JPH0686675A - Murine dehydropeptidase-i - Google Patents

Abstract

PURPOSE:To obtain a new dehydropeptidase useful for screening, etc., of a carbapenem in chemotherapy. CONSTITUTION:The objective murine dehydropeptidase-I has an amino acid sequence of the formula. This dehydropeptidase is obtained by culturing a transformant transformed with an expression vector containing a DNA capable of coding this murine dehydropeptidase in a culture medium and then collecting the murine dehydropeptidase from the resultant culture.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION The present invention relates to mouse dehydropeptidase-I (hereinafter referred to as mouse D by DNA recombination technology).
Referred to as HP-I). For more details,
The present invention provides a DNA encoding mouse DHP-I, said D
An NA-bearing expression vector, a transformant transformed with the expression vector, and a method for producing DHP-I, which comprises culturing the transformant, and a genetically modified DHP-produced in this manner. I.

[0002]

2. Description of the Related Art DHP-I has been isolated and extracted mainly from human and porcine kidneys, and its physiological action has been elucidated. H. Adachi et al. [J. Bio
Chem., 105, 957-961 (1989)], extracted and purified DHP-I from human kidney and clarified its N-terminal amino acid sequence, and it plays an important role in the metabolism of glutathione and leukotrienes. I showed that. Furthermore, Adachi et al. [J. Biol. Chem. 265
(1990), 3992-3995], isolated a cDNA clone encoding DHP-I from a human kidney and placenta cDNA library, cloned it, determined the nucleotide sequence, and deduced the entire amino acid sequence.

As described above, it is known that DHP-I is a physiologically active substance involved in the metabolic system of the living body and at the same time a substance which specifically acts on a carbapenem antibiotic. Therefore, DHP-I is considered to be useful as a reagent used for the in vivo stability test of carbapenem antibiotics in addition to its original use based on physiological activity. This kind of antibiotic screening reagent is necessary because, in order to develop new and useful antibiotics, it is essential to search for a substance having the best properties regarding activity and stability from a large number of candidate substances. , Is extremely important in the technical field of medicine.

[0004]

[Problems to be Solved by the Invention] In order to promote further research and development of physiological actions of DHP-I and to put it into practical use as a screening reagent for carbapenem antibiotics, a sufficient amount of DHP-I must be supplied. I won't. However, in the conventional method of extracting and purifying from the kidney, DH in an amount and purity sufficient to achieve the above-mentioned object is used.
It is impossible to get PI.

[0005]

In view of the above situation, the present inventors have made use of gene recombination technology to obtain highly pure mouse DH.
Repeated research for the purpose of producing a sufficient amount of PI
The cloning of the cDNA encoding mouse kidney DHP-I was successful. That is, the present inventors reverse-transcribe DHP-I mRNA obtained from mouse kidney to obtain cDNA,
It was cloned, then the DNA encoding DHP-I was inserted into an appropriate expression vector, and the resulting DH
Host cells were transformed with the PI expression vector, and active DHP-I was recovered from the culture of the transformants.

Therefore, the present invention also includes providing an expression vector containing the above DNA. Furthermore, the present invention provides a transformant carrying the above-mentioned expression vector, and culturing the transformant, and culturing mouse DHP from the culture.
It also provides a method for producing mouse DHP-I, which comprises isolating -I. Thus, the present invention provides DHP-I produced by the above method.

[0007]

The cloning of the DNA encoding mouse DHP-I may be carried out according to a conventional method in the art. still,
In the present specification, DHP-I is represented by SEQ ID NO: 1 in the sequence listing.
(Polypeptides represented by amino acid sequences 1 to 394), and polypeptides having the enzymatic activity of DHP-I having different types and degrees of glycosylation, and their ends different from DHP-I ( N-terminal and / or C-terminal) amino acid sequence, DH
A polypeptide having an enzyme activity of PI is included.

When a polypeptide is produced by a gene recombination technique, different types and degrees of glycosylation of the desired polypeptide can be obtained depending on the type of host cell, and in the so-called secretory production method of polypeptide, The terminal (N-terminal and / or C-terminal) amino acid sequence of the precursor polypeptide expressed in the host cell is the signal
It is well known to those skilled in the art that polypeptides having various terminal amino acid sequences can be obtained by processing with peptidase or the like. Therefore, it is easily understood by those skilled in the art that such a polypeptide is also included in the scope of DHP-I of the present invention.

