloned the human thrombomodulin precursor gene containing a signal peptide from a human lung cDNA library using genetic engineering techniques, elucidated the entire gene structure of thrombomodulin, and revealed the amino acid sequence of 557 residues. [EMBO J. 6,1891-1897 (198
7)]. Subsequently, various human thrombomodulins having different numbers of amino acids were produced by genetic engineering and reported [WO 88/5053 (full-length human thrombomodulin, N-terminal 498th Gl from Ala).
y), JP-A-63-301791 (full-length human thrombomodulin including signal peptide), W
O 88/09811 (497 from 307th Asp)
From the th Ser to the 307th Asp to the 469th Gly), WO 90/100081 (216th His to 468th Asp, 216th H
from is to the 464th Ser), Japanese Patent Laid-Open No. 2-2
No. 55699 (365th Gln to 462th C
up to ys), JP-A-3-259084 (N-terminal Al
a to 468th Asp: r-UTM), WO
92/325 (from near the N-terminus to near the 447th Ile) and the like].

Further, when thrombodulin is produced by genetic engineering, thrombomodulin modified with glycosaminoglycan is simultaneously produced, which is reported to exhibit an antithrombin III activity enhancing action [EP412841 (N-terminal From Ala of Ser to 497th Ser), WO 91/4276 (N-terminal Ala)
To 498th Gly), WO 91/58
03 (N-terminal Ala to 491st Ala) and the like].

Furthermore, the present applicant expresses the DNA by transforming a host cell with a recombinant vector into which a specific DNA fragment at the 3'-end of the above-mentioned DNA fragment encoding r-UTM is incorporated. By antithrombin
III It was found that thrombomodulin (r-GAG-UTM) having an activity enhancing effect and a platelet aggregation inhibiting effect was obtained, and a patent application was made (EP Publication 488317).

[0007]

These thrombomodulins are obtained by culturing a transformant cell carrying a recombinant vector consisting of a DNA fragment containing a DNA sequence encoding its amino acid sequence and a replicable expression vector. Being manufactured.

[0008] However, thrombomodulin expressed and produced in a host vector system has a problem in that there are mixed N-terminal amino acid sequences different from the original ones, and it is difficult to isolate and purify only the desired product. It was

For example, in the above r-GAG-UTM,
Highly active r-GAG-UTM1 (hereinafter, GAG-UT
M) has the amino acid sequence shown in SEQ ID NO: 4,
It is produced by culturing a transformant cell carrying a recombinant vector consisting of a replicable expression vector and the DNA fragment shown in SEQ ID NO: 5 containing the DNA sequence encoding the amino acid sequence. The N-terminal amino acid sequence of the GAG-UTM produced in E. coli was produced in addition to the original polypeptide starting with Ala (1) and Phe.
There is a problem that it is difficult to isolate and purify only the target substance because the polypeptides starting with (-2) are mixed.

Therefore, it is an object of the present invention to provide a signal peptide that expresses only thrombomodulin whose N-terminal amino acid sequence is native.

[0011]

Under such circumstances, the present inventors have conducted extensive studies to solve the above-mentioned problems, and as a result, the conventional method was found to have a structure of a signal sequence which is cleaved when a protein is secreted. Therefore, a DNA encoding a modified signal sequence was prepared, ligated to pBPV to construct a thrombomodulin expression vector,
This was introduced into host cells. When this cell was cultured and thrombomodulins were isolated from the culture medium and analyzed for the N-terminal amino acid sequence, the original polypeptide starting with Ala (1) was observed and the polypeptide starting with Phe (-2) was not detected. It was found that the present invention has been completed.

That is, the present invention encodes a signal peptide for expressing thrombomodulins having the amino acid sequence represented by SEQ ID NO: 1, a DNA fragment capable of encoding the amino acid sequence of the signal peptide, and an amino acid sequence of the signal peptide and thrombomodulins. The present invention provides a DNA fragment having the obtained nucleotide sequence, a recombinant vector containing this DNA fragment, a transformant cell carrying the recombinant vector, and a method for producing thrombomodulins using the transformant cell.

The signal peptide of the present invention has the amino acid sequence represented by SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment encoding this peptide is represented by SEQ ID NO: 2. This DNA can be synthesized by a conventional method, for example, using an automatic DNA synthesizer.

In the synthesis, it is preferable to add a restriction enzyme site, which can be used for binding to a vector, to the 5'end of the present DNA fragment. In addition, it is preferable to add an appropriate restriction enzyme site necessary for binding to the DNA fragment encoding the amino acid sequence of thrombomodulin to the 3'end side of the present DNA fragment. Furthermore, when this DNA fragment is too long and difficult to synthesize, it is preferable to divide it into two or more. More preferably, a DNA fragment complementary to the above DNA fragment is preferably synthesized so as to form a cohesive end.

