JPH07108231B2 - Gene product manufacturing method - Google Patents

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to a method for producing a gene product. More specifically, the present invention relates to a method for producing a gene product using a Bacillus bacterium transformed with a recombinant DNA having a promoter activity.

[0002]

2. Description of the Related Art Gene manipulation techniques have been advanced using Escherichia coli, and many heterologous genes have already been expressed in Escherichia coli. Not only is Bacillus subtilis living in soil and not known to be associated with animal or plant diseases,
It has been used for the production of foods such as natto and has been known for its safety since ancient times. Bacillus subtilis is a fermenting microorganism widely used in industry, and a management system on an industrial scale has been established. In addition, Bacillus subtilis is a Gram-positive bacterium and, as compared with the Gram-negative bacterium Escherichia coli, is more susceptible to many antibiotics such as β-lactam antibiotics and macrolide antibiotics, and thus kills viable bacteria more rapidly. It is possible to visit. Focusing on these excellent characteristics of Bacillus subtilis, development of an expression system for a heterologous gene using Bacillus subtilis is currently drawing attention. However, since Bacillus subtilis does not have an excellent expression vector as in Escherichia coli, the number of cases in which a heterologous gene is expressed in Bacillus subtilis is extremely smaller than that in E. coli, and examples thereof include the hepatitis B virus C antigen gene and the oral cavity. Expression of the hoof disease virus main antigen (VPI) gene [K. Hardy et al: Nature, 293 , 481 (198).
1)], Expression of E. coli trpC gene [DW Williams
et al: Gene, 16 , 199 (1981)], mouse dih
Expression of the ydrofolate reductase gene [DM Williams
et al: Gene, 16 , 199 (1981)]; RG Sch
oner et al: Gene, 22 , 47 (1983), Expression of human interferon-β gene [S. Chang et al: Proc
eedings of the IVth International Symposium
on Genetics of Industrial Microorganisms p.277
(1982)] and the like. Further, since the expression level thereof is generally small, it is desired to develop an excellent expression vector having a strong promoter in Bacillus subtilis. Vag promoter, tms promoter, penP promoter, SPO1 promoter, φ29 are used as Bacillus subtilis promoters whose nucleotide sequences have been clarified to date.
AI promoter [CPMoran Jr. et al: Mol. Gen.
Genetics, 186 , 339 (1982)] and SPO2
Promoter [RG Schoner et al. Gene, 22 , 4
7 (1983)] and the like, but of these, only the SPO2 promoter is actually used for gene expression. In addition, most of the heterologous gene products expressed so far are produced as fusion proteins.

[0003]

In view of these situations,
The present inventors have conducted research aiming at the development of a stronger gene expression system using Bacillus subtilis. As a result, they learned that a strong promoter was obtained from the chromosomal DNA of Bacillus subtilis, and based on this, they succeeded in constructing a gene expression vector and expressing the gene, and completed the present invention.

[0004]

The present invention is a recombinant comprising an SD sequence downstream of the base sequence shown in FIG. 1 or a part thereof having promoter activity, and a gene encoding a protein of interest downstream of the SD sequence. It is intended to provide a method for producing a gene product, which comprises culturing a Bacillus bacterium transformed with DNA and collecting a target protein from the culture. DN of the base sequence shown in FIG.
A is, for example, a known method for preparing DNA, for example, Lo
vett et al. [Methods in Enzymology, 68 , 342]
(1979)] and the like.
us) It can be obtained by cloning a chromosomal DNA of a genus fungus as a raw material using a promoter cloning vector. The above-mentioned chromosomal DNA may be any of those belonging to the genus Bacillus, for example, Bacillus subtilis JB-1-
168 (IFO-14144), Bacillus subtilis 1
68, Bacillus subtilis MI114 and the like. Bacillus subtilis 168 is the Bacillus Genetic Stock Center [The Bacillus G
BGSC No. 1A1 [The Baci]
llus Genetic Stock Center, Catalog of Strains (Sec
ond edition)] and also Bacillus subt
ilis MI114 is a reference [Gene, 24 , 255 (198
3)], and is also available from Mitsubishi Life Research Institute.

As a vector (promoter cloning vector) used for cloning a DNA fragment having a promoter activity using chromosomal DNA, for example, a chromosomal DNA fragment of Bacillus sp. Any plasmid can be used as long as it can be known that the promoter is present in, for example, a plasmid having a gene in which the promoter portion is deleted, and specifically, plasmid pBTM126 (Fig. 2). And so on. The plasmid pBTM126 was obtained by Williams et al. [J. Bacteriol., 146 , 1162 (1
981)] and pPL603. That is, these plasmids pBTM126 and p
PL603 is a kanamycin resistant plasmid pUB110 [Plas derived from Staphylococcus genus.
mid, 6 , 67 (1981)] and Bacillus pumilus (B
acillus pumilus) NCIB8600 chloramphenicol acetyl transferase (hereinafter CAT
It is constructed by deleting the promoter portion of the CAT gene from a recombinant plasmid with a gene, and the resistance to chloramphenicol is lost. In order to clone a DNA fragment having a promoter activity derived from the chromosome into this plasmid pBTM126, it was obtained by cutting the chromosomal DNA with a restriction enzyme at a restriction enzyme cleavage site upstream of the CAT structural gene of this plasmid, for example, EcoRI and PstI. DN
The A fragment may be ligated using, for example, T4 DNA ligase, and Bacillus subtilis may be transformed using this to isolate chloramphenicol-resistant transformants. The promoter activity can be measured, for example, according to the method of Williams et al. (Supra).

