JPH07123986A - Dna polymerase gene - Google Patents

Abstract

PURPOSE:To provide a new gene capable of producing a new thermostable DNA polymerase useful in various genetic manipulation experiments, especially the genetic manipulation at high temperatures according to genetic engineering. CONSTITUTION:This DNA polymerase gene is derived from an isolated thermophilic phage and has an illustrated restriction map of a DNA fragment, having 2.3kb length and integrated into a plasmid pphiYS200. The DNA polymerase gene derived from the thermophilic phage can be isolated by the infection of Thermus thermophilus HB8 with a thermophilic phage YS40, purification of phage particles and extraction, etc., of the DNA from the particles. A thermostable DNA polymerase produced by a transformant prepared by transducing a recombinant plasmid containing the gene therein, e.g. Escherichia coli BL21(DE3)/pphiY200 (FERM P-13658) has about 8 optimum pH and 65 deg.C optimum temperature and requires four kinds of deoxyribonucleoside 5'- triphosphates.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a gene encoding a DNA polymerase useful in the field of genetic engineering, and the DN.
The present invention relates to a method for genetically engineering A polymerase.

[0002]

2. Description of the Related Art DNA polymerase which has been generally used as a reagent for genetic engineering research is E. coli DN.
A polymerase, its modified Klenow fragment, T4
There are DNA polymerases derived from phages and T7 phage-derived DNA polymerase, Thermus aquaticus, Pyrococcus furiosus, Thermococcus litoralis, Bacillus caldotenax and other thermophilic bacteria. . These enzymes are used for labeling of specific DNAs, DNA base sequence determination methods, PCR methods, etc., depending on their properties. In general, a DNA polymerase has an enzyme specificity depending on its origin, and there is a utilization method utilizing its characteristics. For example, a DNA polymerase derived from an extremely thermophilic bacterium that can grow at 70 ° C or higher is stable at high temperatures,
The typical DNA polymerase derived from Thermus aquaticus is widely used as an enzyme indispensable for PCR technology. In addition, many DNA polymerases possessed by bacteriophage have excellent extendibility, and also have a high ability to incorporate analogs other than the four natural nucleotide substrates. As a typical example, a DNA polymerase derived from T7 phage which infects E. coli is widely used in a nucleotide sequence determination experiment by the dideoxy chain termination method.

[0003]

Generally, a DNA polymerase derived from a thermophilic bacteriophage that infects a thermophilic bacterium is expected to be stable at high temperature and have properties useful for genetic engineering experiments. Phage-derived D
No details are given about NA polymerase.
The object of the present invention is to identify a novel DNA polymerase gene derived from a thermophilic phage, and to provide a method for genetically engineering a novel DNA polymerase using a transformant introduced with a recombinant plasmid containing the DNA fragment. To provide.

[0004]

SUMMARY OF THE INVENTION In summary of the present invention, the first invention of the present invention is that an isolated thermophilic phage-derived DN is used.
A polymerase gene. The second invention of the present invention also relates to a method for producing a DNA polymerase, which comprises culturing a transformant into which a recombinant plasmid containing the gene of the first invention of the present invention has been introduced, and converting the DNA polymerase from the culture. Characterized by collecting.

The thermophilic phage used in the present invention is a virus that propagates by infecting a thermophilic bacterium, and the thermophilic bacterium is a bacterium that can grow at a temperature of 55 ° C. or higher.
As a thermophilic phage, TP that infects Bacillus stearothermophilus
1, TP8 [Journal of Bacteriology (J.
Bacteriol), Vol. 89, pp. 178-184 (196).
5)], TP84 [Journal of Bacteriology, 91, 340-348 (1966)], G
H5, GH8 [Journal of Birology (J.Vio
l.), Vol. 9, 397-398 (1972)], Bacillus acidocaldariu
NS11 [Virology, 7th
5, 256-259 (1976)], and the phage YS40 infecting Thermus thermophilus (Journal of Virology, 15: 1449-1453 (1975)].
Etc. are known, and a thermophilic phage-derived DNA polymerase gene can be isolated from these phages.

The present invention will be described in detail below by taking the thermophilic phage YS40 which infects Thermus thermophilus as an example. The YS40 is Thermus Thermophilus H
As a phage that infects B8 (ATCC 27634), it is a thermophilic phage collected and isolated from a self-spraying spring in Mine Onsen, Izu.

Infection of a thermophilic phage with a thermophilic bacterium, purification of phage particles, and extraction of DNA from the particles can be carried out by known methods, for example, infection of phage YS40 with Thermus thermophilus HB8,
Purification of phage particles and extraction of DNA from the particles are described in Journal of Virology, Vol.
It can be performed by the method described on pages 1449 to 1453 (1975).

As a method for selecting a target DNA fragment from phage DNA, probe DNA or RN is used.
The most reliable method is hybridization using A, but there is no information about the amino acid sequence and gene sequence of thermophilic phage-derived DNA polymerase. In addition, a method for purifying DNA polymerase from infectious bacteria has not been established, and it is not easy to obtain the desired DNA polymerase. For example, in the case of phage YS40, since it is a lytic phage, there is no accumulation of phage-derived protein in the infecting bacteria, DNA polymerase is purified, its N-terminal amino acid sequence is determined, and DNA from the sequence is determined.
Probe DNA for polymerase gene screening
Is impossible to create.

DNA polymerases are roughly classified into amino acid sequences, and are classified into Pol I type represented by Escherichia coli DNA polymerase I and α type represented by human-derived DNA polymerase α. The present inventors selected regions conserved in each group and synthesized oligonucleotides for the PCR method. D
For sequence comparison of NA polymerases, see eg Pol I.
By type, Journal of Biological Chemistry, Volume 264,
Pp 4255-4263 (1989), for the α type, The FASEB Journal, Volume 3,
Reference can be made to pages 14 to 21 (1989).

The nucleotide sequences of the primers 1-8 prepared by the present inventors are shown in SEQ ID NOS: 1-8 of the sequence listing. In addition, each primer pair is expected to be amplified by the PCR method.
The type of A polymerase gene is shown in Table 1.

[0011]

[Table 1] Table 1 ─────────────────────────────────── DNA polymerase gene expected to be amplified ─ ────────────────────────────────── Primer 1,2 Pol gene primer encoding type I DNA polymerase Primer 3, 4 Genes encoding high GC type α-type DNA polymerase Primers 5, 6 Genes encoding medium GC type α-type DNA polymerase Primers 7, 8 Genes encoding low GC type α-type DNA polymerase ──── ──────────────────────────────

PCR is a PCR technology (PCR
Technology) Edited by Erlich HA (Erlich), according to the method described in Stockton Press (issued in 1989). Temperature cycle is 94 ° C for 1 minute, 55 ° C for 1 minute, 7
Perform 30 cycles at 2 ° C. for 2 minutes. Even when PCR was carried out using the DNA prepared from the phage YS40 described above as a template and using the primer pairs of each combination in Table 1, DN
No specific amplification of the A polymerase gene was observed, and the DNA polymerase of phage YS40 cannot be cloned by the usual method based on the known DNA polymerase gene sequence.

When PCR is carried out under conditions where the binding condition between the primer and the template is mild, DN other than the desired PCR product is
A is also amplified. The PCR product of the target DNA polymerase gene may be present in this DNA product. Therefore, the PCR temperature cycle was 94 ° C for 1 minute and 37 ° C for 1 minute.
PCR is performed for 30 minutes at 72 ° C. for 2 minutes and the binding conditions between the primer and the template are relaxed. When PCR was performed using the DNA pair prepared from the phage YS40 described above as a template and using the primer pairs in the combinations of Table 1, the combination of primers 1 and 2 was about 2.0 kb, and about 1.
Amplification of 3 kinds of DNA of 5 kb and about 0.3 kb was observed. The PCR products were subjected to gel electrophoresis, the separated DNAs were isolated, each separated DNA was incorporated into a vector, and the nucleotide sequence was determined by the dideoxy method. decide. DN analyzed
In A, the DNA fragment of about 0.3 kb showed some homology with the known Pol I type DNA polymerase gene,
This DNA fragment may be part of the DNA polymerase gene of interest. The sequence of a DNA fragment of about 0.3 kb is shown in SEQ ID NO: 9 in the sequence listing.