The DNA synthesized as described above is ligated with a cloning vector having a necessary portion of a DNA fragment coding for the amino acid sequence of thrombomodulins cleaved with an appropriate restriction enzyme to transform a microorganism. By extracting plasmid DNA from the obtained transformant and cutting it with a restriction enzyme, a DNA fragment having a nucleotide sequence capable of encoding the amino acid sequences of the signal peptide and thrombomodulins can be obtained. Here, as the thrombomodulins, in addition to the GAG-UTM, natural or recombinant thrombomodulins (J. Biol. Chem., Which has a structure starting from N-terminal Ala).
257, (2), 859-864 (1982), Thr.
omb. Res. , 37, 353-364 (198)
5), J. Clin. Invest. 76,2178-
2181 (1985), JP-A-63-146898,
JP-A-3-86900, JP-A-3-218399,
EMBO J.M. 6,1891-1897 (1987),
WO 88/5053, JP-A-63-301791,
WO 88/09811, WO 90/1081, JP-A-2-255699, JP-A-3-259084, W
O 92/325, WO91 / 4276, EP4128
41, WO 91/5803, EP publication 488317).
Etc.

To construct a recombinant expression vector containing this DNA fragment, a replicable expression vector may be connected to the fragment. The expression vector, if replicable, derived from E. coli and other prokaryotes, derived from yeast,
Any vector such as insect virus-derived and vertebrate virus-derived may be used.

However, in order to efficiently produce a thrombin-binding substance, the following (1)-
(7) base sequence, (1) base sequence acting as a promoter (2) ribosome binding site base sequence (3) initiation codon base sequence (4) SEQ ID NO: 1 encoding the amino acid sequence of the signal peptide Obtained nucleotide sequence (5) A nucleotide sequence capable of encoding an amino acid sequence of thrombomodulins (6) A nucleotide sequence that is a stop codon (7) A nucleotide sequence that acts as a poly-A addition signal is preferably constructed. .

The DNA used as a vector is preferably a plasmid. For example, it can be amplified using E. coli as a host,
A plasmid capable of expressing the inserted gene by transforming mammalian cells is preferable. Such a plasmid DNA has a nucleotide sequence necessary for propagation of the plasmid in E. coli cells, for example, a nucleotide sequence of origin of replication of ColE1 type plasmid, and further functions as a promoter in mammalian cells. SV40 ori, polyoma ori, HS containing a gene serving as a selectable marker for Escherichia coli, a gene serving as a selectable marker for transformed mammalian cells, and more preferably functioning in mammalian cells
V ori Contains a replication origin base sequence such as bovine papilloma virus ori. Examples of the promoter include promoters of cytomegalovirus, SV40, polyoma virus, bovine papilloma virus, adenovirus, LTR of retrovirus such as MMTV, and promoter of metallothionein gene. Examples of E. coli selection markers include ampicillin resistance gene,
Examples include kanamycin resistance gene, tetracycline resistance gene, chloramphenicol resistance gene, and the like. Examples of selectable markers for mammalian cells include neomycin resistance gene, hygromycin B resistance gene, thymidine kinase gene, dihydrofolate reductase gene,
Examples include xanthine guanine phosphoribosyl transferase gene, and one or more of these genes are used.

In order to incorporate the DNA fragment of the present invention into the above vector, the DNA containing it is cleaved with an appropriate restriction enzyme, and if necessary an appropriate linker is added, and then the vector is cleaved with an appropriate restriction enzyme. It is performed by binding. Examples of the restriction enzyme used include EcoR
I, SphI, PstI, HindIII, BamHI,
XhoI, XbaI, BanIII, SmaI, Nco
I, NotI and the like. Further, nucleic acid-modifying enzymes such as exonuclease III, Ba131, S1 nuclease, exonuclease VII, Mung bean nuclease and DNA polymerase I can also be used. Examples of the linker used include EcoRI linker, SmaI linker, NcoI linker, BamHI linker, Xh.
An oI linker, HindIII linker, PstI linker, SphI linker, XbaI linker, NotI linker and the like can be used.

The obtained recombinant vector for expression is introduced into a host cell by the competent cell method, protoplast method, calcium phosphate coprecipitation method, electroporation method, DEAE dextran method, lipofectin method, etc. A transformant cell having the ability to efficiently produce the recombinant vector and / or thrombomodulin is obtained. As a host cell for obtaining such a transformant cell, a unicellular microorganism such as bacteria or yeast, a cultured insect cell, or a cultured vertebrate cell is preferable. When E. coli is used as a host, E. Various mutants of E. coli strain K12, such as HB101, C600K, JM101, JM
103, JM105, JM109, MV1034, MV
1184, MC1061 / P3, etc. can be used. When cultured mammalian cells are used as hosts, COS cells, CHO
Cells, L cells, C127 cells, NIH3T3 cells, He
La cells and the like can be used.