For a DNA fragment having a promoter activity, a plasmid is prepared from the transformant, which is then cleaved with, for example, a restriction enzyme, followed by a method known per se such as polyacrylamide gel electrophoresis or agarose gel electrophoresis. It can be isolated. The base sequence of the isolated DNA fragment is known per se, for example, the dinucleotide synthetic chain termination method [Proc. Natl. Acad. Sci., USA, 7
4 , 5463 (1977)]. The DNA fragment having promoter activity shown in FIG. 1 and a part thereof are known per se, for example, the triester method [R. Crea et al: Proc. Natl. Acad. Sci., US
A, 75 , 5765 (1978)]. The DNA fragment of the present invention has a strong promoter activity and is considered to be useful not only as a promoter for an excellent expression vector of Bacillus but also as a promoter for expression vectors of Escherichia coli and actinomycetes. To be The target protein is a transformant obtained by transforming Bacillus with a DNA in which a gene encoding the target protein is ligated downstream of a promoter and a ribosome binding site (SD sequence) necessary for transcription initiation. It can be obtained by culturing.

Any of the above SD sequences may be used as long as it functions in Bacillus subtilis, and some of the sequences are already known [JR McLaughl
inet al: J. Biol. Chem. 256 , 11283 (198).
1), CP Moran Jr. et al: Mol. Gen. Genetics, 1
86 , 339 (1982)]. Therefore, the desired expression can be obtained by isolating the oligonucleotide containing the SD sequence from the chromosomal DNA or chemically synthesizing it by a method known per se, for example, the triester method (supra), and inserting it downstream of the promoter in a vector having the promoter. Vectors can be constructed. The oligonucleotide has a restriction enzyme recognition site (eg, ClaI site, BamHI site, SalI site) downstream of the SD sequence.
It is more convenient to have It is more desirable that the gene used for expression has no intervening sequence and has a clear base sequence, and the gene isolated from the chromosome, complementary DNA obtained from mRNA, chemically synthesized gene, semisynthetic gene, etc. It can be anything. Specifically, immune interferon gene, hepatitis B virus (HBV)
Examples include surface antigen gene, HBV core antigen gene, immunoglobulin E gene, human growth hormone gene, interleukin-2 gene, etc., and all or part of the gene may be used. In addition, when these genes are inserted into an expression vector to construct an expression plasmid, an appropriate synthetic oligonucleotide may be linked to the gene as necessary. When transforming a bacterium of the genus Bacillus with the plasmid thus obtained, the host is not particularly limited. For example, Bacillus subtilis BGSC1
A1, BGSC1A339, BGSC1A340 and the like [The Bacillus Genetic Stock Center, C
atalog of Strains (Second edition), published in 1982]. The transformant is cultured in a medium known per se, such as L medium, at 20 to 40 ° C. for 3 to 48 hours. After completion of the culture, cells are collected by a method known per se, and freeze-thaw method,
The produced protein can be extracted by dissolving the bacterial cells by a method such as a lysozyme addition method, an ultrasonic treatment method, a surfactant addition method, or a combination thereof. The extracted protein can be purified according to a conventional protein purification method to obtain the desired protein. When the target protein is human immune interferon, it can be extracted by the following method. Human immunity is cultivated by culturing Bacillus bacteria having an interferon gene, and the collected bacterial cells are lysed by a combination of two or more of freeze-thawing method, lysozyme addition method and ultrasonic treatment method to obtain human immunity. Extract interferon.

In the freeze-thaw method, -20 ° C to -16
Frozen cells at about 0 ° C will thaw at around + 4 ° C for 10 hours
A method of melting for about 2 to 3 minutes is preferably used. The lysozyme used in the lysozyme addition method may be any type of lysozyme and has a bacterial cell concentration of 1 × 10 ⁴ to 1
× 10 ¹⁰ cells / ml final concentration 50-5000 μg
It is preferable that lysozyme is added so that the concentration is about 500 ml / ml, preferably about 500 to 1000 μg / ml, and the treatment is performed at about + 15 ° C. to + 40 ° C., preferably about + 28 ° C. to + 37 ° C. The treatment time varies depending on the type and amount of lysozyme and the treatment temperature, but generally 5 minutes to 30 minutes is preferable.

In the ultrasonic treatment method, a wavelength of 10 kHz-
At about 30 KHz for about 5 to 60 seconds, preferably 5 to 20
It is preferable to treat the cells for about a second to crush the cells. Human immune interferon can be easily extracted by disrupting the cells by a method combining two of these three methods, but it is more preferable to disrupt the cells by combining the three methods. Also, if necessary, various surfactants and protease inhibitors may be added. Table 1 shows the meanings of the symbols used in the claims, the detailed description of the invention, the brief description of the drawings and the drawings of the present application.