D of about 0.3 kb selected above
Using the NA as the probe (probe 1), the DN obtained above
A DNA polymerase gene is screened by genomic Southern hybridization using the restriction enzyme cleavage product of A as a target. Phage YS4 to which probe 1 binds by Southern hybridization
As a restriction enzyme digestion fragment of 0 DNA, a 4.5 kb EcoRV fragment, a 3.0 kb EcoT14I fragment,
2.5 kb Hind III fragment, 6.5 kb PstI
Fragment, 2.3 kb SspI fragment, and 4.5 kb XbaI fragment, and these DNA fragments are detected as a positive signal.

From the DNA fragments selected above, a DNA fragment covering the entire length of the target DNA polymerase structural gene is selected. The desired DNA fragment can be selected from the restriction enzyme digested fragments of the phage YS40 DNA which showed a positive signal as described above. i) Each DNA fragment of the desired size is cut out from an agarose gel, the EcoT14I fragment is blunt-ended, and the other fragments are directly incorporated into the pUC19 vector opened with the same enzyme. ii) From the nucleotide sequence of probe 1, primers 9, 10
(SEQ ID NOS: 10 and 11) are created. iii) Each D obtained in i) above in each combination of primer 9 and M13 primer RV (Takara Shuzo), primer 10 and M13 primer M4 (Takara Shuzo)
PCR is carried out using the vector incorporating the NA fragment as a template, and the size of the amplified DNA is determined by electrophoresis. Table 2 shows the size of amplified DNA using each vector as a template in which a DNA fragment showing a positive signal was incorporated. In addition,
The 4.5 kb EcoRV fragment and the 6.5 kb PstI fragment could not be cloned in one experiment, probably because of their long chains.

[0016]

[Table 2] Table 2 ─────────────────────────────────── Incorporated into the amplified DNA (kb) vector ────────────────────── DNA fragment Primer 9 Primer 10 M13 Primer RV M13 Primer M4 ──────────────── ──────────────────── 4.5 kb EcoRV fragment origin ─── ─── 3.0 kb EcoT14I 〃 1.0 2.3 2.5 kb Hind III 〃 1 .5 1.0 6.5 kb PstI 〃 ─────── 2.3 kb SspI 〃 0.7 1.6 ──────────────────────── ─────────────

Iv) The average chain length of the known Pol type I DNA polymerase gene is about 3 kb, and this gene is called pU
Incorporated into C19, primer 9, M13 primer RV
The length of DNA expected to be amplified by the combination of
It is 2.0 kb. The chain length of DNA expected to be amplified by the combination of primer 10 and M13 primer M4 is about 0.7 to 0.8 kb. Therefore, in Table 2, 2.5
The DNA fragment derived from the HindIII fragment of kb has a D size similar to that of the known Pol type I DNA polymerase gene.
There is a possibility that the full-length NA polymerase gene is contained, and the HindIII fragment is selected as a DNA fragment that covers the full-length polymerase gene of interest.

The DNA fragment selected above is incorporated into a plasmid vector. Known plasmid vectors can be used, for example pUC18 and pUC1.
9, pUC119, pTV118N and the like, but are not limited thereto. Also, as a means for incorporating, a known method can be used, and it can be incorporated by an enzymatic reaction using DNA ligase. Then, the recombinant plasmid is introduced into the host and the host is transformed. When E. coli is used as the host, either wild strain or mutant strain can be used as long as it has transformability. It is desirable that the restriction mutant strain is a modified wild strain (r ⁻ , m ⁺ ). The means of introduction itself is a known method, for example, molecular cloning or an laboratory manual (Molecular Cloning, A La.
boratory Manual) [T. Cold Spring Harbor Laboratory by T. Maniatis et al.
Issued in 1982] The method described on page 250 can be used.

In this way, the desired DNA fragment is introduced into the host, and the characteristics of the plasmid vector, for example pUC1
In the case of 19, ampicillin-resistant colonies, or ampicillin, 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-Gal) and isopropyl-β-D-thiogalactopyranoside (IPT
The population of cloned DNA can be prepared by selecting colonies that are ampicillin resistant and white on the plate containing G). Next, a clone having the desired fragment is selected from the above population. As a selection method, colony hybridization or plaque hybridization may be used depending on the type of vector, and a PCR method using the primer used for probe preparation may also be used.

If a plasmid vector containing the desired DNA fragment can be selected, then the vector is transformed into a host, and then the transformant is cultured to obtain the DNA polymerase activity expressed in the culture. To measure. At this time, by using a heat-treated product of the extract of the culture as a sample, it can be distinguished from the DNA polymerase activity derived from the host. When expression of the target DNA polymerase is observed, the optimum conditions for the expression are examined.

In order to clone the 2.5 kb HindIII fragment derived from phage YS40 selected above, the DNA of phage YS40 was digested with HindIII, and the DNA of the desired size was recovered from the agarose gel after agarose gel electrophoresis. To do. Hinge pUC119
After circularization with dIII and mixing with the recovered DNA, ligation reaction was carried out with DNA ligase and introduction into E. coli JM109, the desired DNA fragment was incorporated by colony hybridization from the resulting transformants. A clone was selected, and the present inventors selected the plasmid pφYS101.
Select the plasmid named. Plasmid pφYS
The nucleotide sequence of the 2.5 kb HindIII fragment inserted in 101 can be determined by the dideoxy chain terminator method. The determined nucleotide sequence is shown in SEQ ID NO: 12 in the sequence listing. According to the determined sequence,
In the above, the region of about 0.3 kb amplified using the primers 1 and 2 is the one amplified only with the primer 1. That is, the primer 1 is unexpectedly used as the template DN.
It is attached to two places of A and amplified about 0.3 kb of DNA.

Escherichia coli JM109 transformed with the plasmid pφYS101, E. coli JM109 / pφYS101
After crushing the cultured bacterial cells of No. 1 by ultrasonic treatment,
After heat treatment at 20 ° C. for 20 minutes to denature the E. coli protein, the supernatant is recovered by centrifugation and the DNA polymerase activity is measured as follows.

As a reaction solution, 67 mM potassium phosphate (pH 7.4), 6.7 mM MgCl ₂ , 1 mM 2
-Mercaptoethanol, 20 μM activated DNA, 33 μM each dATP, dGTP, dCTP, dTTP,
Prepare 100 μM [α ³² P] dCTP and prepare this solution 5
5 μl of enzyme solution was added to 0 μl, reacted at 65 ° C. for 10 minutes, and then 45 μl was spotted on DE81 filter paper and washed with 5% Na ₂ HPO ₄ solution three times. The radioactivity of the acid-insoluble fraction remaining on the filter is measured with a liquid scintillation counter to determine the uptake activity. The activity of incorporating 10 nmol of all nucleotides into the acid-insoluble precipitate in 30 minutes with the above solution is defined as 1 unit (U).

In the crude extract derived from Escherichia coli JM109 / pφYS101, the activity of thermostable DNA polymerase, which is not denatured by heat treatment at 65 ° C. for 20 minutes, was recognized, and cloning of the gene of the present invention has been achieved. However, its expression is low and industrial production of DNA polymerase requires modification of the plasmid.