Thrombomodulins are produced by culturing the obtained transformant cells and extracting and separating from the cultured cells and / or the culture solution. In culturing the transformant cells, various natural media and synthetic media are used. The medium preferably contains carbon sources such as sugars, alcohols and organic acid salts; nitrogen sources such as protein mixtures, amino acids and ammonium salts; and inorganic salts. Furthermore,
It is desired to add vitamins and antibiotics corresponding to the selectable marker gene. If the vector can control the expression, it is necessary to add an operation for inducing gene expression during the culture. After culturing, centrifugation or the like is performed to separate the culture solution and the cultured cells. When thrombomodulins are likely to accumulate in cultured cells, for example, freeze-thaw, ultrasonic treatment, French press, enzyme treatment, homogenizer, etc. are used to disrupt the cells, and then, for example, EDTA, a surfactant, urea, guanidine hydrochloride. It is necessary to solubilize the thrombin-binding substance using, for example,

Purified thrombomodulins can be obtained by subjecting the obtained culture solution or cultured cell extract containing thrombomodulins to various column chromatography. As column chromatography, ion exchange chromatography, affinity chromatography (for example, using the monoclonal antibody described in JP-A-64-45398), gel filtration chromatography and the like can be used alone or in combination.

Among the thrombomodulins thus obtained, GAG-UT having the amino acid sequence of SEQ ID NO: 4
M has the following properties. (1) Amino acid sequence From the base sequence of the DNA fragment, the amino acid sequence of GAG-UTM is judged to be as shown in SEQ ID NO: 1. (2) Molecular weight 70,000-92,000 (SDS-polyacrylamide gel electrophoresis, non-reducing state) (3) Isoelectric point (isoelectric focusing method using ampholine) pH 3.9-4.9 ( 4) Sugar analysis From the molecular weight, it is considered that multiple sugars are added, one of which is Ser (47) from the amino acid sequence.
It is presumed that acidic polysaccharide is added to 2 and / or 474). (5) Action a. It has a protein C activating effect. B. Has antithrombin activity. C. Enhances the activity of antitrobin III. D. It has an inhibitory effect on platelet aggregation.

The dosage form when thrombomodulin is used as an active ingredient of an anticoagulant includes, for example, injections. As an injection, when using lyophilized powder,
A form in which it is dissolved in distilled water for injection, physiological saline or the like for administration is preferable. A suitable site for administration is intravenous.

The dose is usually 10 μg to 10 mg / kg / day, although it varies depending on the severity of the disease, the body weight of the patient and the like. It should be noted that GAG-UTM is safe since no abnormality was observed within the above dose range.

[0026]

The present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.

Example 1 Construction of thrombomodulin (GAG-UTM1) expression vector: DNA synthesizer (ABI model 381)
Modified signal peptide and GAG-UTM using A)
DNA linker # 1 shown in SEQ ID NO: 6 encoding the amino acid sequence near the N-terminal of 1, DNA linker # 2 shown in SEQ ID NO: 7, and DNA linker # 3 shown in SEQ ID NO: 8 which is complementary to these DNA linkers. D shown in SEQ ID NO: 9
NA linker # 4 was synthesized, phosphorylated at the 5'end with polynucleotide kinase and then annealed to each other. Also, pCDM-GAG-UTM1 (EP48831
7) was digested with XhoI to obtain 1.68 kb GAG-
UTM DNA fragment cloning vector pUC118
Was ligated to the SalI site of After checking the insertion direction, Hin
It was cleaved with dIII and blunt-ended with T4 DNA polymerase. Phosphorylated BamHI linker d (pCGGATCCG) was ligated to the blunt-ended DNA using T4 DNA ligase, and further BamHI cleavage was performed. Bam
The HI-cut DNA fragment was blunt-ended again and NotI
After linking the linker d (pAGCGGCCGCT), Sm
A 1.46 kb SmaI-NotI fragment encoding Gly- (23) and subsequent fragments of GAG-UTM was prepared by digesting with aI and NotI and performing low melting point agarose gel electrophoresis. On the other hand, the cloning vector pUC118 was cleaved with SphI, blunt-ended, and ligated with a NotI linker to prepare Eco
A vector DNA fragment was prepared by digestion with RI and NotI and low melting point agarose gel electrophoresis. This and the previously annealed synthetic DNA linker, 1.40 kb SmaI-
Ligated with the NotI fragment and transformed into E. coli MV1304
Was transformed. A plasmid was extracted from the obtained transformant, a plasmid that was correctly cleaved by restriction enzyme digestion was selected, and the DNA nucleotide sequence was confirmed. 1.53 kb XhoI encoding a signal peptide-modified GAG-UTM was digested with XhoI and NotI and the plasmid carrying the inserted DNA fragment having the correct nucleotide sequence shown in SEQ ID NO: 10 was digested with low melting point agarose gel.
-A NotI fragment was prepared. On the other hand, the animal cell expression vector pBPV (Pharmacia) was used for XhoI and No.
It was cleaved with tI and a vector DNA fragment was prepared by low melting point agarose gel electrophoresis. This and the previous 1.53kb
Ligated with the XhoI-NotI fragment and transformed into E. coli H
B101 was transformed. A plasmid was extracted from the obtained transformant, a plasmid that was correctly cleaved by restriction enzyme digestion was selected, and the DNA nucleotide sequence was confirmed.
The vector of the present invention constructed as described above is used as pBPV-GA.
G-UTM1-GP (FIG. 1) and the transformant carrying the vector of the present invention were transformed into E. coli HB101 (pBPV
-GAG-UTM1-GP).

