JPH0690632A - Method for preparing dwarf petunia - Google Patents

Abstract

PURPOSE:To simply introduce a variety of petunia having dwarf properties by integrating chromosome of petunia cell with a DNA sequence encoding rolC gene product, etc., and redifferentiating a plant from the prepared transformant cell. CONSTITUTION:A DNA sequence encoding rolC gene product or cytokinin- glucoside-glucosidase is linked to the downstream of an adventitious promoter (preferably cauliflower mosaic virus 35S promoter). A sequence of the promoter is integrated into chromosome of petunia cell and a plant is redifferentiated from the plasma cell to prepare the objective plant.

Description

Detailed Description of the Invention

[Background of the Invention]

[0002]

BACKGROUND OF THE INVENTION The present invention relates to transformed petunia ( P
etunia hybrida ) plant cells and petunia plants obtained by redifferentiating the plant cells. More specifically, the present invention relates to a transformed petunia cell in which a plant cell chromosome is modified to express a rol C gene product and a petunia dwarf variety plant which is a redifferentiation product thereof.

[0003]

2. Description of the Related Art Giving dwarfing traits to plants is important for plant breeding. Introducing dwarf traits, such as those found in rice breeding, has resulted in increased lodging resistance, resulting in a stable increase in yield, and easier harvesting as seen in apples. It's getting worse. Especially in flowers, there are many advantages to dwarf varieties, such as improvement of cultivability such as pruning can be simplified, and flowers that have been used only for cut flowers with high plant height can be used as pot flowers. There is.

Therefore, also in breeding petunia, it is important for breeding to develop a technique capable of easily producing dwarf petunia in many varieties to produce dwarf petunia varieties. There are already petunia varieties with dwarf traits, but it was dependent on the combination of varieties to use them as parents to introduce and stabilize only dwarf traits in other varieties by conventional mating technology and cell fusion technology. There were many problems such as good compatibility with mating and fusion, and the introduction of unwanted traits other than dwarf traits. Furthermore, the dwarf trait is recessive, and in order to remove unwanted traits other than the dwarf trait, backcrossing must be performed for many generations, and it is difficult to impart only the dwarf trait. As described above, it has been extremely difficult to introduce dwarf traits into various petunia varieties using conventional crossing and cell fusion techniques to produce dwarf petunias.

On the other hand, dwarfing agents (for example, ancimidol)
It is known that the dwarfing of petunia can be achieved by the administration, but the dose varies depending on the timing of administration of the dwarfing agent, that the dwarfing agent must be administered periodically, and the variety. After all, there were many problems. With the recent development of plant genetic engineering, it is becoming possible to give various useful traits to plants using gene recombination techniques. The gene recombination technique has an advantage that various varieties can be given only desired traits regardless of crossing.

Agrobacterium rhizogenes is a soil bacterium known to cause hair root disease in plants, and a plant can be regenerated from hairy roots produced by infection with this bacterium. Regenerated plants show a series of morphological changes including dwarf called rol syndrome. Hairy roots are Ag
Ri plasmid T- present in robacterium rhizogenes
A region called DNA is transferred and expressed in the chromosome of plant cells, resulting in the transformation of cells. This T-DN
There is a gene group called the rol gene that expresses the rol syndrome in the A region. Then, when the only rol C gene is one of the rol genes were expressed in tobacco potato or belladonna plants in, it has been reported to cause even a series of morphological changes, including dwarfing (1,2,3
1). However, there was no case of introducing the rol C gene into petunia, and it was not known how this gene product causes changes in petunia plants. Recently, it was shown that the rol C gene product has a glucosidase activity that cleaves glucose from glycosylated cytokinins, and it has the function of converting inactive cytokinin contained in cells to active cytokinin. Was suggested (3). However, it is unknown about the amount of cytokinin or glycosylated cytokinin in petunia cells,
It is completely unimaginable what kind of morphological changes can be induced in petunia plants when the amount ratio is changed. That is, it is not known whether the rol C gene product can influence the morphogenesis of petunia plants,
Furthermore, when trying to induce morphological changes in petunia using the rol C gene, what kind of promoter should be used to express the desired morphological changes in which part of the plant and how much to induce the desired morphological changes? I couldn't. Furthermore, the expression of the rol C gene product is known to make the transformant male sterile in tobacco, and it was considered difficult to transfer the rol C gene to progeny.

[0007]

SUMMARY OF THE INVENTION It is an object of the present invention to develop a general-purpose technique for easily introducing a dwarf trait into many petunia cultivars regardless of the above-mentioned breeding and cell fusion techniques.

[0008]

[Means for Solving the Problems]

[Summary of the Invention] In the present invention, a DNA sequence substantially encoding a rol C gene product or a cytokinin-glucoside glucosidase is used as a chimeric gene in which the rol C gene originally has a promoter or is combined with various other promoters. Provided are a method for introducing a dwarf trait to petunia by introducing it into a plant chromosome and controlling the expression of its genetic information, and a dwarf petunia plant obtained by such a method.

That is, the dwarf petunia according to the present invention has a DNA sequence that substantially encodes a rol C gene product or a cytokinin-glucoside glucosidase, which is transcribed into RNA and the transcribed RNA can be translated. It is characterized by being integrated into the chromosome. In the present invention, a dwarf plant can be produced without using a dwarfing agent by expressing a rol C gene product or a cytokinin-glucoside glucosidase in a petunia plant and controlling the expression level thereof. Also, since it is possible to grow dwarf petunia varieties without relying on conventional breeding,
It is possible to solve the problems such as the above-mentioned backcrossing which depend on conventional breeding and the problems such as the difference between breeds. Further, it is known that pollen fertility is completely lost in a tobacco dwarfed by expressing the rol C gene product, which may result in a so-called male sterile plant.However, the dwarf petunia of the present invention is a male sterile plant. It was not fertile, and the next-generation plants could be obtained by selfing or by crossing. Moreover, some of these progeny plants showed dwarf traits. That is, the dwarf trait provided by the present invention is transmitted not only to the petunia plants of the transformed generation in which the DNA sequence encoding the rol C gene product or the cytokinin-glucoside glucosidase has been incorporated, but also to the next generation. Furthermore, since the dwarf trait provided by the present invention is dominant, it is possible to relatively easily introduce the dwarf trait into other cultivars by crossing, and the transformed petunia plant of the present invention is used as a mother of dwarf petunia breed breeding by a mating technique. It can also be used as a book.