2.5 kb shown in SEQ ID NO: 12 in the sequence listing
When the longest region of the open reading frame is searched based on the nucleotide sequence of the HindIII fragment of SEQ ID NO: 12, ATG of nucleotide numbers 229 to 231 of SEQ ID NO: 12 becomes the translation initiation codon of the longest region. Therefore, by removing the base sequence before the codon from the base number 1 of SEQ ID NO: 12, it can be modified into a plasmid in which the promoter gene and the target gene are close to each other. Further, by incorporating into a plasmid vector suitable for high expression of protein, it can be modified into a plasmid vector suitable for expression of DNA polymerase.

A recognition sequence for the restriction enzyme NcoI can be introduced into the sites of the base sequences 229 to 231 by the site-directed mutagenesis method. The site-specific introduction can be performed by using a known method, for example, Proceedings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 82,
The method described on page 488 (1985) can be used. From the plasmid designated by the present inventors as the plasmid pφYS102, in which the recognition site of NcoI was introduced,
A 2.3 kb NcoI-HindIII fragment was added to NcoI
By excising with I and HindIII and incorporating into the high protein expression plasmid vectors pTV119N and pET8C, the present inventors have obtained the plasmid pφYS.
103, a plasmid designated as plasmid pφYS200 can be obtained.

The plasmid pφYS103 and the plasmid pφYS200 can be integrated into a host of high expression system suitable for each plasmid system to obtain a transformant. Escherichia coli JM in which the plasmid pφYS103 is incorporated
109 is Escherichia coli JM109 / pφYS103, E. coli BL21 (DE
3) is designated as Escherichia coli BL21 (DE3) / pφYS200. Escherichia coli JM109 / pφYS103 and Escherichia coli BL21 (DE3) / pφYS200 were subjected to culture, sonication and heat treatment in the same manner as the above-mentioned Escherichia coli JM109 / pφYS101, and the enzyme activity in each crude extract was measured. The results are shown in Table 3.

[0028]

[Table 3] Table 3 ─────────────────────────────────── Transformants Thermostable DNA polymerase activity [ mU / μl] ─────────────────────────────────── E. coli JM109 / pφYS101 <0.01 E. coli JM109 / pφYS103 0.2 E. coli BL21 (DE3) / pφYS200 5.6 ────────────────────────────────────

From the crude extract obtained by culturing the E. coli BL (DE3) strain containing the plasmid pφYS200, 5.
A thermostable DNA polymerase activity of 6 mU / μl is obtained. Escherichia coli BL21 (DE3) transformed with this plasmid pφYS200 is Escherichia coli BL21.
Named and displayed as (DE3) / pφYS200, FERM P-1365 at the Institute of Biotechnology, Institute of Biotechnology, AIST.
Deposited as 8.

FIG. 1 shows a restriction enzyme map of a 2.3 kb DNA fragment containing the DNA polymerase gene of the present invention incorporated in the plasmid pφYS200. Further, FIG. 2 shows a restriction enzyme map of the 2.5 kb HindIII fragment. The nucleotide sequence of a 2.3 kb DNA fragment containing the DNA polymerase gene of the present invention and the amino acid sequence of the protein that can be encoded by the fragment are shown in SEQ ID NO: 13. The recombinant Escherichia coli obtained as described above [Escheric
By using hia coli BL21 (DE3) / pφYS200], industrial production of a novel thermostable DNA polymerase becomes possible.

Transformants introduced with a recombinant plasmid containing a thermostable DNA polymerase gene, such as Escherichia coli BL21 (DE3) / pφYS200, were cultured under normal culture conditions, for example, L containing 100 μg / ml ampicillin.
The thermostable DNA polymerase can be expressed in the culture by culturing in B medium at 37 ° C. After completion of the culturing, the cultured bacterial cells are collected, and the resulting centrifuged supernatant of the bacterial cells after sonication is subjected to heat treatment at 65 ° C. for 20 minutes for denaturation of contaminating proteins, nucleic acid removal treatment, ammonium sulfate precipitation treatment, A purified enzyme preparation can be obtained by performing dialysis treatment, ion exchange chromatography and the like.

A transformant introduced with a recombinant plasmid containing the thermostable DNA polymerase gene of the present invention,
For example, the enzymatic and physicochemical properties of thermostable DNA polymerase produced by E. coli BL21 (DE3) / pφYS200 are as follows.

(1) Action and Substrate Specificity By covalently bonding the α-phosphate of dioxyribonucleoside 5′-3 phosphate to the 3′-hydroxyl group of the oligonucleotide or polynucleotide annealed to the template DNA, It catalyzes the reaction of introducing deoxynucleoside 5'-1 phosphate complementary to deoxyribonucleic acid. This enzyme requires four types of deoxyribonucleoside 5'-3 phosphates.

(2) Method for measuring enzyme activity As a reaction solution, 20 mM Tris HCl (pH
8.0), 2 mM MgCl ₂ , 0.01% BSA,
0.01% Triton X-100, 0.2 mg activated D
NA, 33 μM each dATP, dGTP, dCTP, d
TTP, 100 μM [methyl- ³ H] TTP was prepared, and 5 μl of enzyme solution was added to 100 μl of this solution, reacted at 65 ° C. for 7.5 minutes, and then 45 μl was added to DE8.
Spot on 1 filter paper, 5% Na ₂ H
Wash 3 times with PO ₄ solution. The radioactivity of the acid-insoluble fraction remaining on the filter is measured with a liquid scintillation counter to determine the uptake activity [the following (3) to (7)
Was measured by this method].

(3) Optimum pH The influence of pH on the reaction of the DNA polymerase of the present invention was determined. For the measurement, 100 mU of this enzyme preparation was used.
Of the reaction conditions shown in (2), pour 20 mM Tris HCl
Reactions were carried out using those prepared for H 7.0 to 8.9. As shown in FIG. 3, this enzyme showed maximum activity at about pH 8. That is, FIG. 3 is a diagram showing the optimum pH of the enzyme obtained by the present invention, in which the vertical axis represents relative activity (%) and the horizontal axis represents pH.

(4) For optimum temperature measurement, 100 mU of this enzyme preparation was used, and the reaction was carried out at various temperatures for 7.5 minutes under the reaction conditions shown in (2).
As shown in FIG. 4, this enzyme was 37 ° C. at pH 8.0.
It was active in the range of ~ 70 ° C, and its optimum temperature was 65 ° C. That is, FIG. 4 is a diagram showing the optimum temperature of the enzyme obtained by the present invention, in which the vertical axis represents relative activity (%) and the horizontal axis represents temperature (° C.).

(5) Optimal MgCl ₂ Concentration This enzyme requires Mg ²⁺ . Using 100 mU of this enzyme, the concentration of MgCl ₂ in the reaction conditions shown in (2) was set to 2
The reaction was performed at 65 ° C. for 7.5 minutes while changing the amount at 50 mM. As shown in FIG. 5, this enzyme had an optimum MgCl ₂ concentration of about 2 mM. That is, FIG. 5 shows the relationship between the activity of the enzyme obtained according to the present invention and the MgCl ₂ concentration, where the vertical axis represents the relative activity (%) and the horizontal axis represents the MgCl ₂ concentration (mM).
Indicates.

(6) Optimal KCl concentration Using 100 mU of this enzyme, KCl having a final concentration of 0 to 100 mM was added to the reaction conditions shown in (2), and the reaction was carried out at 65 ° C for 7.5 minutes. This enzyme is 0-100 as shown in FIG.
It had activity in mM KCl, and the activity was highest around 0 mM KCl. That is, FIG. 6 is a diagram showing the relationship between the activity of the enzyme obtained by the present invention and the KCl concentration, where the vertical axis represents relative activity (%) and the horizontal axis represents KCl concentration (mM).
Indicates.