Example 2 Thrombomodulin (GAG-U) using cultured animal cells
TM): Calcium phosphate precipitation method using pBPV-GAG-UTM1-GP (Gorman, C.,
"DNA Cloning", IRL Press, E
ngland, 1985, Vol. 2, pp. 143-
190) were used to transfect mouse C127 cells. 8 × 10 ⁵ C127 on a 10 cm Petri dish
The cells were seeded, and the next day, the culture medium (10% FCS-added Dulbecco's modified Eagle's minimal medium; hereinafter referred to as medium) was replaced,
Four hours later, a coprecipitate of DNA and calcium phosphate was added. The coprecipitate was prepared as follows. Two
0 μg of pBPV-GAG-UTM1-GP and 100 ng
Plasmid containing the neomycin resistance gene of
1 mM Tris-HCl (pH 8.0) /0.1 mM EDTA
Dissolved in, and mixed with 50 μl of 2.5 M calcium chloride,
50 mM HEPES (pH 7.12), 280 mM sodium chloride, 1.5 mM sodium hydrogen phosphate solution 500 μl
The mixture was added dropwise to. After leaving it at room temperature for 30 minutes, it was added to the above cell culture medium and cultured for 24 hours. Then, after changing to a fresh medium and culturing for another 24 hours, 400 μg / ml of G418
The medium was replaced with a medium containing 5% FBS. After 10 days, the resulting colonies were transferred to a 24-well culture plate and further cultured until they became confluent. The culture supernatant was collected, the amount of secreted GAG-UTM was quantified, and high producing clones were selected. The selected clone was further cloned by the limiting dilution method. The obtained transformant cell line was designated as C
127-GUTM-GP-1, named FERM BP-44 at the Institute of Biotechnology, Institute of Biotechnology, Ministry of International Trade and Industry.
Deposited as 76.

Transformant cell line C127-GUTM-G
After culturing P-1 in a 1750 cm ² roller bottle using 5% FBS-added medium until confluent, 500
The medium was replaced with 1% FBS-supplemented medium. After culturing for one week, the culture supernatant was collected. 20 μg / ml of this GAG-UTM was secreted in the culture supernatant. Sepharose 4B (2 mg IgG / ml resin) to which the obtained culture broth was bound with monoclonal antibody A-73 (JP-A-64-45398)
Pass through a 5 ml column. The column was (1) 0.02 M Tris-hydrochloric acid buffer solution (pH) containing 0.1 M sodium chloride.
7.4) 10 ml, (2) 1M sodium chloride and 0.0
50 ml of 0.02 M Tris-HCl buffer (pH 7.4) containing 5% Tween 20, (3) 0.02 M Tris-HCl buffer (pH 7.4) containing 1 M sodium chloride 25
After washing sequentially with ml, 2M sodium thiocyanate and 5
0.0 with 1 M sodium chloride containing mM EDTA
Elution was performed with 25 ml of 2M Tris-hydrochloric acid buffer solution (pH 7.4). The eluate was dialyzed against 50 mM acetate buffer (pH 4.5) supplemented with 0.1 M sodium chloride and applied to the MonoQ column. After washing the column with the same buffer,
Purified GAG-UTM (3.0 mg) was obtained by elution with a linear concentration gradient method using a 50 mM acetate buffer (pH 4.5) containing 0.1 M to 2 M sodium chloride.

Example 3 N-terminal amino acid analysis of GAG-UTM produced by the above-mentioned method Using 150 μg of purified GAG-UTM, 10 residues from the N-terminal were analyzed by ABI protein sequencer 473A. As shown in Table 1, the N-terminal of GAG-UTM was correctly processed.

[0031]

[Table 1]

Example 4 Physical Properties of GAG-UTM: Purified GAG-UTM was La
Emmli's method (Nature, 227 , 680-6.
SDS-PAGE was performed according to 85). Mat the gel
udaira method [J. Biol. Chem. , 26
2 , (21), 10035-10038], PV
It was transferred to a DF film. Then, the PVDF membrane was reacted for 2 hours at room temperature in a 0.05 M Tris-hydrochloric acid buffer (TBS) solution containing 0.1 M sodium chloride containing 0.1% bovine serum albumin. Throw away the solution, 0.05% Twe
After thorough washing with TBS containing en20, monoclonal antibody A-6 labeled with horseradish peroxidase
TBS with 0.05% Tween 20 containing 0
The reaction was carried out at room temperature for 1 hour. Discard the solution, 0.05%
After thoroughly washing with TBS containing Tween 20, 3-
A 50 mM acetate buffer (pH 5.50) containing 5 mg of amino-9-ethylcarbazole and 25 μl of 30% hydrogen peroxide solution.
0) When added to 50 ml for color development, a broad band peculiar to the glycosaminoglycan adduct was confirmed.