Table 1 DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP : Deoxyguanosine triphosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Leu: Leucine Thr: Threonine Cys: Cysteine Met: Methionine Glu: Glutamic acid Lys: Histilysine Hisis Phe: phenylalanine Gln: glutamine

[0011]

The present invention will be described in more detail with reference to Reference Examples and Examples below, but the present invention should not be limited thereto. Reference Example 1 Construction of Promoter Cloning Vector pBTM126 The plasmid pBTM126 was prepared as follows according to the method of Williams et al. Bacillus pumilus NCIB8600 (IFO-12 obtained from Fermentation Research Institute)
089) and prepared the DNA (6.5 μm
g) was cleaved by reacting with 40 units of restriction enzyme EcoRI at 37 ° C. for 1 hour, then heated at 68 ° C. for 15 minutes,
Ethanol precipitation was performed. On the other hand, the plasmid pUB11
0 (2.0 μg) was digested with 20 units of restriction enzyme EcoRI at 37 ° C for 1 hour and cleaved.
After heating for a minute, ethanol precipitation was performed. Both precipitates were dissolved in water and mixed, and a reaction solution (100 μl) containing 60 nmole of ATP, 10 units of T4 DNA ligase (manufactured by Takara Shuzo) and a ligase buffer was kept at 11 ° C. for 30 hours for ethanol precipitation. It was The precipitate was dissolved in TE buffer (50 μl) and 25 μl of it was used for Bacillus
Transformation of subtilis MI114 was performed. A plasmid was prepared from a transformant resistant to chloramphenicol,
The plasmid was named pBTM124. Then, the plasmid pBTM124 (2.5 μg) was cleaved by reacting with 14 units of the restriction enzyme PstI at 37 ° C. for 1 hour,
After heat treatment at 15 ° C for 15 minutes, ethanol precipitation was performed. The precipitate was dissolved in water, a reaction solution (100 μl) containing 66 nmole of ATP, 10 units of T4 DNA ligase (manufactured by Takara Shuzo) and a ligase buffer was kept at 11 ° C. for 24 hours for ethanol precipitation. The precipitate was dissolved in TE buffer, Bacillus subtilis MI114 was transformed, a plasmid was prepared from a kanamycin-resistant transformant, and the plasmid was named pBTM125. This plasmid is obtained by removing the promoter site (PstI fragment) of the CAT gene of the plasmid pBTM124. Next, plasmid pBTM125 (2.5 μg) was added to
Cleavage was performed by reacting with 8 units of restriction enzyme BamHI and 15 units of restriction enzyme BglII at 37 ° C. for 1 hour, and
After heat treatment at 8 ° C for 15 minutes, ethanol precipitation was performed. After dissolving the precipitate in water, 66 nmole of ATP, 1
Bacillus subtilis MI was incubated in a reaction solution (100 μl) containing 3 units of T4 DNA ligase (Takara Shuzo) and ligase buffer at 11 ° C. for 28 hours.
114 transformations were performed. A plasmid was prepared from a transformant resistant to kanamycin, and the plasmid was designated as pBTM.
It was named 126.

Reference Example 2 Construction of plasmid pHITtrp2101 Plasmid pHIT3709 containing immune interferon (IFN-γ) cDNA and expression vector ptrp60.
1 was constructed according to the method described in JP-A-58-189197. First, the plasmid pHIT3709 was digested with the restriction enzyme PstI to obtain a PstI fragment containing the IFN-γ structural gene, and this fragment was partially digested with the restriction enzyme BstNI to cleave the BstNI site in the IFN-γ structural gene. A BstNI-PstI fragment was obtained. An oligonucleotide adapter containing a translation initiation codon ATG, which was chemically synthesized by the triester method after filling in the free region of the BstNI cleavage site with a DNA polymerase I large fragment. Was ligated with T4 DNA ligase. On the other hand, the IFN-γ gene bound with the above-mentioned adapter was ptrp771 [Y. F.
ujisawa, et al Nucleic Acids Res., 11 , 3581
(1983)] was inserted into the downstream of the tryptophan promoter of the fragment obtained by cutting with the restriction enzymes PstI and ClaI, and ligated with T4 DNA ligase to give IFN.
The γ expression plasmid pHITtrp1101 was constructed.
Next, use ptrp601 with the restriction enzyme ClaI and the restriction enzyme Hpa.
ClaI-HpaI containing the trp promoter after treatment with II
An I fragment of 0.33 kb was obtained. This fragment was digested with ClaI and treated with alkaline phosphatase to produce pHITtrp110.
1 was ligated with T4 DNA ligase to obtain pHITtrp2101 having two trp promoters in tandem.

Reference Example 3 (i) Isolation of mRNA encoding human IL-2 Lymphocytes prepared from human peripheral blood were treated with 12-O-tetradecanoylphorbol-13-acetate (TPA) (1).
5 ng / ml) and Concanavalin A (40 μg / ml) in RPMI1640 medium (containing 10% fetal calf serum)
The medium was cultured at 37 ° C. to induce IL-2. After 24 hours, the induced 1 × 10 ¹⁰ human lymphocytes were treated with 5M guanidine thiocyanate, 5% mercaptoethanol,
50 mM Tris.HCl pH 7.6, 10 mM EDTA
After destructive denaturation with a Teflon homogenizer in the solution, sodium N-laurylyl sarcosinate was added to 4%, and the homogenized mixture was added to a 5.7M cesium chloride solution (5.7M cesium chloride, 0.1M EDTA). 6m
Layer on top, and centrifuge at 24,000 rpm for 48 hours at 15 ° C using the rotor of Beckmann SW28,
A NA precipitate was obtained. This RNA precipitate was dissolved in a 0.25% sodium N-lauroyl sarcosinate solution and then precipitated with ethanol to obtain 10 mg of RNA. This RNA
A high salt solution [0.5 M NaCl, 10 mM Tris.HCl.
pH 7.6, 1 mM EDTA, 0.3% SDS] was adsorbed on an oligo (dT) cellulose column, and mRNA containing poly (A) was added to a low salt solution (10 mM Tris · HCl pH).
300 μg of mRNA containing poly (A) was collected by elution with 7.6, 1 mM EDTA, 0.3% SDS). This mRNA was further precipitated with ethanol,
0.2 ml of solution (10 mM Tris.HCl pH 7.6,
2 mM EDTA, 0.3% SDS), treated at 65 ° C. for 2 minutes and subjected to 10-35% sucrose density gradient centrifugation (using a Beckman SW28 rotor at 20 ° C., 25
It was fractionated by centrifugation at 000 rpm for 21 hours to obtain 22 fractions. A part of RNA for each fraction was injected into Xenopus oocytes, and IL-2 activity in the synthesized protein was measured.
The activity of IL-2 was detected (precipitation constant 8S-15S). The amount of IL-2 mRNA in this fraction was about 25 μg.