[0010] DNA sequences rol C gene encoding the Detailed Description of the Invention] 1) rol C gene products, hair root disease pathogen Agrobacterium Rhiz plant
It is a gene that exists in a region called T-DNA of a giant plasmid called Ri plasmid that is held by ogenes . When Agrobacterium rhizogenes infects plants,
The T-DNA region is transferred into the chromosome of plant cells. There is a group of rol genes including the rol C gene on T-DNA, and expression of these genes in plant cells causes hairy root disease. Plants can be regenerated from hairy roots caused by hairy root disease, but the regenerated plants show a series of morphological changes including dwarf called rol syndrome. rol
Multiple ro including rol C gene in plants showing syndrome
Although the l gene is expressed, it is known that morphological changes such as dwarfing occur in tobacco, potato, and belladonna even when only the rol C gene is expressed (1, 2,
31).

Agrobacterium rhizogenes A4 strain (ATCC 430
The entire nucleotide sequence of the T-DNA region of the Ri plasmid derived from 57) has been determined (4), and among the multiple open reading frames found there, open reading frame 12 corresponds to the rol C gene. It is known to do (32). The amino acid sequence of the gene product consisting of 180 amino acids encoded by the A4 strain rol C gene is shown in SEQ ID NO: 1. There are various strains of Agrobacterium rhizogenes , each carrying a different Ri plasmid and thus a different rol C gene. For example, Ag from Japan
The robacterium rhizogenes C8 strain (MAFF 02-10268) is a pathogen that causes hairy root disease and rol syndrome in infected plants.The rol C gene isolated by the inventors from this strain encodes a gene product consisting of 177 amino acids. Then
The homology with the rol C gene derived from the A4 strain is 44 amino acids.
% And 75% in DNA.

In the present invention, any of these various rol C gene products existing in nature may be used. Furthermore, various amino acid substitutions, deletions, additions,
Even a mutant rol C gene product to which an insertion is added can be used in the present invention as long as it retains the biological activity of expressing a dwarf trait. In the present invention, the term “substantially” when referring to “a DNA sequence substantially encoding a rol C gene product” means not only a DNA sequence encoding a rol C gene product which exists in nature but also such a mutation. It is shown to also include the DNA sequence encoding the rol C gene product. It is known that the rol C gene product has cytokinin-glucoside glucosidase activity (3). And has the biological activity of expressing a dwarf trait
The rol C gene product is believed to be essentially a cytokinin-glucoside glucosidase.

Examples of the rol C gene product that can be used in the present invention include the rol C gene product derived from strain A4 shown in SEQ ID NO: 1, but are not limited to this polypeptide. Is as described above. In addition, in general, when encoding a polypeptide having a certain amino acid sequence, there are multiple genetic codes (codons) corresponding to one amino acid, so there are multiple DNA sequences corresponding to one amino acid sequence. Yes (degenerate isomer). It goes without saying that, in the DNA sequence encoding the rol C gene product used in the present invention, any genetic code can be used as long as the amino acid sequence of the polypeptide encoded by it does not change.

DN encoding such a rol C gene product
To get the A array, for example, r that exists in nature
The ol C gene can be isolated and its structural gene portion can be used. The rol C gene is, for example, the above-mentioned Agrobacter.
ium rhizogenes A4 strain can be isolated, but Ri other than A4 strain
It can also be isolated from a plasmid-carrying Agrobacterium rhizogenes , for example, Agrobacterium rhizogenes produced in Japan. The outline of the method for cloning the rol C gene from the A4 strain is described below, but other Agrobacterium u rhizogen
It will be apparent to those skilled in the art that cloning from es can be carried out accordingly.

As mentioned above, Agrobacterium rhizogenes
Since the base sequence of the rol C gene of A4 strain is known, rol C
Various methods as described below can be considered for obtaining the gene. First, Ri plasmid is isolated according to a conventional method (5) and digested with restriction enzymes HindIII and EcoRI to isolate a 1858 bp DNA fragment having a rol C gene containing a promoter. This DNA fragment is then used as a cloning vector for E. coli, pUC18, 19 (6) or pBR328.
(7) A plasmid is ligated with a vector DNA fragment digested with restriction enzymes HindIII and EcoRI using a DNA ligase,
Transform into E. coli and clone. Synthesized oligo DNA primers containing the nucleotide sequences at both ends of the rol C gene were used to generate Ri plasmid or Agrobacterium rho.
rol by PCR Total DNA from Izogenes A4 strain as a template
The C gene is amplified and the DNA fragment is cloned into a cloning vector (8). It is totally synthesized according to a known nucleotide sequence and cloned into a cloning vector (9). It is also possible to clone as a probe the nucleotide sequence of the rol C gene from the A4 strain, the rol C gene of the other strains.

Agrobacterium obtained by such a method
The nucleotide sequence of a 1858 bp DNA fragment containing the rol C gene derived from the rhizogenes A4 strain is shown in SEQ ID NO: 2. R in this DNA sequence
The portion encoding the ol C gene product is a 543 bp DNA sequence from base number 876 to base number 1418, and the polypeptide encoded by this DNA sequence has the amino acid sequence shown in SEQ ID NO: 1. This 543 bp DNA sequence is an example of a DNA sequence encoding the rol C gene product that can be used in the present invention, but the DNA sequence that can be used in the present invention is not limited to this. As described above. To 2) rol C expression of the gene product rol C gene product DNA sequence encoding is expressed in petunia plants which had been transformed, at least this
It is necessary that the DNA sequence be transcribed into RNA. It is known that when a foreign gene is integrated into the chromosome of a plant cell, it will be integrated into the transcribed region on the chromosome with a certain probability (33), so the DNA encoding the rol C structural gene is used.
It is also possible to integrate and express the sequences alone.
However, it is preferable to ligate appropriate promoter and terminator sequences in advance and then incorporate them.