Example 5 r-UTM and GAG-UTM (0.1 μg / ml) were each reacted with 5 μl of chondroitinase ABC (10 mU; manufactured by Seikagaku Corporation) at 37 ° C. for 40 minutes, and then carried out. Immunoblotting in the same manner as in Example 4 GA
G-UTM migrated to the low molecular weight region, but r-UTM was unchanged from untreated r-UTM. Therefore, GAG-U
It was confirmed that TM is covalently bound to a chondroitin sulfate type glycosaminoglycan.

[0034]

When thrombomodulins are produced using a DNA fragment having a nucleotide sequence capable of encoding the amino acid sequence of the signal peptide of the present invention, only the original N-terminal amino acid sequence of thrombomodulin can be obtained.

[0035]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 18 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence Met Leu Gly Val Leu Val Leu Gly Ala Leu Ala Leu Ala Gly Leu Val Phe Ser 5 10 15

SEQ ID NO: 2 Sequence length: 54 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Sequence ATGCTTGGGG TCCTGGTCCT TGGCGCGCTG GCCCTGGCCG GCCTGGTCTT CTCC 54

SEQ ID NO: 3 Sequence length: 1482 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Sequence ATGCTTGGGG TCCTGGTCCT TGGCGCGCTG GCCCTGGCCG GCCTGGTCTT CTCCGCACCC 60 GCAGAGCCGC AGCCGGGTGG CAGCCAGTGC GTCTAGCACG GCTCTACCCG 120 GGCCCCGCGA CCTTCCTCAA TGCCAGTCAG ATCTGCGACG GACTGCGGGG CCACCTAATG 180 ACAGTGCGCT CCTCGGTGGC TGCCGATGTC ATTTCCTTGC TACTGAACGG CGACGGCGGC 240 GTTGGCCGCC GGCGCCTCTG GATCGGCCTG CAGCTGCCAC CCGGCTGCGG CGACCCCAAG 300 CGCCTCGGGC CCCTGCGCGG CTTCCAGTGG GTTACGGGAG ACAACAACAC CAGCTATAGC 360 AGGTGGGCAC GGCTCGACCT CAATGGGGCT CCCCTCTGCG GCCCGTTGTG CGTCGCTGTC 420 TCCGCTGCTG AGGCCACTGT GCCCAGCGAG CCGATCTGGG AGGAGCAGCA GTGCGAAGTG 480 AAGGCCGATG GCTTCCTCTG CGAGTTCCAC TTCCCAGCCA CCTGCAGGCC ACTGGCTGTG 540 GAGCCCGGCG CCGCGGCTGC CGCCGTCTCG ATCACCTACG GCACCCCGTT CGCGGCCCGC 600 GGAGCGGACT TCCAGGCGCT GCCGGTGGGC AGCTCCGCCG CGGTGGCTCC CCTCGGCTTA 660 CAGCTAATGT GCACCGCGCC GCCCGGAGCG GTCCAGGGGC ACTGGGCCA G GGAGGCGCCG 720 GGCGCTTGGG ACTGCAGCGT GGAGAACGGC GGCTGCGAGC ACGCGTGCAA TGCGATCCCT 780 GGGGCTCCCC GCTGCCAGTG CCCAGCCGGC GCCGCCCTGC AGGCAGACGG GCGCTCCTGC 840 ACCGCATCCG CGACGCAGTC CTGCAACGAC CTCTGCGAGC ACTTCTGCGT TCCCAACCCC 900 GACCAGCCGG GCTCCTACTC GTGCATGTGC GAGACCGGCT ACCGGCTGGC GGCCGACCAA 960 CACCGGTGCG AGGACGTGGA TGACTGCATA CTGGAGCCCA GTCCGTGTCC GCAGCGCTGT 1020 GTCAACACAC AGGGTGGCTT CGAGTGCCAC TGCTACCCTA ACTACGACCT GGTGGACGGC 1080 GAGTGTGTGG AGCCCGTGGA CCCGTGCTTC AGAGCCAACT GCGAGTACCA GTGCCAGCCC 1140 CTGAACCAAA CTAGCTACCT CTGCGTCTGC GCCGAGGGCT TCGCGCCCAT TCCCCACGAG 1200 CCGCACAGGT GCCAGATGTT TTGCAACCAG ACTGCCTGTC CAGCCGACTG CGACCCCAAC 1260 ACCCAGGCTA GCTGTGAGTG CCCTGAAGGC TACATCCTGG ACGACGGTTT CATCTGCACG 1320 GACATCGACG AGTGCGAAAA CGGCGGCTTC TGCTCCGGGG TGTGCCACAA CCTCCCCGGT 1380 ACCTTCGAGT GCATCTGCGG GCCCGACTCG GCCCTTGTCC GCCACATTGG CACCGACTGT 1440 GACTCCGGCA AGGTGGACGA GGACTATAGC GGCTCTGGCG AG 1482