(Ii) Synthesis of single-stranded DNA Using the mRNA and reverse transcriptase obtained above, 100 μm
1 reaction solution (5 μg mRNA, 50 μg oligo (d
T), 100 units of reverse transcriptase, 1 mM dA each
TP, dCTP, dGTP and dTTP, 8 mM Mg
Cl ₂ , 50 mM KCl, 10 mM dithiothreitol,
After incubating in 50 mM Tris · HCl pH 8.3) at 42 ° C. for 1 hour, deproteinization with phenol,
RNA was decomposed and removed by treatment with 0.1 N NaOH at 70 ° C. for 20 minutes.

(Iii) Synthesis of double-stranded DNA The single-stranded complementary DNA synthesized here is reacted in 50 μl of reaction solution (the same reaction solution as above except that mRNA and oligo dT are not included) at 42 ° C. for 2 hours. Double strand D
NA was synthesized.

(Iv) Addition of dC tail 50 μl of reaction solution (double-stranded DNA, 0.1M sodium acetate pH 4.5, nuclease S1 was added to this double-stranded DNA.
After reacting in 0.25 M NaCl, 1.5 mM ZnSO ₄ , 60 units of S1 nuclease) at room temperature for 30 minutes, deproteinizing with phenol and precipitating DNA with ethanol, 50 μl of a reaction solution of terminal transferase ( Double-stranded DNA, 0.14 M potassium cacodylate, 0.3 M Tris (base) pH 7.6, ₂ mM dithiothreitol, 1 mM CoCl ₂ , 0.15 mM dCTP,
30 unit terminal transferase) for 3 minutes at 37 ° C. to extend about 15 deoxycytidine chains at the 3 ′ end of the double-stranded DNA. In these series of reactions, the duplex D having about 300 ng of deoxycytidine chain
I got NA.

(V) Cleavage of E. coli plasmid and addition of dG tail On the other hand, 10 μg of E. coli plasmid pBR322DNA
Restriction enzyme PstI in 50 μl of reaction solution (10 μg DN
A, 50 mM NaCl, 6 mM Tris.HCl pH 7.
4,6 mM MgCl ₂ , 6 mM 2-mercaptoethanol, 100 μg / ml bovine serum albumin, 20 units of PstI) for 3 hours at 37 ° C. to generate pBR322D.
After cleaving one PstI recognition site in NA and deproteinizing with phenol, 50 μl of reaction solution of terminal transferase (DNA 10 μg, 0.14 M potassium cacodylate, 0.3 M Tris / base pH 7.6, 2 m)
M dithiothreitol, 1 mM CoCl ₂ , 0.15 mM
dGTP, 30 unit terminal transferase) for 3 minutes at 37 ° C.
About 17 deoxyguanine chains were extended at the 3'end of 322 DNA.

(Vi) Association of cDNA and transformation of E. coli 0.1 μg of the thus obtained synthetic double-stranded DNA and 0.1 μg of the above plasmid pBR322, 0.5 μg
aCl, 50 mM Tris.HCl pH 7.6, 1 mM E
The solution was heated at 65 ° C. for 2 minutes and 45 ° C. for 2 hours in a solution consisting of DTA, and then slowly cooled to associate them with the method of Enea [J. Mol.
ol., 96 , 495 (1975)].
94 were transformed.

(Vii) Isolation of cDNA-Containing Plasmid In this manner, about 20,000 tetracycline-resistant strains were isolated, and the DNA of each of them was immobilized on a nitrocellulose filter. Next, IL-2 reported by Taniguchi et al. [Nature, 302 , 305 (1983)].
Amino acids No.74-78 based on the amino acid sequence of
^{(Lys 74 -His-Leu-Gln} -Cys) and amino acid No.122~126 (Thr ¹²² -Phe-M
et-Cys-Glu) corresponding nucleotide sequence (5'AA
A CAT CTT CAG TGT 3'and 5'A
CA TTC ATG TGT GAA 3 ') using the triester method [R. Crea et al. Proc. Natl. Acad. Sci. U.
SA, 75 , 5765 (1978)]. A 50 μl reaction solution (0.20 μg of oligonucleotide, 50 mM Tris · HCl pH was added to this oligonucleotide using T4 polynucleotide kinase.
The reaction was carried out for 1 hour at 37 ° C. in 8.0, 10 mM MgCl ₂ , 10 mM mercaptoethanol, 50 μCiγ- ³² PATP, 3 unit T4 polynucleotide kinase, and the 5'end was labeled with ³² P. Using this labeled oligonucleotide as a probe, the method of Lawn et al. [Nucleic
Acids Res., 9 , 6103 (1981)] and associated with the DNA immobilized on the above nitrocellulose filter, and four strains which react with the above two kinds of oligonucleotide probes were isolated by autoradiography. Plasmid DNA from each of these strains
The alkaline method [HC Birnboim & J. Doly: Nucleic Ac
ids Res., 7 , 1513 (1979)]. Next, the insertion part of the plasmid DNA was cut out with the restriction enzyme PstI, and the isolated plasmid containing the longest fragment of the insertion part was selected and this plasmid was named pILOT135-8 (FIG. 3). Next, the cD inserted into this pILOT135-8 plasmid
The primary structure (base sequence) of the NA sequence was determined by the dideoxynucleotide synthetic chain termination method and the Maxam-Gilbert method. Its primary structure is shown in FIG. The peptide defined by this base sequence has a synthesis initiation signal (No. 64-66).
ATG) and consists of 153 amino acids.
Of these, 20 amino acids from the N-terminus are considered to be a signal peptide. From the above primary structure, it was revealed that this plasmid has the entire nucleotide sequence encoding the human IL-2 protein. Due to this fact, any gene of the IL-2 protein can be produced by incorporating the gene incorporated in the plasmid into another expression plasmid.