For this purpose, a promoter / terminator originally possessed by the natural rol C gene may be used. In that case, the promoter / structural gene / terminator can be isolated from the rol C gene obtained from the natural world and used as it is or after being partially modified as necessary. The rol C gene DNA sequence containing such a promoter / terminator is, for example, SEQ ID NO: 2
The 1858 bp DNA fragment shown in can be mentioned.

In order to express a DNA sequence encoding the rol C gene, a chimeric gene may be constructed in which this DNA sequence is ligated downstream of various foreign promoter sequences and a terminator sequence is ligated downstream thereof. . In this case, as the promoter, any promoter that has been known to function in plant cells so far, specifically, a promoter of a gene encoding ribulose-1,5-2 phosphate carboxylase small subunit (1
7), the promoter of the nopaline synthase gene (1
8), a promoter (19) that produces cauliflower mosaic virus 19S-RNA, and the like can be used, but it is particularly preferable to use a promoter (20) that produces 35S-RNA of cauliflower mosaic virus. As the terminator, any terminator known so far to function in plant cells can be used. Specifically, a nopaline synthase gene terminator (21), an octopine synthase gene terminator (22), and the like can be used. 3) Transformation of petunia Agrobacterium tumefa was used as a vector for plant transformation.
A plasmid used for transformation via ciens (hereinafter abbreviated as Agrobacterium Vector), specifically pLGV
neo1103 (10), pBIN (11), pGA482 (12), pMO
N505 (13) etc. can be used. Also these
Direct DN to plant pieces without using Agrobacterium Vector
It is also possible to implant A (14) or to prepare plant protoplasts and directly introduce DNA into them for transformation (15, 16).

In order to introduce a gene into petunia cells, a transformation method using Agrobacterium (for example, leaf disk method (23)), a gene introduction method for protoplasts (for example, PEG method and electroporation method (2).
4, 25)), a method using a particle gun (26)
Etc. can be used. It is known that the introduced gene is expressed in plant cells, and some gene copies are integrated into the chromosome while maintaining the ability to express.

It is known that plant bodies can be redifferentiated from petunia protoplasts, leaf discs and the like, and petunia plants can be regenerated from transformed petunia tissues or petunia cells (23, 24). 4) Dwarf Petunia Plant According to the present invention, it is possible to produce dwarf petunia without using a dwarfing agent, and it is possible to give dwarf traits to various petunia varieties without relying on conventional breeding. it can.

Dwarfness refers to a trait in which the plant height is lower than the original plant height of the plant. The cause is often due to the reduction of internode length, but it is also rarely dwarfed due to the reduction of the number of nodes. For example, if the plant height of a variety B improved from a variety A is significantly lower, it can be said that the variety B is a dwarf variety. At this time, the degree of dwarfing may differ depending on the time of comparison of plant heights, and even if dwarfness is shown at the early stage of growth, it may be almost normal at the later stage. In the present invention, the term "dwarf petunia" includes those which show dwarf only in such an early stage of growth, but those which show stable dwarf throughout the entire growth period are more preferable.

According to the invention, in petunia plants
By adjusting the expression level and expression pattern of the rol C gene product or cytokinin-glucoside glucosidase, the degree of dwarfing of the resulting transformed petunia plant can be changed. For example, a transgenic petunia plant in which a rol C gene product is expressed using a promoter originally possessed by the rol C gene (hereinafter referred to as a native promoter) has a flowering period of 2-3 weeks earlier than that of a non-transformant plant. A significant dwarf trait was shown when one flower was planted, but there was almost no difference in plant height from the non-transformant in the late growth stage. In contrast, the flowering time was not observed to be early in the transgenic petunia plants in which the rol C gene product was expressed using the promoter that produces the 35S-RNA of cauliflower mosaic virus (hereinafter referred to as 35S promoter). However, remarkable dwarfing was always observed compared to the non-transformants until the late growth stage. In addition, 35
Comparing multiple transgenic petunia plants obtained by incorporating a chimera gene containing the S promoter and the rol C structural gene, there was a significant positive correlation between the degree of dwarfing and the expression level of the rol C gene. I was seen.

The native promoter has been reported to be specifically expressed in phloem tissues in plants (34), whereas the 35S promoter has no tissue-specific expression.
It is known to be strongly expressed in the whole plant (2
0). Therefore, the above findings indicate that in Petunia, it is preferable to use a tissue-nonspecific high expression type promoter, particularly preferably 35S promoter, in order to produce more prominent dwarf plants. In tobacco and potato, it is reported that both native and 35S promoters dwarf together.
This indicates that when a dwarf plant is to be produced by expressing the rol C gene, a suitable method differs depending on the target plant species. The inventors examined histologically the dwarf petunia obtained by the present invention, and found that in dwarfed petunia, the number of cells in the stem tissue was reduced and the size of individual cells was also reduced, These findings were previously unknown for tobacco and potatoes. Furthermore, in a tobacco dwarfed by expressing a rol C gene product using the 35S promoter, it is known that pollen fertility is completely lost and male sterility is achieved, but the dwarf petunia according to the present invention is Whether using the native or 35S promoter,
Although the fertility decreased, it did not become male sterile, and the next-generation plant could be obtained by self-fertilization or by-fertilization. Moreover, some of these progeny plants showed dwarf traits. That is, the dwarf trait provided by the present invention is transmitted not only to the petunia plant of the transformed generation in which the DNA sequence encoding the rol C gene product has been incorporated, but also to the next generation. Furthermore, since the dwarf trait provided by the present invention is dominant, it is possible to relatively easily introduce the dwarf trait into other cultivars by crossing, and the transformed petunia plant of the present invention is used as a mother of dwarf petunia breed breeding by a mating technique. It can also be used as a book. The inventors investigated pollen of dwarf petunia obtained according to the present invention and found that the above-mentioned decrease in fertility was due to a decrease in pollen germination rate and a decrease in pollen tube elongation. It was also found that the progeny seeds of dwarf petunia have a shallow diapause and germinate about one day earlier than normal seeds. These findings are also unknowns in the past regarding tobacco and potato.