SEQ ID NO: 4 Sequence length: 476 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp 5 10 15 Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln 20 25 30 Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val 35 40 45 Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly 50 55 60 Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp 65 70 75 80 Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp 85 90 95 Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala 100 105 110 Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr 115 120 125 Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala 130 135 140 Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu 145 150 155 160 Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly 165 170 175 Thr Pro Phe A la Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly 180 185 190 Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala 195 200 205 Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala 210 215 220 Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala 225 230 235 240 Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln 245 250 255 Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp 260 265 270 Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr 275 280 285 Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg 290 295 300 Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln 305 310 315 320 Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn 325 330 335 Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe 340 345 350 Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr 355 360 365 Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His 370 375 380 Arg Cys Gln Met P he Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp 385 390 395 400 Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp 405 410 415 Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe 420 425 430 Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys 435 440 445 Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys Asp Ser 450 455 460 Gly Lys Val Asp Glu Asp Tyr Ser Gly Ser Gly Glu 465 470 475

SEQ ID NO: 5 Sequence length: 1680 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Sequence features Characteristic symbol: sig peptide Location: 190..243 Characterized method: S Characteristic symbol: mat peptide Location: 244..1671 Characterized method: S sequence CTCGAGCCCT GGCCGATCCG CATGTCAGAG GCTGCCTCGC AGGGGCTGCG CGCAGCGGCA GCTGGCTGCCCCCCGTCCTCCCCCCCGTCCTGCCCCGTCCTGCCCCGGCTGTCCTGCGGCCTGTGGCCTGCGCT CGCTTTCCCC GGCGCCTGCA CGCGGCGCGC 180 CTGGGTAAC ATG CTT GGG GTC CTG GTC CTT GGC GCG CTG GCC CTG GCC GGC 231 Met Leu Gly Val Leu Val Leu Gly Ala Leu Ala Leu Ala Gly -18 -15 -10 -5 CTG GGG CCC GCA TCC CCC GCA CCG CAG CCG GGT GGC AGC CAG TGC 279 Leu Gly Phe Pro Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys 1 5 10 GTC GAG CAC GAC TGC TTC GCG CTC TAC CCG GGC CCC GCG ACC TTC CTC 327 Val Glu His Asp Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu 15 20 25 AAT GCC AGT CAG ATC TGC GAC GGA CTG CGG GGC CAC CTA ATG ACA GTG 375 Asn Ala Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val 30 35 40 CGC TCC TCG GTG GCT GCC GAT GTC ATT TCC TTG CTA CTG AAC GGC GAC 423 Arg Ser Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp 45 50 55 60 GGC GGC GTT GGC CGC CGG CGC CTC TGG ATC GGC CTG CAG CTG CCA CCC 471 Gly Gly Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro 65 70 75 GGC TGC GGC GAC CCC AAG CGC CTC GGG CCC CTG CGC GGC TTC CAG TGG 519 Gly Cys Gly Asp Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp 80 85 90 GTT ACG GGA GAC AAC AAC ACC AGC TAT AGC AGG TGG GCA CGG CTC GAC 567 Val Thr Gly Asp Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp 95 100 105 CTC AAT GGG GCT CCC CTC TGC GGC CCG TTG TGC GTC GCT GTC TCC GCT 615 Leu Asn Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala 110 115 120 GCT GAG GCC ACT GTG CCC AGC GAG CCG ATC TGG GAG GAG CAG CAG TGC 663 Ala Glu Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys 1 25 130 135 140 GAA GTG AAG GCC GAT GGC TTC CTC TGC GAG TTC CAC TTC CCA GCC ACC 711 Glu Val Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr 145 150 155 TGC AGG CCA CTG GCT GTG GAG CCC GGC GCC GCG GCT GCC GCC GTC TCG 759 Cys Arg Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser 160 165 170 ATC ACC TAC GGC ACC CCG TTC GCG GCC CGC GGA GCG GAC TTC CAG GCG 807 Ile Thr Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala 175 180 185 CTG CCG GTG GGC AGC TCC GCC GCG GTG GCT CCC CTC GGC TTA CAG CTA 855 Leu Pro Val Gly Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu 190 195 200 ATG TGC ACC GCG CCG CCC GGA GCG GTC CAG GGG CAC TGG GCC AGG GAG 903 Met Cys Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu 205 210 215 220 GCG CCG GGC GCT TGG GAC TGC AGC GTG GAG AAC GGC GGC TGC GAG CAC 951 Ala Pro Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His 225 230 235 GCG TGC AAT GCG ATC CCT GGG GCT CCC CGC TGC CAG TGC CCA GCC GGC 999 Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys GlnCys Pro Ala Gly 240 245 250 GCC GCC CTG CAG GCA GAC GGG CGC TCC TGC ACC GCA TCC GCG ACG CAG 1047 Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln 255 260 265 TCC TGC AAC GAC CTC TGC GAG CAC TTC TGC GTT CCC AAC CCC GAC CAG 1095 Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln 270 275 280 CCG GGC TCC TAC TCG TGC ATG TGC GAG ACC GGC TAC CGG CTG GCG GCC 1143 Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Alg Leu Ala Ala 285 290 295 300 GAC CAA CAC CGG TGC GAG GAC GTG GAT GAC TGC ATA CTG GAG CCC AGT 1191 Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser 305 310 315 CCG TGT CCG CAG CGC TGT GTC AAC ACA CAG GGT GGC TTC GAG TGC CAC 1239 Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His 320 325 330 TGC TAC CCT AAC TAC GAC CTG GTG GAC GGC GAG TGT GTG GAG CCC GTG 1287 Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val 335 340 345 GAC CCG TGC TTC AGA GCC AAC TGC GAG TAC CAG TGC CAG CCC CTG AAC 1335 Asp Pro Cys Phe Arg Ala Asn C ys Glu Tyr Gln Cys Gln Pro Leu Asn 350 355 360 CAA ACT AGC TAC CTC TGC GTC TGC GCC GAG GGC TTC GCG CCC ATT CCC 1383 Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro 365 370 375 380 CAC GAG CCG CAC AGG TGC CAG ATG TTT TGC AAC CAG ACT GCC TGT CCA 1431 His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro 385 390 395 GCC GAC TGC GAC CCC AAC ACC CAG GCT AGC TGT GAG TGC CCT GAA GGC 1479 Ala Asp Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly 400 405 410 TAC ATC CTG GAC GAC GGT TTC ATC TGC ACG GAC ATC GAC GAG TGC GAA 1527 Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu 415 420 425 AAC GGC GGC TTC TGC TCC GGG GTG TGC CAC AAC CTC CCC GGT ACC TTC 1575 Asn Gly Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe 430 435 440 GAG TGC ATC TGC GGG CCC GAC TCG GCC CTT GTC CGC CAC ATT GGC ACC 1623 Glu Cys Ile Cys Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr 445 450 455 460 GAC TGT GAC TCC GGC AAG GTG GAC GAG GAC TAT AGC GGC TCT GGC GAG 1671 Asp C ys Asp Ser Gly Lys Val Asp Glu Asp Tyr Ser Gly Ser Gly Glu 465 470 475 TGACTCGAG 1680