(Viii) Plasmid pILOT135-
8 was cleaved with the restriction enzyme HgiA1 to give 1294 bp of IL-
A DNA fragment containing 2 genes was obtained. This DNA fragment is
After treatment with 4DNA polymerase, a ClaI linker having alanine codon GCA and a methionine codon ATG, CGATA ATG GCA, was ligated to Cla.
After treatment with I, it was integrated into the ClaI site of ptrp771 (Y. Fujisawa et al., Supra), and the resulting plasmid was named pTF5.

Example 1 Promoter Cloning The promoter cloning vector pB obtained in Reference Example 1
TM126 (2.1 μg) was digested with the restriction enzyme PstI (8 units) at 37 ° C. for 1 hour, and then the restriction enzyme E was further added.
Cut with coRI (5 units) at 37 ℃ for 1 hour, 68 ℃
The reaction was stopped by heating for 15 minutes and ethanol precipitation was performed. On the other hand, Bacillus subtilis JB-1-16
8 (IFO-14144) chromosome (6.2 μg)
tI (24 units) and EcoRI (15 units)
Each of them was cut at 37 ° C. for 1 hour, heat-treated at 68 ° C. for 15 minutes, and then ethanol precipitated. Both precipitates were dissolved in water and mixed, then adenosine triphosphate (66 nmol
e) and T4 DNA ligase [manufactured by Takara Shuzo] (10 units) were reacted at 11 ° C. for 24 hours to perform ethanol precipitation. Precipitate 10 mM Tris-HCl buffer pH 8.
B. subti was dissolved in 0.1 mM EDTA (TE buffer).
Transformation of lis MI114 was performed by the protoplast method [S. Cha.
ng and SN Cohen; Mol. Gen. Genet., 168 , 11
1 (1979)], and DM3 agar plate containing 12.5 μg / ml chloramphenicol [Mol. Gen. Ge.
net., 168 , 111 (1979)] is 95.
Six transformants were obtained. Furthermore, 20 strains grew when replicating on a Brain Heart Infusion (Difco, USA) agar plate containing 200 μg / ml chloramphenicol. These transformants carry a plasmid into which a DNA fragment having a strong promoter activity has been incorporated.

Example 2 The promoter activity of a DNA fragment obtained from chromosomal DNA was determined by measuring the CAT activity based on the method of Williams et al. [Supra]. For this activity measurement, one of the 20 transformants obtained in Example 1 Bacillus
ussubtilis T48 [plasmid pBTM128 (Fig. 2
Bacillus subtilis MI114] containing the above) and the plasmid pBTM obtained in Reference Example 1 as a control.
Bacillus subtilis MI114 containing 124 (containing the CAT gene containing the promoter) and pBTM126 (containing the CAT gene lacking the promoter) was used. First, each strain contained chloramphenicol (5 μg /
ml) or a non-containing L medium (40 ml) in a 200 ml Erlenmeyer flask at 30 ° C. for 16 hours with shaking. Next, centrifuge 10 ml of the obtained culture solution to collect 20 m of cells.
It was washed with M Tris-HCl buffer (pH 7.8).
The washed cells were suspended in 1 ml of the same buffer containing 0.5 mg / ml lysozyme, incubated at 37 ° C for 25 minutes, treated with an ultrasonic disruptor for 2 A for 10 seconds, and centrifuged to obtain a supernatant. Was used as an enzyme solution for activity measurement. The CAT activity is determined by a colorimetric method using 5 ', 5-dithiobis (2-nitrobenzoic acid) (Methods in Enzymology, 43, 737,
1975). For proteins, the method of Lowry et al. [J.
Biol. Chem., 193 , 265 (1951)]. The results are shown in Table 2.

[0023]

[Table 2] In the table, + Cm represents L medium containing 5 μg / ml of chloramphenicol, and −Cm represents L medium not containing chloramphenicol. From this result, it was revealed that the DNA fragment cloned in pBTM128 has a strong promoter activity.