In the following, an example in which the rol C gene product is expressed in the petunia variety "Mitchell" using the native promoter or the 35S promoter is shown as an example, but the present invention can be similarly applied to petunia varieties other than Mitchell. Needless to say.

[0025]

【Example】

Example 1 Method for Constructing rol C Gene for Plant Introduction In order to express the rol C gene product in a transgenic petunia plant using a native promoter, Agrobact was used.
185 from Ri plasmid of erium rhizogenes A4
8bp of HindIII / EcoRI DNA fragment (SEQ ID NO: 2) the rol C gene contained in vectors were constructed PBI-rol C to be introduced into a plant.

The above HindIII / EcoRI DNA fragment (SEQ ID NO:
As mentioned above, 2) can be obtained from Agrobacterium rhizogenes A4 (ATCC 43057), but the DN that we actually used
Fragment A is from the French National Institute of Agricultural Research (Institut National de
(Professor Tepfer of la Recherche Agronomique). The 1858 bp HindIII / EcoRI DNA fragment was tested in a state where it was cloned between the HindIII / EcoRI sites of E. coli cloning vector pBR328 (plasmid name: pBR328-rolC). The restriction enzyme / Escherichia coli-derived alkaline phosphatase used in the experiment was manufactured by Toyobo Co., Ltd., and its usage was according to the conditions in the instruction manual. Unless otherwise specified, 5 μg of DNA and 25 restriction enzymes should be used for digestion of DNA with restriction enzymes.
The unit was used for the reaction, and the reaction solution volume was adjusted so that the volume of the final restriction enzyme in the whole reaction solution was 1/10 or less of the total volume. A ligation kit manufactured by Takara Shuzo Co., Ltd. was used for connecting the DNA, and its usage was in accordance with the setting conditions in the instruction manual. Transformation into Escherichia coli HB101 was carried out by Takara Shuzo E.
coli HB101 Competent Cells were used, and the usage was in accordance with the instruction manual. The reagents used were those manufactured by Wako Pure Chemical Industries, unless otherwise specified. A GUS GENE FUSION SYSTEM kit manufactured by Clontech was used for gene transfer into plant cells, and its usage was according to the instruction manual included in the kit. Other experimental operations were performed according to the general experimental operation method described in Molecular Cloning (5), etc., unless otherwise specified.

The binary vector plasmid pBI121 (11) contained in the kit was modified and used to introduce the rol C gene into plant cells. The manufacturing method will be described below. After digesting pBI121 with HindIII for 2 hours, 1M in the reaction solution
After adding NaCl to a final concentration of 150 mM, EcoRI was added and digested for another 2 hours to perform double digestion (hereinafter,
Double digestion with the restriction enzymes HindIII and EcoRI and BclI and Ec
Double digestion with oRI was done similarly). After digestion, the enzyme was removed by phenol treatment and the DNA was recovered by ethanol precipitation. Recovered DNA from 200 μl of 50 mM Tris / HCl
The suspension was suspended in a solution (pH 8.0), 2 units of alkaline phosphatase derived from Escherichia coli was added, and the mixture was treated at 37 ° C for 2 hours for dephosphorylation (hereinafter abbreviated as alkaline phosphatase treatment). The dephosphorylated DNA was treated with phenol and then suspended in TE buffer.

On the other hand, pBR328-rolC was digested with restriction enzymes HindIII and EcoR.
1858bp HindIII / Eco containing rol C gene digested with I and subjected to agarose gel electrophoresis using low melting point agarose
The RI DNA fragment was separated from the pBR328 DNA fragment (hereinafter, the DNA fragment was isolated by agarose gel electrophoresis using the same low melting point agarose). Cut out a 1858 bp DNA fragment,
An equal volume of TE buffer was added and the mixture was heated at 65 ° C for 10 minutes. To this, an equal volume of saturated phenol solution was added, followed by phenol treatment and ethanol precipitation to recover DNA.

This DNA and the above-mentioned dephosphorylated pBI121
The fragments were mixed and the DNA fragments were ligated (ligated) with each other using a ligation kit. Escherichia coli (HB101) was transformed with these DNAs, and resistant clones were obtained in LB medium (5) containing kanamycin (50 μg / ml). The rol C gene introduced into plants that were cloned rol C gene in a binary vector in this manner (pBI-rolC) was produced (Figure 1).

Plasmid DNA was extracted from Escherichia coli having pBI-rolC by the alkaline lysis method and purified by cesium chloride density gradient ultracentrifugation to prepare pBI-rolC DNA (5). Prepared DNA was electroporated to Agrobacteri
um tumefaciens e LBA4404 was introduced. Agrobacterium was cultured in 5 ml of YEB medium (27) at 28 ° C. for 18 to 22 hours with shaking (90 rpm). The cells were collected by centrifugation at 5000 rpm for 10 minutes and suspended in 0.2 ml of 10% glycerol solution. PBI-rolC (500 ng) was added to this suspension (100 μl) and electroporation was performed at 2.5 kV using a 25 μF condenser in an electroporation cuvette (Bio-Rad 0.2 cm gap). went. The electroporated bacteria were suspended in 1 ml of YEB medium, heated at 28 ° C. for 1 hour, and spread on YEB medium containing kanamycin (50 μg / ml). The colonies obtained after culturing at 28 ° C. for 48 to 60 hours were used below as LBA4404 (pBI-rolC) for plant transformation. Example 2 Construction of 35S- rol C Gene for Plant Introduction In order to express the rol C gene product in transformed petunia plants using the 35S promoter, the 35S promoter sequence, the rol C structural gene, and the rol C gene were derived. A chimeric gene for plant introduction (hereinafter, referred to as 35S- rol C gene) was constructed, which comprises a terminator sequence.