SEQ ID NO: 6 Sequence length: 75 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AATTCTCGAG ATGCTTGGGG TCCTGGTCCT TGGCGCGCTG GCCCTGGCCG GCCTGGTCTT 60 CTCCGCACCC GCAGA 75

SEQ ID NO: 7 Sequence length: 54 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GCCGCAGCCG GGTGGCAGCC AGTGCGTCGA GCACGACTGC TTCGCGCTCT ACCC 54

SEQ ID NO: 8 Sequence length: 65 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGTGCGGAGA AGACCAGGCC GGCCAGGGCC AGCGCGCCAA GGACCAGGAC CCCAAGCATC 60 TCGAG 65

SEQ ID NO: 9 Sequence length: 60 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGTAGAGCG CGAAGCAGTC GTGCTCGACG CACTGGCTGC CACCCGGCTG CGGCTCTGCG 60

SEQ ID NO: 10 Sequence length: 1529 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Sequence characteristics: Characteristic symbol: sig peptide Location : 7..60 Characteristic determination method: S Characteristic symbol: mat peptide Location: 61..1488 Characteristic determination method: S sequence CTCGAG ATG CTT GGG GTC CTG GTC CTT GGC GCG CTG GCC CTG GCC GGC 48 Met Leu Gly Val Leu Val Leu Gly Ala Leu Ala Leu Ala Gly -18 -15 -10 -5 CTG GTC TTC TCC GCA CCC GCA GAG CCG CAG CCG GGT GGC AGC CAG TGC 96 Leu Val Phe Ser Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys 1 5 10 GTC GAG CAC GAC TGC TTC GCG CTC TAC CCG GGC CCC GCG ACC TTC CTC 144 Val Glu His Asp Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu 15 20 25 AAT GCC AGT CAG ATC TGC GAC GGA CTG CGG GGC CAC CTA ATG ACA GTG 192 Asn Ala Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val 30 35 40 CGC TCC TCG GTG GCT GCC GAT GTC ATT TCC TTG CTA CTG AAC GG C GAC 240 Arg Ser Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp 45 50 55 60 GGC GGC GTT GGC CGC CGG CGC CTC TGG ATC GGC CTG CAG CTG CCA CCC 288 Gly Gly Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro 65 70 75 GGC TGC GGC GAC CCC AAG CGC CTC GGG CCC CTG CGC GGC TTC CAG TGG 336 Gly Cys Gly Asp Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp 80 85 90 GTT ACG GGA GAC AAC AAC ACC AGC TAT AGC AGG TGG GCA CGG CTC GAC 384 Val Thr Gly Asp Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp 95 100 105 CTC AAT GGG GCT CCC CTC TGC GGC CCG TTG TGC GTC GCT GTC TCC GCT 432 Leu Asn Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala 110 115 120 GCT GAG GCC ACT GTG CCC AGC GAG CCG ATC TGG GAG GAG CAG CAG TGC 480 Ala Glu Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys 125 130 135 140 GAA GTG AAG GCC GAT GGC TTC CTC TGC GAG TTC CAC TTC CCA GCC ACC 528 Glu Val Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr 145 150 155 TGC AGG CCA CTG GCT GTG GAG CCC GGC GCC GCG GCT GCC G CC GTC TCG 576 Cys Arg Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser 160 165 170 ATC ACC TAC GGC ACC CCG TTC GCG GCC CGC GGA GCG GAC TTC CAG GCG 624 Ile Thr Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala 175 180 185 CTG CCG GTG GGC AGC TCC GCC GCG GTG GCT CCC CTC GGC TTA CAG CTA 672 Leu Pro Val Gly Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu 190 195 200 ATG TGC ACC GCG CCG CCC GGA GCG GTC CAG GGG CAC TGG GCC AGG GAG 720 Met Cys Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu 205 210 215 220 GCG CCG GGC GCT TGG GAC TGC AGC GTG GAG AAC GGC GGC TGC GAG CAC 768 Ala Pro Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His 225 230 235 GCG TGC AAT GCG ATC CCT GGG GCT CCC CGC TGC CAG TGC CCA GCC GGC 816 Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly 240 245 250 GCC GCC CTG CAG GCA GAC GGG CGC TCC TGC ACC GCA TCC GCG ACG CAG 864 Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln 255 260 265 TCC TGC AAC GAC CTC TGC GAG CAC TTC TGC G TT CCC AAC CCC GAC CAG 