Example 3 Preparation of plasmid Bacillus subtilis T48 was supplemented with 1% tryptone (Difco, USA), 0.5% yeast extract (Difco), 0.5.
L medium (500 m
The culture was performed at 28 ° C. for 16 hours with shaking at l). Obtained 50
The cells collected by centrifuging 0 ml of the culture solution were added to 60 ml of 2
TES buffer containing 5% sucrose (30 mM Tris HC
pH 8.0-50 mM NaCl-5 mM EDTA),
12 ml of 0.25M EDTA pH 8.0, 16 ml of 5
A mg / ml lysozyme solution and 0.8 ml of a 5 mg / ml ribonuclease A solution were added, and the mixture was incubated at 37 ° C for 30 minutes.
Add another 8 ml of 10% sodium lauroyl sulfate,
Incubated at 37 ° C for 15 minutes. Then, 20 ml of 5M sodium chloride was added, and the mixture was left at 0 ° C. for 3 hours and then centrifuged. Add 2 volumes of cold ethanol to the supernatant and
I left it overnight. 8.6 ml of the precipitate obtained by centrifugation
Dissolved in TES buffer containing 0.4% Zarcoseal,
After adding 9 g of cesium chloride and 0.25 ml of a 30 mg / ml ethidium bromide solution, 38,000 at 20 ° C. using a Beckman ultracentrifuge (rotor 50 Ti).
It was centrifuged at rpm for 48 hours. Take the band of plasmid detected by UV irradiation, and add it to [(specific gravity) =
1.6] of a cesium chloride-ethidium bromide solution was added, and the mixture was centrifuged again at 20 ° C. and 55,000 rpm for 6 hours using a Beckman ultracentrifuge (rotor Vti65).
The band of the plasmid was taken, ethidium bromide was removed by n-butanol extraction, and then dialyzed with TE buffer to prepare plasmid pBTM128 (see FIG. 2). It was found from the absorbance at 260 nm that about 330 μg of plasmid was obtained.

Example 4 Isolation and Characterization of Promoter DNA Fragment Plasmid pBTM128 (221 obtained in Example 3
μg) to PstI (208 units) and EcoRI (2
20 units) and each of them was cut at 37 ° C. for 1 hour and subjected to 10% polyacrylamide gel electrophoresis. The gel was immersed in an ethidium bromide solution for staining, and the promoter DNA fragment detected by an ultraviolet lamp was recovered. After the DNA fragment was electrically eluted from the gel, phenol extraction and ether extraction were performed, and ethanol precipitation was performed. The precipitate was dissolved in TE buffer and 3.55 μg of promoter D
The NA fragment was isolated. The size of the obtained promoter DNA fragment was measured by 4% polyacrylamide gel electrophoresis. When the Hae III degradation product of the plasmid pBR322 was used as a standard, it was calculated to be about 120 bp. The nucleotide sequence of this fragment was determined as shown in FIG. 1 by the dinucleotide synthetic chain termination method (supra). This fragment consists of 117 bp and has an EcoRI cleavage site at the 5'end and a PstI cleavage site at the 3'end. In addition, nucleotide sequences considered to be −10 region and −35 region are recognized in the fragment.

Example 5 Construction of Expression Vector pBTM134 The plasmid pBTM128 (7.7 obtained in Example 3)
μg) with restriction enzyme PstI (51 units) at 37 ° C, 1
After reacting for a period of time to cleave, it was treated with 0.75 units of E. coli alkaline phosphatase at 65 ° C. for 30 minutes. The reaction product was collected by subjecting the reaction solution to phenol extraction and ether extraction, followed by ethanol precipitation. The precipitate was dissolved in a small amount of water, and an 8 nucleotide synthetic nucleotide GGAGGTAT (200n
g), a 14-nucleotide synthetic nucleotide CGATACCTCCTGCA (350 ng), which is phosphorylated at the 5'end, 1
00 nmole of ATP, 28 units of T4 DNA ligase (Takara Shuzo) and a ligase buffer were added, and the reaction solution (100 μl) was incubated at 11 ° C. for 20 hours, followed by ethanol precipitation. The precipitate was dissolved in a small amount of water, treated with 25 units of ClaI at 37 ° C. for 1 hour, the small oligonucleotides were removed with a Sepharose 4B column, and the desired product was ethanol precipitated and collected. Dissolve the precipitate in water,
100nmole of ATP, 28 units of T4DN
A reaction solution (100 μl) containing A ligase (Takara Shuzo) and a ligase buffer solution was kept warm at 11 ° C. for 20 hours to prepare Cla.
After ligating the I sites, 50 μl of the I site was used for the Bacillus subtilis MI11 by the protoplast method (supra).
4 was transformed. A plasmid was isolated from a transformant resistant to kanamycin and chloramphenicol, and this plasmid was named pBTM134 (see FIG. 5).