As the 35S promoter sequence, the one in pBI121 was used and connected to the rol C structural gene. That is, pBR328-rolC was digested with a restriction enzyme HpaI that cuts 3 bp upstream of the coding region of the rol C gene product (after base number 872 of SEQ ID NO: 2), and treated with phenol and alkaline phosphatase. After phenol treatment, the DNA was recovered by ethanol precipitation and 10 μl TE was added.
Suspended in buffer. To this DNA solution, 500 ng of BclI linker (Toyobo) was added, ligated, and then introduced into Escherichia coli GM48 by a conventional method for transformation (5).
Modified rol C gene with linker (pBR328-rolC / BclI
linker). Use this plasmid DNA for the restriction enzyme BclI
99 containing the structural gene and terminator of rol C after double digestion with EcoRI and low melting point agarose gel electrophoresis.
A 4 bp DNA fragment (without promoter) was isolated.
On the other hand, pBI121 was digested with restriction enzymes BamHI and EcoRI, treated with phenol, and then treated with alkaline phosphatase. Recovered by phenol treatment and ethanol precipitation
The DNA and the above DNA fragment were mixed and ligated (FIG. 2). This DNA was transformed into Escherichia coli HB101 and spread on LB medium containing kanamycin (50 μg / ml) to obtain a resistant clone. In this way, the 35S- rol C gene for plant introduction (pBI35S-ro
lC) was prepared. pBI35S-rolC was introduced into Agrobacterium tumefaciens e LBA4404 in the same manner as in Example 1 to obtain LBA4404 (pBI35S-rolC) for plant transformation. Introduction of rol C and ³⁵S-rol C gene into the introduction petunia cells rol C and ³⁵S-rol C gene to Example 3 Petunia cells was performed according to the leaf disc method. That is, the leaves of the petunia variety "Mitchell" grown in a greenhouse are lightly washed with a neutral detergent diluted about 50 times, then immersed in a 2.5% sodium hypochlorite solution at room temperature for 15 to 20 minutes, and finally It was washed with sterile water and sterilized. A leaf disc with a diameter of 9 mm was punched out from this leaf using a cork borer for 16 to 22 hours.
Agrobacterium for transformation cultured in YEB medium (LBA4404 (pBI-rolC) or LBA4404 (pBI35 obtained in Examples 1 and 2)
S-rol C)) was immersed in the suspension for 30 seconds. Claforan (500 μg / ml) after removing excess bacterial suspension with filter paper
After culturing for 2 days at 26 ° C on Murashige-Skug's medium (manufactured by Hoechst) (28), the MS medium further contains 1 ppm of benzyladenine and 0.1 ppm of naphthalene acetic acid. It was cultured for 2 weeks on a selective medium in which Claforan (concentration as above) and kanamycin sulfate (100 μg / ml) were added to the foliage differentiation medium. After that, the same medium was replaced every two weeks to obtain kanamycin-resistant adventitious buds. These adventitious buds were transferred to an MS medium containing kanamycin (same concentration as above), rooted, and transformant candidates were selected. Furthermore, the plants that acquired kanamycin resistance were acclimated and grown in a greenhouse and subjected to the following experiment. Example 4 Confirmation of Transformant From the leaves of plants that acquired kanamycin resistance, the conventional method (1
5) was modified to extract DNA, and the introduced gene was confirmed by Southern blot analysis (29).

Approximately 5 g of leaves fully developed in a mortar were added to 10 ml of 15
% Sucrose, 0.1% β-mercaptoethanol, 50 mM E
It is ground in a buffer solution consisting of DTA, 250 mM NaCl, 50 mM Tris / HCl (pH 8.0), the ground solution is centrifuged at 3000 × g for 5 minutes, and the precipitate is 1.25 ml of 15% sucrose and 50 mM EDTA. , 50 mM
It was suspended in a buffer solution consisting of Tris / hydrochloric acid (pH 8.0). Add SDS to the suspension to a final concentration of 0.1% and
Heated for minutes. After cooling to room temperature, the mixture was mixed with 125 μl of 5M potassium acetate solution (pH 4.3), and the mixture was allowed to stand on ice for 1 hour. Collect the supernatant by centrifugation at 15000 x g for 15 minutes,
The DNA produced by adding 2.5 volumes of ethanol was wound around a glass capillary (Aqua cap disposable microdispenser, manufactured by Drummond) and collected. this
DNA was purified by cesium chloride density gradient ultracentrifugation.

Purified DNA was digested with restriction enzymes HindIII and EcoRI
Digested with 10 μg and separated by 1% agarose gel electrophoresis. Soak the gel in 0.4 N NaOH for 30 minutes at room temperature.
After denaturing the DNA, it was adsorbed on a nylon filter (Gene Screen; manufactured by DuPont) using the same NaOH by the Southern method. Hin of 1858bp including rol C gene was labeled with ³² P
Hybridization was performed using the dIII / EcoRI digested DNA fragment as a probe according to the standard protocol of DuPont. The result is shown in FIG.

All the transformed petunia plants were ro
It had about 5 to 30 copies of the l C gene or 35S- rol C gene. Example 5 Expression Analysis of Introduced rol C and 35S- rol C Genes Using transformant leaves as a material, total RNA was extracted according to a conventional method (5), and polyA-RNA was further prepared therefrom. Northern blot analysis (30) was performed using the obtained polyA-RNA, and expression analysis of the introduced rol C and 35S- rol C genes was performed.

Using a mortar, 5 g of plant leaves were ground under liquid nitrogen, and total RNA was extracted according to the guanidine thiocyanate method (5). The obtained RNA was added to TE containing 0.1% SDS.
Suspend in 400 μl of buffer and concentrate polyA-RNA using Oligotex-dT30 (Daiichi Pure Chemicals) (Oligotex-
Follow the instructions for use of dT30). PolyA-RNA was recovered by ethanol precipitation and the absorbance at 260 nm was measured to determine the RNA amount. 2 μg of polyA-RNA was denatured by glyoxal according to a conventional method, separated by 1.5% agarose gel electrophoresis, and Northern blotted in 25 mM sodium phosphate solution, and adsorbed on Gene Screen nylon filter (described above). . Filter 90
After heating at 3 ° C. for 3 hours, hybridization was carried out in the same manner as in Example 4. The signal intensity on the obtained autoradiogram (Fig. 4) was measured using a densitometer (Pharmacia L
KB Biotechnology, LKB 2222-020 UltroScan XL La
Ser Densitometer), and the relative intensity was calculated as the relative expression intensity. As a result, it was observed that the rol C gene mRNA could be detected in the transformed petunia in which the rol C and 35S- rol C genes were integrated, and that there was a difference in the expression level between clones (Table 1). .