912 Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln 270 275 280 CCG GGC TCC TAC TCG TGC ATG TGC GAG ACC GGC TAC CGG CTG GCG GCC 960 Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala 285 290 295 300 GAC CAA CAC CGG TGC GAG GAC GTG GAT GAC TGC ATA CTG GAG CCC AGT 1008 Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser 305 310 315 CCG TGT CCG CAG CGC TGT GTC AAC ACA CAG GGT GGC TTC GAG TGC CAC 1056 Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His 320 325 330 TGC TAC CCT AAC TAC GAC CTG GTG GAC GGC GAG TGT GTG GAG CCC GTG 1104 Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val 335 340 345 GAC CCG TGC TTC AGA GCC AAC TGC GAG TAC CAG TGC CAG CCC CTG AAC 1152 Asp Pro Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn 350 355 360 CAA ACT AGC TAC CTC TGC GTC TGC GCC GAG GGC TTC GCG CCC ATT CCC 1200 Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro 365 370 375 380 CAC GAG CCG CAC AGG TGC CAG ATG TTT TGC AAC CAG ACT GCC TGT CCA 1248 His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro 385 390 395 GCC GAC TGC GAC CCC AAC ACC CAG GCT AGC TGT GAG TGC CCT GAA GGC 1296 Ala Asp Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly 400 405 410 TAC ATC CTG GAC GAC GGT TTC ATC TGC ACG GAC ATC GAC GAG TGC GAA 1344 Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu 415 420 425 AAC GGC GGC TTC TGC TCC GGG GTG TGC CAC AAC CTC CCC GGT ACC TTC 1392 Asn Gly Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe 430 435 440 GAG TGC ATC TGC GGG CCC GAC TCG GCC CTT GTC CGC CAC ATT GGC ACC 1440 Glu Cys Ile Cys Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr 445 450 455 460 GAC TGT GAC TCC GGC AAG GTG GAC GAG GAC TAT AGC GGC TCT GGC GAG 1488 Asp Cys Asp Ser Gly Lys Val Asp Glu Asp Tyr Ser Gly Ser Gly Glu 465 470 475 TG ACTCGACCTG CAGGCATGCA AGCTCGGATC AGCGGCCGC 1529

[Brief description of drawings]

FIG. 1 shows the expression vector pBPV-GAG-UT of the present invention.
It is explanatory drawing which shows the structure of M1-GP.

Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI technical display location C12P 21/02 C 9282-4B

Claims (9)

[Claims] 1. A signal peptide for expressing thrombomodulins, which has the amino acid sequence represented by SEQ ID NO: 1. 2. A DNA fragment having a base sequence capable of encoding the amino acid sequence of the signal peptide according to claim 1. 3. The DNA fragment according to claim 2, which has a base sequence shown in SEQ ID NO: 2. 4. A DNA fragment having a nucleotide sequence capable of encoding the signal peptide according to claim 1 and the amino acid sequence of thrombomodulin. 5. The DNA fragment according to claim 4, which has a nucleotide sequence shown in SEQ ID NO: 3. 6. A recombinant vector comprising the DNA fragment according to claim 4 and a replicable vector. 7. The following base sequences (1) to (7) (1) a base sequence acting as a promoter in the downstream direction of transcription (2) a base sequence which is a ribosome binding site (3) a base sequence which is a start codon (4) A base sequence capable of encoding the amino acid sequence of the signal peptide according to claim 1 (5) A base sequence capable of encoding the amino acid sequence of thrombomodulins (6) A base sequence which is a stop codon (7) As a poly A addition signal A recombinant vector containing a base sequence that acts. 8. A transformant cell carrying the recombinant vector according to claim 6 or 7. 9. A method for producing thrombomodulin, which comprises culturing the transformant cell according to claim 8 and collecting a polypeptide produced from the culture.