(7) N-ethylmaleimide (NEM) sensitivity Using 100 mU of this enzyme, NEM was added to the reaction conditions shown in (2) so that the final concentration was 0 to 10 mM, and the mixture was reacted at 65 ° C for 7.5 minutes. It was As shown in FIG. 7, this enzyme is SH
It showed strong sensitivity to NEM which is a group modifying reagent.
That is, FIG. 7 shows the activity of the enzyme and N
It is a figure which shows the relationship of EM concentration, a vertical axis | shaft shows relative activity (%) and a horizontal axis shows NEM concentration (mM). The enzyme activity of the enzyme of the present invention is inhibited by NEM.

As described in detail above, the present invention provides a thermostable phage-derived thermostable DNA polymerase gene and a method for industrially producing a thermostable DNA polymerase using the gene. The thermostable DNA polymerase of the present invention is a novel thermostable DNA polymerase that is completely different from known Pol I type and α type DNA polymerases, and is useful in various genetic manipulation experiments, particularly in genetic manipulation under high temperature. DNA isolated by the present invention
The polymerase gene is completely different from the known nucleotide sequences encoding the type I and α type DNA polymerases, and by using the gene, a thermostable phage-derived thermostable DNA polymerase gene that can hybridize with the gene can be easily prepared. Can be cloned into.

[0041]

EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to the following examples.

Example 1 (1) Preparation of phage YS40 DNA Thermus thermophilus HB8 (ATCC 2763)
4) was cultured in 10 ml of a liquid medium (polypeptone 10 g / l, yeast extract 5 g / l, NaCl 5 g / l, 0.01% iron sulfate) at 72 ° C. overnight, transferred to 100 ml of a new medium having the same composition, and transferred to A600. The culture was carried out with shaking until it reached about 0.1. 3 x 1 in this culture
Phage YS40 stock solution at 0 ¹⁰ pfu / ml was added to 7.5
The cells were infected with the addition of ml, and the cells were further shake-cultured for 4.5 hours.
Add chloroform and lyse completely at 70 ° C for 5 minutes,
The residue was removed by centrifugation at 10,000 rpm for 15 minutes. Next, 10 mg of DNaseI and 5 mg of RNaseA were added to the supernatant.
After adding 00 μg and reacting at 37 ° C. for 1 hour, the eluted DNA and RNA derived from the host bacterium were decomposed and then centrifuged (10
000 rpm for 15 minutes), and add NaCl to the supernatant.
3.5 g and 50 g of PEG6000 were added and left at 4 ° C. overnight to precipitate phage particles. Further, the solution is added to 10
After centrifugation at 000 rpm for 15 minutes, the precipitate was collected and
ml 10 mM Tris HCl (pH 7.5), 10 m
Suspended in M MgCl ₂ . Furthermore, once again 1000
After centrifugation at 0 rpm for 15 minutes, the supernatant was subjected to sucrose density gradient centrifugation to purify the phage particles. 40%, 5%
2.5 ml each of the sucrose solution of 3 was superposed on the centrifuge tube, and 5 ml of the phage particles were superposed on each tube in 5 ml.
After centrifuging at 000 rpm for 60 minutes, precipitate is 10 mM.
Dissolve in 2 ml of Tris HCl (pH 7.5), 1 mM MgCl ₂ solution, and add DNaseI and RNas again.
eA treatment (6μg, 20μg added at 37 ° C,
30 minutes) STEP buffer (0.5% SDS, 50m
M Tris HCl, pH 7.5, 0.4M EDTA,
5 μl of proteinase K (1 mg / ml) was added.
The reaction was carried out at 0 ° C for 15 minutes. Then, an equivalent phenol was added for extraction, extraction was performed with a phenol / chloroform 1: 1 solution, and then phage DNA was recovered by ethanol precipitation. Next, after drying the DNA, TE buffer (10 mM
Tris HCl, pH 7.5, 1 mM EDTA) 1 ml
It was dissolved in and quantified. About 500 μg of phage DNA was obtained.

(2) Amplification of specific DNA fragment using PCR Primers 1 to 8 of the mix primers represented by SEQ ID NOS: 1 to 8 in the sequence listing were synthesized by a DNA synthesizer,
Purified. Next, PCR was carried out by using primers in combination of primer 1 and primer 2, primer 3 and primer 4, primer 5 and primer 6, and primer 7 and primer 8. That is, 100 pm for each primer
ol and DNA1n of phage YS40 obtained in (1)
g of 10 mM Tris HCl, pH 8.3, 50
mM KCl, 1.5 mM MgCl ₂ , 200 μM each
94 with 100 μl of a solution containing deoxynucleotide triphosphate (4 types) 1 unit Taq polymerase
30 cycles of PC at 1 ° C, 1 minute at 55 ° C, 1 minute at 72 ° C
R was done. After completion of PCR, 5 μl of the reaction solution was taken and analyzed by agarose gel electrophoresis for the amplified DNA product. As a result, amplification of the Pol I type DNA polymerase gene was not observed with the combination of primers 1 and 2, and some bands amplified from other combinations were excised, and M13m
After cloning by blunt-end ligation to the SmaI site of p18, the nucleotide sequence was examined to find a codeable amino acid sequence, but no sequence homologous to the α-type DNA polymerase was obtained. Then, next, the annealing conditions of the primer and the template DNA were relaxed, and 30 cycles of PCR were performed at 94 ° C. for 1 minute, 37 ° C. for 1 minute, and 72 ° C. for 1 minute. After the PCR is completed, the reaction solution is 5μ
As a result of taking 1 and analyzing it by agarose gel electrophoresis, it was found that three kinds of DNA fragments were clearly amplified by the combination of the primers 1 and 2. They are about 2.0k
b, about 1.5 kb and about 0.3 kb in length.
Of these, about 1.5 kb and about 0.3 kb, two kinds of DNA were excised from the gel and cloned into the SmaI site of M13mp18 to obtain the nucleotide sequence.
Pol I type D in the amino acid sequence that can be encoded by the kb fragment.
Homology to the sequence of NA polymerase could be found.

(3) Search for target gene by genomic Southern method 5 μg of phage YS40 DNA per restriction enzyme
Using EcoT14I, EcoRV, HindIII,
It was digested with PstI, SspI and XbaI, respectively. After separation by agarose gel electrophoresis, the DNA in the gel was transferred to a nylon membrane, and about 0.3 kb obtained by PCR of (2)
Hybridization was carried out using the DNA fragment (1) as probe 1. The probe 1 was radiolabeled by adding [α ³² p] dCTP to the substrate by the random priming method. Hybridization is 6 x SSC
(1 × SSC: 0.15M NaCl, 0.015M
Sodium citrate, pH 7.0), 1% SDS, 5x
Den Hearts solution (Ficoll, polyvinylpyrrolidone,
Bovine serum albumin (1% each), 100 μg / ml calf thymus DNA at 65 ° C. for 5 hours. 1 x SSC, 0.1
After washing for 1 hour in a% SDS solution, it was exposed to an X-ray film and an autoradiogram was taken. As a result, by genomic Southern hybridization, as a restriction enzyme cleavage fragment of the DNA of phage YS40 to which probe 1 binds, a 4.5 kb EcoRV fragment, a 3.0 kb EcoT14I fragment, a 2.5 kb Hind III fragment,
There was a 6.5 kb PstI fragment, a 2.3 kb SspI fragment, and a 4.5 kb XbaI fragment, and these DNA fragments were detected as a positive signal.