[0036]

[Table 1] Dwarfing of transformed petunia and relative amount of rol C mRNA ───────────────────────── Petunia dwarf (%) Relative amount of mRNA (%) ───────────────────────── Non-transformant 100 ND (ND: not analyzed) pBI121 Transformant 85 ND 35S- rol C transformant clone 11-2 80 100 clone 12-2 62 730 clone 34-1 47 1390 clone 43-1 57 1154 rol C transformant clone 11-2 84 1005 clone 32-1 80 ND ───── ──────────────────── Dwarfness: Relative value at the plant height of the non-transformants in the later stage of growth as 100 mRNA amount: 35S- rol C 11-2 Relative value with respect to the value of 100. Example 6 Observation of morphological changes After culturing transformants and non-transformants acclimated at the same time, the morphology of the plant was observed, and its plant height, leaf major axis and Minor diameter, flower diameter It was measured is.

It was observed that in the petunia plants in which the rol C and 35S- rol C genes were integrated and expressed, the lateral bud elongation was vigorous as compared with the non-transformants, and the number of flowers was increased. These transformed plants showed dwarfism, but the degree of dwarfing was different. In other words, petunia in which the rol C gene was integrated and expressed (hereinafter abbreviated as rol C plant) grew slower and dwarfed in the early stage of growth than the non-transformed plant, but compared to the period when flowers bloomed. Then, it was observed that petunia in which the 35S- rol C gene was integrated and expressed (hereinafter abbreviated as 35S- rol C plant) showed remarkable dwarf, while it did not show remarkable dwarf (Table 1). Moreover, 35S-
The degree of dwarfing also increased in petunia in which the expression amount of the rol C gene was high, and there was a correlation between the expression level and the degree of dwarfing (Table 1).

Further, observation of the leaf rol C and ³⁵S-rol C plants, but significant waving state was observed in the rol C plants, in ³⁵S-rol C plants was observed (Fig. 5). This is due not only to the degree of dwarfness by combining an appropriate promoter with the rol C gene,
It also suggests that other morphology (eg leaf waviness) can be controlled. Note becomes slightly elongated in comparison leaves rol C and ³⁵S-rol C gene Tobacco plant incorporating the non-transformants in tobacco, undulating it has been reported that there is no (1), the expression of rol C It is shown that the response to is different depending on the plant.

Furthermore, changes were observed in the morphology of flowers. That is, it was observed that the flower diameter was reduced in the rol C and 35S- rol C plants, but the flower length was the same as that of the non-transformant (FIG. 6). It was also observed that the petals of the rol C plants were wavy. Although it was reported that the flower size was reduced in tobacco, petunia was only reduced in diameter. Example 7 Assay of Fertility of Transformant Each transformant was artificially self-pollinated, and the fresh weight of seeds per capsule was measured, which was used as an index of fertility as compared with the non-transformant. As a result, it was observed that the fertility of transformants in which the rol C and 35S- rol C genes were integrated was reduced. However, it did not result in male sterility as observed in tobacco (Table 2). This indicates that unlike the case of tobacco, this dominant dwarf trait is genetically transmitted to progeny in breeding dwarf petunia using the rol C gene. Furthermore, this dwarf trait can be easily introduced into many varieties by crossing, and has great utility value in breeding.

[0040]

[Table 2] Dwarfing of transformed petunia and seed production ───────────────────────────── Petunia dwarf (%) Seed production Amount (mg / capsule) ───────────────────────────── Non-transformant 100 43.1 pBI121 Transformant 85 35.8 35S- rol C transformant clone 11-2 80 14.6 clone 12-2 62 7.1 clone 13-1 58 16.1 clone 34-1 47 3.6 clone 41-3 102 40.9 clone 43-1 57 4.9 rol C transformant clone 11-2 84 5.7 Clone 13-1 72 20.7 Clone 33-1 81 32.7 ───────────────────────────── Dwarfness: Non-trait at the late growth stage Relative value when the plant height of the transformant is set to 100. Seed production: Several individuals per clone are self-pollinated, and the seed weight in the obtained seed capsules is measured for 20 or more capsules. , And the average value was obtained.

There was no correlation between the degree of dwarfing and the degree of decrease in fertility. Furthermore, it was confirmed that when these obtained seeds were sown, they germinated at the same germination rate as the seeds obtained from the non-transformants. Of the three independently obtained 35S- rol C plants, five self-fertilizing first-generation plants were arbitrarily selected and grown, and as a result, they showed dwarfism similar to or higher than that of the parental transformants (Table 3). ). In addition, it is considered that the selfed first-generation individuals that do not show dwarf in Table 3 are due to the isolation of the 35S- rol C gene. It was also confirmed that the dwarf trait is dominantly inherited.

[0042]