Example 6 Expression of Human Immune Interferon Gene Phosphorylation of 5 ′ end to 5 μg of 1.03 kb ClaI-PstI fragment containing the human immune interferon gene obtained by isolation from the plasmid pHITtrp2101 obtained in Reference Example 2. Synthesized 8-base oligonucleotide GA
TCGATC (300 ng), phosphorylated at the 5'end 1
Two base synthetic oligonucleotide GATCGATCTG
A reaction solution (100 μl) containing CA (450 ng), 100 nmole of ATP, 2000 units of T4 DNA ligase (New England Biolabs, USA) and a ligase buffer solution was incubated at 11 ° C. for 24 hours, and then ethanol precipitation was performed. . The precipitate was dissolved in water and reacted with 25 units of restriction enzyme ClaI at 37 ° C. for 1 hour. Then, small oligonucleotides were removed by Sepharose 4B column (1.5 ml) and ethanol precipitation was carried out to analyze the human immune interferon gene. D with both ends becoming ClaI sites
The NA fragment was obtained. On the other hand, 1.1 μg of the expression vector pBTM134 obtained in Example 5 was added to 10 units of ClaI.
It was cleaved at 37 ° C. for 1 hour, treated with 0.1 unit of E. coli alkaline phosphatase at 65 ° C. for 30 minutes, extracted with phenol and extracted with ether, and precipitated with ethanol. This precipitate and the above precipitate were dissolved in a small amount of water and mixed, and then 100 nmole of ATP, 12 was added.
A reaction solution (100 μl) obtained by adding 00 units of T4 DNA ligase (manufactured by New England Biolabs) and a ligase buffer was kept warm at 11 ° C. for 24 hours, and 50 μl of this was used by the Bacillus protoplast method.
Subtilis MI114 was transformed. A plasmid was isolated from a transformant resistant to kanamycin, and pBTM1 was isolated.
Plasmids in which DNA fragments having the human immune interferon gene were inserted in the forward and reverse directions at the ClaI site of 34 were pHIT-B101 (see FIG. 6), respectively.
And pHIT-B102. Plasmid pB
TM134, pHIT-B101 and pHIT-B1
40 ml of Bacillus subtilis MI114 holding 02
20 of L medium (containing 5 μg / ml of kanamycin)
Inoculate a 0 ml Erlenmeyer flask from the agar medium, and incubate at 37 ° C for 5
When cultured with shaking for an hour, the OD ₆₀₀ reached 1.2. The obtained culture broth was centrifuged, and the cells were washed with 30 mM Tris-HCl buffer pH 8.0-50 mM NaCl-5 mM E.
After washing twice with DTA, it was frozen with dry ice-ethanol (-70 ° C). 2 ml of this frozen cell is 50m
M Tris / HCl buffer pH 8.0-10% sucrose-1
Suspended in 00 mM NaCl-10 mM EDTA-20 mM spermidine-1 mg / ml albumin, 40 μl of 20 mg
/ Ml lysozyme solution was added, and the mixture was kept at 37 ° C. for 20 minutes and then treated with an ultrasonic crusher at 19.5 KHz for 10 seconds. The treated solution was centrifuged at 15,000 rpm for 15 minutes, and the supernatant was used as a standard for quantifying human immune interferon. As a result of quantifying the antiviral activity of the human immune interferon obtained above by the cytopathic effect inhibition test of vesicular stomatitis virus (VSV) on human amnion-derived wish cells, plasmid pBTM134, pHIT-B
No human immune interferon activity was observed in the Bacillus subtilis MI114 strain carrying 102, but Bacillus subtili carrying plasmid pHIT-B101.
In the s MI114 strain, human immunointerferon activity of 1238 units / ml (extract) was observed.

Example 7 Expression of IL-2 Gene The plasmid pBTM134 (1 μg) was digested with the restriction enzyme ClaI.
Cut with (10 units) at 37 ℃ for 1 hour,
65 with 1 unit of E. coli alkaline phosphatase
After treatment at 30 ° C. for 30 minutes, the reaction solution was subjected to phenol extraction and ether extraction, and ethanol precipitation was performed to precipitate DNA. On the other hand, from the plasmid pTF5 having the IL-2 gene obtained in Reference Example 3, a 1.3 kb ClaI DNA fragment containing the IL-2 gene was isolated. The ClaI degradation product (0.5 μg) of the plasmid pBTM134 obtained as described above and the 1.3 kb ClaI DNA fragment (0.6 μg) were mixed, and 100 nmole of ATP,
A 100 μl reaction solution containing 2000 units of T4 DNA ligase (New England Biolabs) and a ligase buffer was kept warm at 11 ° C. for 24 hours to obtain pB.
A 1.3 kb ClaI DNA fragment was ligated to TM134. Using this, Bacillus subtilis MI114 was transformed, a plasmid was prepared from the obtained kanamycin resistant strain, and a 1.3 kb DNA fragment having the IL-2 gene was inserted in the forward and reverse directions at the ClaI site of plasmid pBTM134. The obtained plasmids were obtained and named pILT-B101 and pILT-B102, respectively. The direction of this DNA fragment is the restriction enzyme EcoRI-X.
Determined using baI. This plasmid pILT-B1
Bacillus subtilis MI114 having 01 was used as IFO-14305 at the Fermentation Research Institute and FERMBP-6 at the Institute of Microbial Technology of the Ministry of International Trade and Industry.
Deposited as 10. Plasmid pBTM13
4, Bacillus subtilis MI114 harboring pILT-B101 and pILT-B102 was cultured in a 200 ml Erlenmeyer flask containing 40 ml of L medium (containing 5 μg / ml of kanamycin) at 37 ° C. for 4 hours with shaking to give an OD _600.
Has reached 1.1 to 1.5. The obtained culture solution was centrifuged, and the collected bacterial cells were washed 3 times with 1 M KCl, and then frozen with dry asui-ethanol (-70 ° C). Next, 2 ml of 30 mM Tris.HCl (pH 8.
0) -50 mM NaCl-5 mM EDTA-1 mg / ml albumin was suspended, 50 μl of 20 mg / ml lysozyme solution was added thereto, and the mixture was kept at 37 ° C. for 15 minutes and then treated with an ultrasonic crusher for 19.5 KHz for 10 seconds. did. The treated solution was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was
It was used for quantification of L-2. IL-2 was quantified by promoting the growth of IL-2-dependent mouse NKC3 cells by measuring the incorporation of ³ H-thymidine. Table 3 shows the IL-2 activity of strains carrying each plasmid.