Phage Y showing these positive signals
The target DNA was obtained from the restriction enzyme digestion fragment of S40 DNA.
Selection of fragments was performed as follows. i) Each DNA fragment of the desired size was cut out from each agarose gel. The EcoT14I fragment was blunt-ended, and the other fragments were incorporated as they were into the pUC19 vector opened with the same enzyme. ii) From the nucleotide sequence of probe 1, select the DNA regions represented by SEQ ID NOS: 10 and 11, respectively.
Primers 9 and 10 respectively represented by 11 were synthesized by a DNA synthesizer and purified. iii) Each D obtained in i) above in each combination of primer 9 and M13 primer RV (Takara Shuzo), primer 10 and M13 primer M4 (Takara Shuzo)
PCR was carried out using the vector incorporating the NA fragment as a template, and the size of the amplified DNA was determined by electrophoresis. iv) The average chain length of the known Pol type I DNA polymerase gene is about 3 kb, and the chain length of the DNA expected to be amplified by the combination of this gene into pUC19 and primer 9 and M13 primer RV is about 1. It is 8 to 2.0 kb. In addition, the chain length of DNA expected to be amplified by the combination of primer 10 and M13 primer M4 is about 0.7 to
It is 0.8 kb. As shown in Table 2 above, 2.5
The DNA fragment derived from the HindIII fragment of kb was a D of 1.5 kb when combined with primer 9 and M13 primer RV
NA is amplified and primer 10, M13 primer M
In the combination of 4, 1.0 kb of DNA was amplified,
The DNA fragment derived from the HindIII fragment of kb has a D size similar to that of the known Pol type I DNA polymerase gene.
It is possible that the full-length NA polymerase gene was contained, and the HindIII fragment was selected as a DNA fragment covering the full-length polymerase gene of interest.

(4) D containing a DNA polymerase gene
Cloning of NA fragment Among those showing positive results in genomic Southern analysis, 2.
50 μg of phage YS40 DNA was digested with Hind III to clone a 5 kb Hind III fragment,
2.5 kb of desired size after agarose gel electrophoresis
Was recovered from the agarose gel. An electro-elution method was used for recovery. A vector prepared by opening pUC119 with Hind III and removing the terminal phosphate group with alkaline phosphatase was prepared and mixed with the recovered DNA to prepare D
After ligation reaction with NA ligase, E. coli JM109
Introduced. A target clone was selected by colony hybridization from the obtained recombinant population. Recombinant colony 21 grown on nylon membrane
After denaturing 6 with 0.5 N sodium hydroxide and 1.5 M sodium chloride solution, 1 M Tris HCl, 1.5
It was neutralized with M NaCl (pH 7.0) solution, and DNA was fixed on the membrane by UV irradiation. The conditions for probe preparation and hybridization were in accordance with the genomic Southern analysis described in (3) above. As a result of autoradiography, 5 colonies were positive. Plasmids were recovered from these colonies, and one of them was named pφYS101.

(5) Determination of nucleotide sequence of phage YS40 chromosomal DNA fragment containing DNA polymerase gene The nucleotide sequence of the 2.5 kbp phage YS40 DNA inserted in the plasmid pφYS101 obtained in (4) was analyzed by the dideoxy chain terminator method. Were determined.
pφYS101 was double cleaved with SmaI and SacI and the method of Henikoff [Gene, No. 28]
Vol. 351-359 (1984)] using exonuclease III and mung bean nuclease to prepare a set of deletion mutants of various sizes, and decoding the respective sequences. Finally, the entire region of the HindIII fragment shown in SEQ ID NO: 12 in the sequence listing was sequenced.

(6) Plasmid pφYS103, pφY
Construction of S200 The 2.5 kb Hind I shown in SEQ ID NO: 12 of the sequence listing.
If the longest region of the open reading frame is searched based on the nucleotide sequence of the II fragment, the nucleotide number 22 of SEQ ID NO: 12 will be searched.
ATGs 9 to 231 become the translation initiation codon of the longest region. Therefore, by removing the base sequence before the codon from the base number 1 of SEQ ID NO: 12, it can be modified into a plasmid in which the promoter gene and the target gene are close to each other. Further, by incorporating into a plasmid vector suitable for high expression of protein, it can be modified into a plasmid vector suitable for expression of DNA polymerase.

A recognition sequence for the restriction enzyme NcoI can be introduced into the sites of the base sequences 229 to 231 by the site-directed mutagenesis method. The site-specific introduction was converted using a site-specific mutant production system, Mutan K (Takara Shuzo). A 2.3 kb NcoI-HindIII fragment was designated as NcI-HindIII fragment from the plasmid designated by the present inventors as the plasmid pφYS102 and into which the NcoI recognition site was introduced.
By cutting out with oI and HindIII and incorporating into the high protein expression plasmid vectors pTV119N and pET8C, the present inventors have obtained plasmid pφY
A plasmid designated as S103 and plasmid pφYS200 was obtained. The plasmid pφYS103 and the plasmid pφYS200 can be integrated into a host of high expression system suitable for each plasmid system to obtain a transformant. Escherichia coli JM in which the plasmid pφYS103 is incorporated
109 is Escherichia coli JM109 / pφYS103, E. coli BL21 (DE
3) was named E. coli BL21 (DE3) / pφYS200. The plasmid pφYS10 described above is used.
E. coli JM109 containing 1 is E. coli JM109 /
It was named pφYS101.

Example 2 Production of thermostable DNA polymerase by transformant E. coli JM109 / pφYS101, E. coli JM109
/ PφYS103, E. coli BL21 (DE3) / pφY
Ampicillin is 100 μg / ml for each of S200
The cells were inoculated into 5 ml of LB medium existing at the concentration of and cultured at 37 ° C. When the turbidity of the culture solution was 0.5 (A600), IPTG as an inducer was added, and the culture was further performed for 15 hours. Bacteria were collected from 1 ml of culture solution and 50 mM Tris HC
1 (pH 8.0), washed with 25% sucrose solution. After resuspending in the same solution and disrupting by sonication, the supernatant was heat-treated at 65 ° C. for 20 minutes to denature most of the E. coli proteins. The supernatant was recovered by centrifugation and 1 ml of a crude extract was prepared. The DNA polymerase activity of the crude extract was measured by the enzyme activity measuring method of the present invention. The results are shown in Table 3, but E. coli JM109 / pφ
Expression of activity was observed in YS101, and E. coli JM109
/ Pφ YS103-derived crude extract 0.2 mU / μ
1, the crude extract derived from Escherichia coli BL21 (DE3) / pφYS200 had an enzyme activity of 5.6 mU / μl.

Next, E. coli BL21 (DE3) / pφYS
200 was inoculated into 250 ml of L medium containing ampicillin at a concentration of 10 μg / ml and cultured at 37 ° C. When the turbidity of the culture solution was 0.5 (A600), IPTG was added and the mixture was further cultured for 15 hours, and then the cells were collected to obtain about 2 g of bacterial cells. Purification is started from this, and the supernatant 23
ml was obtained. Further, it was heat-treated at 65 ° C. for 20 minutes to obtain 21 ml of a crude extract. Next, ammonium sulfate salting out
The% saturated precipitate was centrifuged to obtain a precipitate fraction that was precipitated at 30-80% saturation. This precipitate is added to 50 mM Tris HCl.
(PH 7.0), 2 mM mercaptoethanol, 10
% Glycerol, 4 μM phenylmethanesulfonyl fluoride (PMSF) in solution (hereinafter referred to as buffer A
Abbreviated) and dialyzing the same solution as the external solution,
Add to a Mono Q column (Pharmacia Biotech) equilibrated with the same buffer A and add FPLC.
System (Pharmacia Biotech) 0-30
A linear concentration gradient of 0 mM NaCl was applied for development. 100
Active fractions eluted near mM NaCl were collected (3.2 ml), 1 mM potassium phosphate (pH 6.
8), dialyzed against a solution containing 7 mM mercaptoethanol and 10% glycerol (hereinafter abbreviated as buffer B). Next, it was added to a hydroxylapatite column (KB column, Koken) equilibrated with buffer B. 0-4
Development was performed using a linear gradient of 00 mM potassium phosphate. Active fractions eluted near a concentration of 200 mM potassium phosphate were collected (3.0 ml) and dialyzed against buffer A. Further, it was added to a Mono S column (Pharmacia Biotech) equilibrated with buffer A to give 0-2.
Development was performed using a linear gradient of 00 mM NaCl. 70
The active fractions eluted near the concentration of mM NaCl were collected and concentrated with Amicon CF25 (manufactured by Grace) to obtain the final preparation.