[Table 3] Dwarfness of the first generation of transformed petunia selfing Relative value when the average plant height of non-transformants is 100 [Reference] (1) T. Schmulling et al .; EMBO J. 7: 2621 (1988) (2) M. Fladung; Plant Breeding 104 : 295 (1990) (3) JJ Estruch et al .; EMBO J. 10: 2889 (1991) (4) JL .Slightom et al .; J. Biol. Chem. 261: 108 (1
986) (5) T. Maniatis et al .; "Molecular Cloning: A Labor
atory Manual ", Cold Spring Harbor Laboratories, Co
ld Spring Harbor, New York (1986) (6) C. Yanisch-Perron et al .; Gene 33: 103 (1985) (7) X. Soberon et al .; Gene 9: 287 (1980) (8) SJ Scharf et al .; Science 233: 1076 (1986) (9) R. Quaas et al .; Eur. J. Biochem. 173: 617 (198
8) (10) R. Hain et al .; Mol. Gen. Genet 199: 161 (198
5) (11) M. Bevan; Nucleic Acid Res. 12: 8711 (1984) (12) G. An et al .; EMBO J. 4: 277 (1985) (13) R. Horsch et al .; Proc. Natl. Acad. Sci. USA 8
3: 4428 (1986) (14) DE McCabe et al .; Bio / Technology 6: 923 (198
8) (15) J. Paszkowski et al .; EMBO J. 3: 2717 (1984) (16) K. Toriyama et al .; Bio / Technology 6: 1072 (198)
8) (17) R. Fluhr et al .; Proc. Natl. Acad. Sci. USA 8
3: 2358 (1986) (18) WHR Langridge et al .; Plant Cell Rep. 4: 355
(1985) (19) H. Guilley et al .; Cell 30: 763 (1982) (20) JT Odell et al .; Nature 313: 810 (1985) (21) A. Depicker et al .; J. Mol. Appl. Gen. 1: 561
(1982) (22) J. Gielen et al .; EMBO J. 3: 835 (1984) (23) RB Horsch et al .; Science 223: 496 (1985) (24) D. Tagu et al .; Protoplasma 146 : 101 (1988) (25) MW Saul et al .; Plant Molecular Biology Manu
al A1 p.1 (1988) (26) TM Ou-Lee et al .; Proc. Natl. Acad. Sci. USA
83: 6815 (1986) (27) G. Vervliet et al .; J. Gen. Virol. 26:33 (197
5) (28) T. Murashige and F. Skoog; Physiologia Plantar
ium 15: 473 (1962) (29) EM Southern; J. Mol. Biol. 98: 503 (1975) (30) JC Alwine et al .; Proc. Natl. Acad. Sci. USA
74: 5350 (1977) (31) Yuriko Kurioka et al .; Proceedings of the 12th Annual Meeting of the Plant Tissue Culture Society p.161 (1991) (32) A. Spena et al .; EMBO J. 6: 3891 (1987) ( 33) C. Koncz et al .; Proc. Natl. Acad. USA 86: 8467.
(1989) (34) S. Sugaya et al .; Plant Cell Physiol. 30: 649
(1989)

[0043]

INDUSTRIAL APPLICABILITY The present invention provides a method for producing a dwarf petunia plant using a gene manipulation technique. This makes it possible to produce dwarf petunia without using a dwarfing agent, and to impart dwarf traits to various petunia cultivars regardless of conventional cross breeding.

[0044]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 180 Sequence type: Amino acid Topology: Linear Sequence type: Protein Origin: Organism name: Agrobacterium rhizogens (Agrobact)
erium rhizogenes) Strain name: A4 sequence Met Ala Glu Asp Asp Leu Cys Ser Leu Phe Phe Lys Leu Lys Val Glu 1 5 10 15 Asp Val Thr Ser Ser Asp Glu Leu Ala Arg His Met Lys Asn Ala Ser 20 25 30 Asn Glu Arg Lys Pro Leu Ile Glu Pro Gly Glu Asn Gln Ser Met Asp 35 40 45 Ile Asp Glu Glu Gly Gly Ser Val Gly His Gly Leu Leu Tyr Leu Tyr 50 55 60 Val Asp Cys Pro Thr Met Met Leu Cys Phe Tyr Gly Gly Ser Leu Pro 65 70 75 80 Tyr Asn Trp Met Gln Gly Ala Leu Leu Thr Asn Leu Pro Pro Tyr Gln 85 90 95 His Asp Val Thr Leu Asp Glu Val Asn Arg Gly Leu Arg Gln Ala Ser 100 105 110 Gly Phe Phe Gly Tyr Ala Asp Pro Met Arg Ser Ala Tyr Phe Ala Ala 115 120 125 Phe Ser Phe Pro Gly Arg Val Ile Lys Leu Asn Glu Gln Met Glu Leu 130 135 140 Thr Ser Thr Lys Gly Lys Cys Leu Thr Phe Asp Leu Tyr Ala Ser Thr 145 150 155 160 Gln Leu Arg Phe Glu Pro Gly Glu Leu Val Arg His Gly Glu Cys Lys 165 170 175 Phe Ala Ile Gly 180

SEQ ID NO: 2 Sequence length: 1858 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid (plasmid DNA) Origin: Biological name: Agrobacterium Resilience (Agrobact
erium rhizogenes) Strain name: A4 Sequence feature: Characteristic symbol: CDS Location: 876..1418 Method of determining position: P sequence AGCTTAAAGT TGGCCCGCTAACGTGAAGATTAGTGTAGAGATTAGTGTAGAGATTAGTGAAGATTGGTGAAGATTG 60 CTGCATTCAA GATACTTTTT CTATTGTAGTATATATCAGTTAGTATATGTAGTATATATGTAGTATATATTAAGTTAGTATAGCTAG ATCTATGCCA AAATGATGTA 180 TTAATAATAG CAATAATAAT ATGTGTTAAT CTTTTTCAAT CGGGAATACG TTTAAGCGAT 240 TATCGTGTTG AATAAATTAT TCCAAAAGGA AATACATGGT TTTGGAGAAC CTGCTATAGA 300 TATATGCCAA ATTTACACTA GTTTAGTGGG TGCAAAACTA TTATCTCTGT TTCTGAGTTT 360 AATAAAAAAT AAATAAGCAG GGCGAATAGC AGTTAGCCTA AGAAGGAATG GTGGCCATGT 420 ACGTGCTTTT AAGAGACCCT ATAATAAATT GCCAGCTGTG TTGCTTTGGT GCCGACAGGC 480 CTAACGTGGG GTTTAGCTTG ACAAAGTAGC GCCTTTCCGC AGCATAAATA AAGGTAGGCG 540 GGTGCGTCCC ATTATTAAAG GAAAAAGCAA AAGCTGAGAT TCCATAGACC ACAAACCACC 600 ATTATTGGAG GACAGAACCT ATTCCCTCAC GTGGGTCGCT AGCTTTAAAC CTAATAAGTA 660 AAAACAATTA AAAGCAGGCA GGTGTCCCTT CTATATTCGC ACAACGAGGC GACGTGGAGC 720 ATCGACAGCC GCATCC ATTA ATTAATAAAT TTGTGGACCT ATACCTAACT CAAATATTTT 780 TATTATTTGC TCCAATACGC TAAGAGCTCT GGATTATAAA TAGTTTGGAT GCTTCGAGTT 840 ATGGGTACAA GCAACCTGTT TCCTACTTTG TTAACATGGC TGAAGACGAC CTGTGTTCTC 900 TCTTTTTCAA GCTCAAAGTG GAGGATGTGA CAAGCAGCGA TGAGCTAGCT AGACACATGA 960 AGAACGCCTC AAATGAGCGT AAACCCTTGA TCGAGCCGGG TGAGAATCAA TCGATGGATA 1020 TTGACGAAGA AGGAGGGTCG GTGGGCCACG GGCTGCTGTA CCTCTACGTC GACTGCCCGA 1080 CGATGATGCT CTGCTTCTAT GGAGGGTCCT TGCCTTACAA TTGGATGCAA GGCGCACTCC 1140 TCACCAACCT TCCCCCGTAC CAGCATGATG TGACTCTCGA TGAGGTCAAT AGAGGGCTCA 1200 GGCAAGCATC AGGTTTTTTC GGTTACGCGG ATCCTATGCG GAGCGCCTAC TTCGCTGCAT 1260 TTTCTTTCCC TGGGCGTGTC ATCAAGCTGA ATGAGCAGAT GGAGCTAACT TCGACAAAGG 1320 GAAAGTGTCT GACATTCGAC CTCTATGCCA GCACCCAGCT TAGGTTCGAA CCTGGTGAGT 1380 TGGTGAGGCA TGGCGAGTGC AAGTTTGCAA TCGGCTAATG GTTAGTCGAT GGGCTGACGA 1440 GTTTGATGTC AGGAGAAGCT GAGTGTGTCA CTTGTTTCCC TTTAAGAAGT ATTAATGTAA 1500 TAAAAATCAA GATCTGGTTT AATAACTGGA TACTTGATTT CATCGCGCTT TTTTTGAATA 1560 AATGTTTGTT GTCTTGACTT TAAGA TATCC TTTGAAATTT GCGTTATTCG TATTTCGCTT 1620 TTGGTTATTT CCAAAAGACT TTGCTCAGTA AGATCAAACG TTTGTATTTC TCCGGGCCAC 1680 AATATTTGAC CTATATGCAC TGGCCCACGC GCCGCAATAG ATGAAAATTG CCAAAATTAG 1740 CTATCGGTCT TCTGAAAAGA AGGGCCGACA TGTTTTCATA GACCATGCAA AGTCATACTA 1800 CCTGAAACTG ATAAATAACG ACAAAGAAAG TAGCCTATTT AAAAGTCGCT ATAGCATG 1858