[0029]

[0030]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 117 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: genomic DNA Origin organism name: Bacillus subtilis Sequence: AATTCCAAGT GTTAATATTC CTTAAAAAAC ATTTACTTCC ATGGAAAATG ATGATAGATT 60 AATTTTTAAG AAAAAGAACT GGTAATTCGC GAATTATGAA AAAGCGCTTT TTCTGCA 117 SEQ ID NO: 2 Sequence length: 18 Sequence type: Nucleic acid Number of strands: Both Topology: Linear Sequence type: Other nucleic acid (chemically synthesized DNA) Sequence: CGATA ATG TGT TAC TGC C 18 SEQ ID NO: 3 Sequence length: 5 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence: Lys His Leu Gln Cys SEQ ID NO: 4 Sequence length: 5 Sequence type: Amino acid Topology: Linear Sequence Type: Peptide Sequence: Thr Phe Met Cys Glu SEQ ID NO: 5 Sequence Length: 15 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Its Other nucleic acids (chemically synthesized DNA) Sequence: AAA CAT CTT CAG TGT SEQ ID NO: 6 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid ( Chemically Synthesized DNA) Sequence: ACA TTC ATG TGT GAA SEQ ID NO: 7 Sequence Length: 11 Sequence Type: Nucleic Acid Number of Strands: Double Strand Topology: Linear Sequence Type: Other Nucleic Acid (Chemically Synthetic DNA) Sequence: CGATA ATG GCA SEQ ID NO: 8 Sequence length: 14 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (chemically synthesized DNA) Sequence: CGATACCTCC TGCA SEQ ID NO: : 9 Sequence Length: 12 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Chemically Synthesized DNA) Sequence: GATCGATCTG CA SEQ ID NO: 10 Sequence Length: 604 Sequence Type: Nucleic Acid Number of Strands: Double Strand Topologyー: Type of linear sequence: cDNA to mRNA sequence: GGGGGGGGGG GGGGGGGATC ACTCTCTTTA ATCACTACTC ACAGTAACCT CAACTCCTGC 60 CACA ATG TAC AGG ATG CAA CTC CTG TCT TGC ATT GCA CTA AGT CTT GCA 109 CTT GTC ACA AAC AGT GCA ACT TCA ACA ACA GCA CCT AAG AAA ACA CAG 157 CTA CAA CTG GAG CAT TTA CTG CTG GAT TTA CAG ATG ATT TTG AAT GGA 205 ATT AAT AAT TAC AAG AAT CCC AAA CTC ACC AGG ATG CTC ACA TTT AAG 253 TTT TAC ATG CCC AAG AAG GCC ACA GAA CTG AAA CAT CTT CAG TGT CTA 301 GAA GAA GAA CTC AAA CCT CTG GAG GAA GTG CTA AAT TTA GCT CAA AGC 349 AAA AAC TTT CAC TTA AGA CCC AGG GAC TTA ATC AGC AAT ATC AAC GTA 397 ATA GTT CTG GAA CTA AAG GGA TCT GAA ACA ACA TTC ATG TGT GAA TAT 445 GCT GAT GAG ACA GCA ACC ATT GTA GAA TTT CTG AAC AGA TGG ATT ACC 493 TTT TGT CAA AGC ATC ATC TCA ACA CTG ACT TGA TAATTAAGTG CTTCCCCCCCT TCC CCCCACTT 546 AAAACATATC AGGCCTTCTA TTTATTTA TAAA Length: 28 Sequence type: Nucleic acid Number of strands: Duplex Topology: Linear Type: Other nucleic acid (partial sequence of plasmid) Sequence: CTGCAGGAGG TATCGATACC TCCTGCAG SEQ ID NO: 12 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other Nucleic acid (partial sequence of plasmid) Sequence: CTGCAGGAGG TATCGATA ATG TGT SEQ ID NO: 13 Sequence length: 12 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid (of plasmid Partial sequence) Sequence: CTGCAGATCG AT

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of a DNA fragment.

FIG. 2: Plasmids pBTM126 and pBTM12
8 shows a restriction enzyme map of 8.

FIG. 3 shows the plasmid pILOT135-8.

FIG. 4 shows the nucleotide sequence of cDNA encoding IL-2 inserted into plasmid pILOT135-8.

FIG. 5 shows a construction diagram of plasmid pBTM134.

FIG. 6 shows a construction diagram of plasmid pHIT-B101.

FIG. 7 shows a construction diagram of plasmid pILT-B101.

[Explanation of symbols]

5'indicates the 5'end. 3'indicates the 3'end. Ori indicates the origin of replication. Km ^r indicates a kanamycin resistance gene. Cm represents a promoter-deficient chloramphenicol resistance gene (chloramphenicol acetyl transferase gene). P indicates a promoter. SD indicates a ribosome binding site. Tc ^r represents a tetracycline resistance gene. Amp ^r represents the ampicillin resistance gene. trp-P represents the trp promoter. IFN-γ represents the human immune interferon gene. IL-2 represents the interleukin-2 gene.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location C12R 1: 125) (C12P 21/02 C12R 1: 125) C12R 1: 125)

Claims (1)

[Claims] 1. The formula 5'AATTCCAAGGTGTTAATATTCCTT.
AAAAAACATTTTACTTCCATGGAAAA
TGATGATAGATTAATTTTTTAAGAAA
AAGAACTGGTAATTCGCGAATTATG
Recombinant DN containing an SD sequence downstream of the base sequence represented by AAAAAGCGCTTTTTTCTGCA 3'or a part thereof having promoter activity, and a gene encoding a protein of interest downstream of the SD sequence
A method for producing a gene product, which comprises culturing a Bacillus bacterium transformed with A, and collecting a target protein from the culture.