[0052]

INDUSTRIAL APPLICABILITY The present invention provides a novel DNA polymerase gene derived from thermophilic phage. By using the gene, a thermostable DNA polymerase useful in the field of genetic engineering can be industrially obtained.

[0053]

[Sequence list]

SEQ ID NO: 1 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: NO Sequence: GAYCCHAACY TSCARAAYAT HCC twenty three

SEQ ID NO: 2 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: YES Sequence: KASNAKYTCR TCRTGNACYT G twenty one

SEQ ID NO: 3 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Antisense: NO Sequence: WSSYTSTACC CSWSSATCAT 20

SEQ ID NO: 4 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: YES Sequence: TCSGTRTCSC CGTAGATVAC 20

SEQ ID NO: 5 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: NO Sequence: WSNYTNTAYC CNWSNATHAT 20

SEQ ID NO: 6 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: YES Sequence: TCNGTRTCNC CRTARATNAC 20

SEQ ID NO: 7 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: NO Sequence: WSHYTDTAYC CDWSDATHAT 20

SEQ ID NO: 8 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Antisense: YES Sequence: TCDGTATCDC CRTARATNAC 20

SEQ ID NO: 9 Sequence length: 317 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: NO Sequence: GACCCCAACC TCCAAAATAT TCCCTCTTGG TTTAAGAGAT ACATAACAGC AGAAGAAGGA 60 TATGTTCCTG TTTTTGCTGA TTATTCTCAA GTTGAGCTGA GAATCTTAGC TTATCTATCT 120 GGAGATGAGG CCATGATTGA CAGCTGTAAT TCTAAAGACA TGCACAGCGA AAATGCTAGA 180 AAGATTTACA AAATTCCCCC AGATCAACCT GTTCCACCAG AACTAAGGAA GAAAGCAAAA 240 ACAGTTTCAT TCGCCATTCC TTATGGTTCC TCAGCTTATG GGTTGGTTGT GCGTGGAATG 300 TTCTGGAGGT TGGGGTC 317

SEQ ID NO: 10 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Antisense: YES Sequence: CAACCAACCC ATAAGCTGAG 20

SEQ ID NO: 11 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Antisense: NO Sequence: GAGATACATA ACAGCAGAAG 20

SEQ ID NO: 12 Sequence length: 2537 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: Genomic DNA Antisense: NO sequence: AAGCTTCGAT AACTAAATTT AAAACGCTGG AAGTTTGGTT TTTTATCTTT ACCGAAATAC 60 CCTTTTTGTT TTGTTCGAAG GTTACCTTAA ATAGTTCTGA TGAACAGGTG CAATTAGAAA 120 AGTCTATAGT AAATTGTGTC ATTGTGTTGG CAAGTGTTAC AGGCACGGTT TAATTGTATA 180 CAATGGAAAA GGCTTTTTCA CCTGACACGA AAGAGCTGAG GTGCTACCAT GAGTAGCATG 240 GACAAAGACC TTTTGGGATA CAAAAAAATT GTTGGAATTG ATATAGAAAC TTGGGATGGA 300 AAAAAAGGAG GTTCACTTGA TCCTTACTCA GGAAAAATAG CGTTAGTTCA GATTGCCTAT 360 GACAGAAATA ACATTGTTTT ATACAGACCT TGGGAAAAGA ATTTTGAGGA AGCATTGAAG 420 GTACTTAGCG ATAAAGATGT TTTAAAAGTT GGACACAACT TAAAATTTGA TTTAAAGTTT 480 TTCTACATGA ACAACATATA TCCAGAACCA ATATTTGATA CGATGATTGC ATCACAAATG 540 ATTTATGCTG GGTTAGATGA ACCAGATGAA ATTTCTGAAG TTTTAGAAGC ACTTAAAGAC 600 GATTTGACTA CAGAAGAAGT AGCTATATTT GATGTGTTTG GCAAGAAAAG AACAAAAGCT 660 ACCAAGTTTT CTCATCGTTA GCAG AAGAGAG AACTAAACAT TTTCTTACCA 720 AAAGATGTTC AAAACAGCAA TTGGGGAGGT GAGCTTAGTG AAGCCCAAAA GGAATATGCA 780 ATTAACGATG TTAAATATCT TAAAGATTTG TCAATAGAGT TATGGAAAAA AATAAAGGCA 840 TTGAACATTG AAAATGTGTT TATGTTAGAA ATGAAGTTTT TGCCTGTGTT AGTAATGTTA 900 GAGTTAACAG GGGTGAAAAT TGATAAAGAA GGTTGGAAGA AAAAAATGGA AAAAGAAAAT 960 CAAGAGCTTT TAGAGCTAGA AAAAGAACTT AAAAAGGAAA TATATGAAAA ATTTGTTTCT 1020 AAACAAAGTG AAAAAATGAT GGTCGGATTG TTTGAAGATG CAGAATATGA AAAAATAAAT 1080 CTAAACTCAC CTTTACAAAT GGCAAAAATT TTTGGATTGC CAAATGTTTC TAAGCTAACC 1140 CTTGAGAAAA TTGAAGATCC GACAATAAAA AAGTATGTGG AATACAAAAA GAAAGCAAAG 1200 TTAGTAACAA CCTACTCAAA AGAATACTTA GAAAAACTAA CAGAAAACAA TAGGTTAATG 1260 TCCGATTACT CACAAACGAA GACTGCAACT GGAAGAATTA GTTCTAGTAA CCCCAACCTC 1320 CAAAATGTTC CCTCTTGGTT TAAGAGATAC ATAACAGCAG AAGAAGGATA TGTTCCTGTT 1380 TTTGCTGATT ATTCTCAAGT TGAGCTGAGA ATCTTAGCTT ATCTATCTGG AGATGAGGCC 1440 ATGATTGACA GCTGTAATTC TAAAGACATG CACAGCGAAA ATGCTAGAAA GATTTACAAA 1500 ATTCCCCCAG ATCAACCTGT TCCACCAGAA CTAAGGAAGA AAG CAAAAAC AGTTTCATTC 1560 GCCATTCCTT ATGGTTCCTC AGCTTATGGG TTGGTTGTGC GTGGCATGTT CTCTAGTTTG 1620 GCGGAAGCAG AGGAAGCTAT TGAAGGTTTT TTCAATAGCT TTCCTAAAGT TAAAGAGTTT 1680 CTAGAAAAAA GCGCAAAGAG TGCGCAAAAC GGCATTACTA GAGATGCGTT GGGTAGAGTA 1740 AGAAACTACA AGAAAATCTA TATTAGCGAA GATGAAAAAG GAGCTTTAAA GATACTTATG 1800 TTTAGATTAC CTTCTGGAAT TTCTAAAGAT GAGTTTATAA AGGAGGTTTT AGAGAAAAAT 1860 AGCTTTAAAG ACGCTGCAAA AATTTTTGGA ATGGATGAAC AAATGCTACA GCTAGCAATT 1920 TCTGCTTACG AAAAAACAAA GAAATTGGCT AAGATTGCGA GAGAAGGACA AAATCACCCG 1980 ATTCAAGCTA CTTCTGCATC AATTACAAAA ACAGCTATGG TTGATCTCTT AGAATACCTG 2040 TCAATGACAG GGTATGGATA TATGACTTTA ACAGTTCATG ACAGCATTTT CTTTGAAATC 2100 AAGAAAGAAT TTATTTTTGA TGCACTTCCA AAAATAAAAG AAATAATGGA ACAAGCTGGT 2160 CCAAAAGTTG TTCCCGGAAT TATAACTCCA GTTGATGTTG AGGTAGGAGA GAAAATATCG 2220 GTATATTGCA ATTCTTGCGG TAAAGAAAAC GAGATTAATA GATACATGGT AAATCTAAAT 2280 GAGAAGATAA TTGTTGATTT TACTAAGGAT CCTTATATTT GCGATGAATG CTTTAACAGG 2340 GTTATTTAAA ATAGTTTCTT AACCAAAAAT TCCAGAAGGG CATTAGGGA T ATTGCAAACG 2400 ATGCTACTAT AAAAACTTCT AACAAATCCA ATTTTCTGCC AATCAAGTCT TCAAATAGAT 2460 TAGATATAAT CCACAGAAAT CCAGCTACTC CCCAAGAAAT ATCACGAAAA CTCGGCTTTT 2520 GTTTAATTAT GAAGCTT 2537