[Brief description of drawings]

FIG. 1 is a diagram illustrating a method for constructing an expression vector pBI-rolC.

FIG. 2 is a diagram illustrating a method for constructing an expression vector pBI35S-rolC.

FIG. 3 shows the results of Southern blot analysis of transformed petunia plants. In lanes 1 to 3, gene copy number markers corresponding to 5, 10, and 50 copies per petunia haploid genome, lanes N, T1, and T, respectively.
2 are non-transformants, 35S- rol C transformants 11-2,
DNA extracted from 35S- rol C transformant 12-2 is placed .

FIG. 4 shows the results of Northern blot analysis of transformed petunia plants. In Lane C, mRNA extracted from the non-transformant, and in Lanes 1 to 3, three different 35S-
mRNA extracted from the rol C transformant and mRNAs extracted from three different rol C transformants are shown in lanes 4 to 6, respectively. No band hybridizing with the probe was detected from the rol C plant 32-1 mRNA in lane 5.

[Fig. 5] From left to right, non-transformants, 35S- rol C plants 12-
FIG. 2 is a diagram showing leaf morphology of rol C plant 11-2 .

[Fig. 6] From the left, non-transformants and 35S- rol C plants 12-
FIG. 2 is a view showing the flower morphology of rol C plant 11-2 . 3 and 4 are electrophoretic diagrams, and FIGS. 5 and 6 are photographs showing the morphology of living things.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] October 15, 1993

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be corrected] Brief description of the drawing

[Correction method] Change

[Correction content]

[Brief description of drawings]

FIG. 1 is a diagram illustrating a method for constructing an expression vector pBI-rolC.

FIG. 2 is a diagram illustrating a method for constructing an expression vector pBI35S-rolC.

FIG. 3 is a photograph of electrophoresis showing the results of Southern blot analysis of transformed petunia plants. Lanes 1-3
5 per petunia haploid genome,
Gene copy number markers corresponding to 10, 50 copy, lane N, T1, T2, respectively the non-transformant, ³⁵S-rol C transformants 11-2,35S- rol C DN extracted from the transformant 12-2
A is put on.

FIG. 4 is a photograph of electrophoresis showing the results of Northern blot analysis of transformed petunia plants. Extraction Lane C mRNA extracted from non-transformed, mRNA extracted from three ³⁵S-rol C transformant different Lane 1-3, the three different in lanes 4-6 from rol C transformants did
Each has an mRNA. Lane 5 rol C plant 32-1 m
No band hybridizing with the probe was detected in RNA.

FIG. 5: From left to right, non-transformants, 35S- rol C plant 12
2 is a photograph showing the leaf morphology of rol C plant 11-2.

FIG. 6 From the left, non-transformants, 35S- rol C plant 12
-2, is a photograph showing the morphology of the rol C plant 11-2.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Office reference number FI technical display location C12N 15/83

Claims (4)

[Claims] 1. A dwarf characterized in that a DNA sequence substantially encoding a rol C gene product or a cytokinin-glucoside glucosidase is integrated into the chromosome of a petunia cell, and a plant body is redifferentiated from the obtained transformed cell. How to make petunia plants. 2. A DNA sequence that substantially integrates into the chromosome of petunia cells and that encodes a rol C gene product or cytokinin-glucoside glucosidase is linked downstream of the cauliflower mosaic virus 35S promoter. The method for producing a dwarf petunia plant according to claim 1. 3. A dwarf petunia plant characterized in that a DNA sequence substantially encoding a rol C gene product or a cytokinin-glucoside glucosidase is integrated and expressed in the chromosome. 4. A DNA sequence encoding a rol C gene product or a cytokinin-glucoside glucosidase that is integrated and expressed in the chromosome and is linked to the downstream of the cauliflower mosaic virus 35S promoter. The dwarf petunia plant according to claim 3.