SEQ ID NO: 13 Sequence length: 2310 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Antisense: NO Sequence: C ATG GGT AGC ATG GAC AAA GAC CTT TTG GGA TAC AAA AAA ATT GTT 46 Met Gly Ser Met Asp Lys Asp Leu Leu Gly Tyr Lys Lys Ile Val 1 5 10 15 GGA ATT GAT ATA GAA ACT TGG GAT GGA AAA AAA GGA GGT TCA CTT 91 Gly Ile Asp Ile Glu Thr Trp Asp Gly Lys Lys Gly Gly Ser Leu 20 25 30 GAT CCT TAC TCA GGA AAA ATA GCG TTA GTT CAG ATT GCC TAT GAC 136 Asp Pro Tyr Ser Gly Lys Ile Ala Leu Val Gln Ile Ala Tyr Asp 35 40 45 AGA AAT AAC ATT GTT TTA TAC AGA CCT TGG GAA AAG AAT TTT GAG 181 Arg Asn Asn Ile Val Leu Tyr Arg Pro Trp Glu Lys Asn Phe Glu 50 55 60 GAA GCA TTG AAG GTA CTT AGC GAT AAA GAT GTT TTA AAA GTT GGA 226 Glu Ala Leu Lys Val Leu Ser Asp Lys Asp Val Leu Lys Val Gly 65 70 75 CAC AAC TTA AAA TTT GAT TTA AAG TTT TTC TAC ATG AAC AAC ATA 271 His Asn Leu Lys Phe Asp Leu Lys Phe Phe Tyr Met Asn Asn Ile 80 85 90 TAT C CA GAA CCA ATA TTT GAT ACG ATG ATT GCA TCA CAA ATG ATT 316 Tyr Pro Glu Pro Ile Phe Asp Thr Met Ile Ala Ser Gln Met Ile 95 100 105 TAT GCT GGG TTA GAT GAA CCA GAT GAA ATT TCT GAA GTT TTA GAA 361 Tyr Ala Gly Leu Asp Glu Pro Asp Glu Ile Ser Glu Val Leu Glu 110 115 120 GCA CTT AAA GAC GAT TTG ACT ACA GAA GAA GTA GCT ATA TTT GAT 406 Ala Leu Lys Asp Asp Leu Thr Thr Glu Glu Val Ala Ile Phe Asp 125 130 135 GTG TTT GGC AAG AAA AGA ACA AAA GCT ACC AAG TTT TCT CAC AGT 451 Val Phe Gly Lys Lys Arg Thr Lys Ala Thr Lys Phe Ser His Ser 140 145 150 CTG CAG GCT GTC TTA AAG AGA GAA CTA AAC ATT TTC TTA CCA AAA 496 Leu Gln Ala Val Leu Lys Arg Glu Leu Asn Ile Phe Leu Pro Lys 155 160 165 GAT GTT CAA AAC AGC AAT TGG GGA GGT GAG CTT AGT GAA GCC CAA 541 Asp Val Gln Asn Ser Asn Trp Gly Gly Glu Leu Ser Glu Ala Gln 170 175 180 AAG GAA TAT GCA ATT AAC GAT GTT AAA TAT CTT AAA GAT TTG TCA 586 Lys Glu Tyr Ala Ile Asn Asp Val Lys Tyr Leu Lys Asp Leu Ser 185 190 195 ATA GAG TTA TGG AAA AAA ATA AAG GCA TTG AAC ATT GAA A AT GTG 631 Ile Glu Leu Trp Lys Lys Ile Lys Ala Leu Asn Ile Glu Asn Val 200 205 210 TTT ATG TTA GAA ATG AAG TTT TTG CCT GTG TTA GTA ATG TTA GAG 676 Phe Met Leu Glu Met Lys Phe Leu Pro Val Leu Val Met Leu Glu 215 220 225 TTA ACA GGG GTG AAA ATT GAT AAA GAA GGT TGG AAG AAA AAA ATG 721 Leu Thr Gly Val Lys Ile Asp Lys Glu Gly Trp Lys Lys Lys Met 230 235 240 GAA AAA GAA AAT CAA GAG CTT TTA GAG CTA GAA AAA GAA CTT AAA 766 Glu Lys Glu Asn Gln Glu Leu Leu Glu Leu Glu Lys Glu Leu Lys 245 250 255 AAG GAA ATA TAT GAA AAA TTT GTT TCT AAA CAA AGT GAA AAA ATG 811 Lys Glu Ile Tyr Glu Lys Phe Val Ser Lys Gln Ser Glu Lys Met 260 265 270 ATG GTC GGA TTG TTT GAA GAT GCA GAA TAT GAA AAA ATA AAT CTA 856 Met Val Gly Leu Phe Glu Asp Ala Glu Tyr Glu Lys Ile Asn Leu 275 280 285 AAC TCA CCT TTA CAA ATG GCA AAA ATT TTT GGA TTG CCA AAT GTT 901 Asn Ser Pro Leu Gln Met Ala Lys Ile Phe Gly Leu Pro Asn Val 290 295 300 TCT AAG CTA ACC CTT GAG AAA ATT GAA GAT CCG ACA ATA AAA AAG 946 Ser Lys Leu Thr Leu Glu Lys Ile GluAsp Pro Thr Ile Lys Lys 305 310 315 TAT GTG GAA TAC AAA AAG AAA GCA AAG TTA GTA ACA ACC TAC TCA 991 Tyr Val Glu Tyr Lys Lys Lys Ala Lys Leu Val Thr Thr Tyr Ser 320 325 330 AAA GAA TAC TTA GAA AAA CTA ACA GAA AAC AAT AGG TTA ATG TCC 1036 Lys Glu Tyr Leu Glu Lys Leu Thr Glu Asn Asn Arg Leu Met Ser 335 340 345 GAT TAC TCA CAA ACG AAG ACT GCA ACT GGA AGA ATT AGT TCT AGT 1081 Asp Tyr Ser Gln Thr Lys Thr Ala Thr Gly Arg Ile Ser Ser Ser 350 355 360 AAC CCC AAC CTC CAA AAT GTT CCC TCT TGG TTT AAG AGA TAC ATA 1126 Asn Pro Asn Leu Gln Asn Val Pro Ser Trp Phe Lys Arg Tyr Ile 365 370 375 ACA GCA GAA GAA GGA TAT GTT CCT GTT TTT GCT GAT TAT TCT CAA 1171 Thr Ala Glu Glu Gly Tyr Val Pro Val Phe Ala Asp Tyr Ser Gln 380 385 390 GTT GAG CTG AGA ATC TTA GCT TAT CTA TCT GGA GAT GAG GCC ATG 1216 Val Glu Leu Arg Ile Leu Ala Tyr Leu Ser Gly Asp Glu Ala Met 395 400 405 ATT GAC AGC TGT AAT TCT AAA GAC ATG CAC AGC GAA AAT GCT AGA 1261 Ile Asp Ser Cys Asn Ser Lys Asp Met His Ser Glu Asn Ala Arg 410 415 420 AAG AT T TAC AAA ATT CCC CCA GAT CAA CCT GTT CCA CCA GAA CTA 1306 Lys Ile Tyr Lys Ile Pro Pro Asp Gln Pro Val Pro Pro Glu Leu 425 430 435 AGG AAG AAA GCA AAA ACA GTT TCA TTC GCC ATT CCT TAT GGT TCC 1351 Arg Lys Lys Ala Lys Thr Val Ser Phe Ala Ile Pro Tyr Gly Ser 440 445 450 TCA GCT TAT GGG TTG GTT GTG CGT GGC ATG TTC TCT AGT TTG GCG 1396 Ser Ala Tyr Gly Leu Val Val Arg Gly Met Phe Ser Ser Leu Ala 455 460 465 GAA GCA GAG GAA GCT ATT GAA GGT TTT TTC AAT AGC TTT CCT AAA 1441 Glu Ala Glu Glu Ala Ile Glu Gly Phe Phe Asn Ser Phe Pro Lys 470 475 480 GTT AAA GAG TTT CTA GAA AAA AGC GCA AAG AGT GCG CAA AAC GGC 1486 Val Lys Glu Phe Leu Glu Lys Ser Ala Lys Ser Ala Gln Asn Gly 485 490 495 ATT ACT AGA GAT GCG TTG GGT AGA GTA AGA AAC TAC AAG AAA ATC 1531 Ile Thr Arg Asp Ala Leu Gly Arg Val Arg Asn Tyr Lys Lys Ile 500 505 510 TAT ATT AGC GAA GAT GAA AAA GGA GCT TTA AAG ATA CTT ATG TTT 1576 Tyr Ile Ser Glu Asp Glu Lys Gly Ala Leu Lys Ile Leu Met Phe 515 520 525 AGA TTA CCT TCT GGA ATT TCT AAA GAT GAG TTT ATA AAG GAG GTT 1621 Arg Leu Pro Ser Gly Ile Ser Lys Asp Glu Phe Ile Lys Glu Val 530 535 540 TTA GAG AAA AAT AGC TTT AAA GAC GCT GCA AAA ATT TTT GGA ATG 1666 Leu Glu Lys Asn Ser Phe Lys Asp Ala Ala Lys Ile Phe Gly Met 545 550 555 GAT GAA CAA ATG CTA CAG CTA GCA ATT TCT GCT TAC GAA AAA ACA 1711 Asp Glu Gln Met Leu Gln Leu Ala Ile Ser Ala Tyr Glu Lys Thr 560 565 570 AAG AAA TTG GCT AAG ATT GCG AGA GAA GGA CAA AAT CAC CCG ATT 1756 Lys Lys Leu Ala Lys Ile Ala Arg Glu Gly Gln Asn His Pro Ile 575 580 585 CAA GCT ACT TCT GCA TCA ATT ACA AAA ACA GCT ATG GTT GAT CTC 1801 Gln Ala Thr Ser Ala Ser Ile Thr Lys Thr Ala Met Val Asp Leu 590 595 600 TTA GAA TAC CTG TCA ATG ACA GGG TAT GGA TAT ATG ACT TTA ACA 1846 Leu Glu Tyr Leu Ser Met Thr Gly Tyr Gly Tyr Met Thr Leu Thr 605 610 615 GTT CAT GAC AGC ATT TTC TTT GAA ATC AAG AAA GAA TTT ATT TTT 1891 Val His Asp Ser Ile Phe Phe Glu Ile Lys Lys Glu Phe Ile Phe 620 625 630 GAT GCA CTT CCA AAA ATA AAA GAA ATA ATG GAA CAA GCT GGT CCA 1936 Asp Ala Leu Pro Lys Ile Lys Glu Ile Met Glu Gln Ala Gly Pro 635 640 645 AAA GTT GTT CCC GGA ATT ATA ACT CCA GTT GAT GTT GAG GTA GGA 1981 Lys Val Val Pro Gly Ile Ile Thr Pro Val Asp Val Glu Val Gly 650 655 660 GAG AAA ATA TCG GTA TAT TGC AAT TCT TGC GGT AAA GAA AAC GAG 2026 Glu Lys Ile Ser Val Tyr Cys Asn Ser Cys Gly Lys Glu Asn Glu 665 670 675 ATT AAT AGA TAC ATG GTA AAT CTA AAT GAG AAG ATA ATT GTT GAT 2071 Ile Asn Arg Tyr Met Val Asn Leu Asn Glu Lys Ile Ile Val Asp 680 685 690 TTT ACT AAG GAT CCT TAT ATT TGC GAT GAA TGC TTT AAC AGG GTT 2116 Phe Thr Lys Asp Pro Tyr Ile Cys Asp Glu Cys Phe Asn Arg Val ATT TAAAATAGTTTAGAGATTTTCCTAACC GGATATTGCA 2169 Ile AACGATGCTA CTATAAAAAC TTCTAACAAA TCCAATTTTC TGCCAATCAA GTCTTCAAAT 2229 AGATTAGATA TAATCCACAG AAATCCAGCT ACTCCCCAAG AAATATCACG AAAACTCGGC 2289 TTTTGTTTAA TTATGAAGCT T 2310

[Brief description of drawings]

FIG. 1 is a diagram showing a restriction enzyme map of a 2.3 kb DNA fragment containing an enzyme gene obtained by the present invention.

FIG. 2 is a diagram showing a restriction enzyme map of a 2.5 kb HindIII fragment containing the enzyme gene obtained by the present invention.

FIG. 3 is a diagram showing the optimum pH of the enzyme obtained by the present invention.

FIG. 4 is a diagram showing the optimum temperature of the enzyme obtained by the present invention.

FIG. 5 is a diagram showing the optimum MgCl ₂ concentration of the enzyme obtained by the present invention.

FIG. 6 is a diagram showing the optimum KCl concentration of the enzyme obtained by the present invention.

FIG. 7 is a view showing NEM sensitivity of an enzyme obtained by the present invention.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication C12R 1:01) (C12N 9/12 C12R 1:19) C12R 1:01) (72) Inventor Ryojun Ishino 3-4-1 Seta, Otsu, Shiga Prefecture, Central Research Laboratory, Sake Brewing Co., Ltd. (72) Inventor Ikuno Kato 3-4-1, Seta, Otsu City, Shiga Prefecture, Central Research Laboratory, Sake Brewery Co., Ltd.

Claims (4)

[Claims] 1. An isolated thermophilic phage-derived DNA polymerase gene. 2. The DNA polymerase gene according to claim 1, which has a restriction enzyme map shown in FIG. 1 of the drawings and is contained in a gene having a length of 2.3 kb. 3. The DNA polymerase gene according to claim 1, which is capable of hybridizing with the DNA polymerase gene according to claim 2. 4. The thermophilic phage-derived D according to claim 1.
A transformant introduced with a recombinant plasmid containing the NA polymerase gene was cultured, and DNA was extracted from the culture.
A method for producing a DNA polymerase, which comprises collecting a polymerase.