The following examples show only construction examples of vectors that function in mammalian cells as expression vectors. However, as a result of disclosing the DNA encoding mouse DHP-I in the present invention, based on these, it was introduced into fungi such as yeast and prokaryotic host cells,
It is easy for those skilled in the art to construct an expression vector capable of expressing and producing DHP-I in the host. Therefore, the present invention also includes an expression vector constructed based on the DNA sequence of the present invention by a method known in the art.

Microbial cells that can be used to express the DNA encoding DHP-I of the present invention include, for example, prokaryotic bacteria [ Escherichia coli and Bacillus subtilis ( B
acillus subtilis )] and eukaryotic yeast [eg Saccaromyces cerevisiae ]. Also,
Mammalian cells include cultured human cells and cultured animal cells (eg, CHO cells, L929 cells, etc.). Furthermore, cultured plant cells can also be used.

A preferred example of the microorganism is a bacterium belonging to the genus Escherichia (for example, E. coli HB101ATCC).
33694, E. coli HB101-16FERM BP
-1872, E. coli MM294 ATCC 3362
5, E. coli DH1 ATCC 33849) and baker's yeast (eg S. cerevisiae AH22 ATCC3)
8626).

Preferred examples of mammalian cells include mouse L929 cells ATCC CCL1 and Chinese
There are hamster oliver (CHO) cells and the like. Normal,
When a procaryotic bacterium, particularly Escherichia coli, is used as a host cell, the expression vector is at least a promoter, a start codon, and DN encoding the amino acid sequence of DHP-I.
A, a stop codon and a self-replicating unit (unit).

When a eukaryote, that is, a yeast or a mammalian cell is used as a host cell, the expression vector contains at least a promoter, a start codon, a signal peptide, and DHP-.
It is preferably composed of a DNA encoding the amino acid sequence of I and a stop codon. In addition, enhancer sequences, 5'- and 3'-noncoding regions of DHP-I, polyadenylation sites and self-replicating units can be inserted. The self-replicating unit preferably contains a selectable marker for transformants (for example, ampicillin resistance).

In the case of a bacterial host expression vector, the term promoter refers to the promoter, operator and Shine-Dalgarno (SD) sequences (eg AAG).
G etc.) means a promoter / operator region. Examples of such a promoter include a conventional promoter / operator region (eg, lactose operon, PL-promoter, trp-promoter, etc.).
Is mentioned. An example of a promoter used in an expression vector using yeast as a host is the pho 5 promoter.

Examples of promoters used for expression vectors in mammalian cells include HTLV-LTR promoter, SV40 early and late promoters, mouse metallothionein I (MMT) -promoter and the like. An example of a preferred initiation codon is methionine codon (ATG). Examples of the DNA encoding the signal peptide include DNA encoding the signal peptides of pho 5 and DHP-I.

D encoding the amino acid sequence of DHP-I
NA is, for example, partially or totally synthesized using a DNA synthesizer, or is a natural DHP-I cDNA or genomic DNA inserted into a vector obtained from the transformants produced in the following Examples. Can be prepared by conventional treatment (for example, digestion with restriction enzymes, dephosphorylation with bacterial alkaline phosphatase, phosphorylation with T4 polynucleotide kinase, ligation with T4 DNA ligase).
Examples of stop codons include commonly used stop codons (eg, TAG, TGA, etc.).

The self-replicating unit is a DNA sequence capable of self-replicating the total DNA of the expression vector containing it in a host cell, and is a natural plasmid or an artificially modified plasmid (for example, from a natural plasmid). Prepared DNA fragments) and synthetic plasmids.

A preferred example of such a plasmid is, for example, when plasmid E. coli is used as a host cell.
BR322 or an artificially modified product thereof (a DNA fragment obtained by treating pBR322 with an appropriate restriction enzyme), and when yeast is used as a host cell, for example,
Examples include pJDB219, pJDB207, and pMM102. Furthermore, examples of plasmids for animal cells include plasmid pMM324 and plasmid pSV2dhfr A.
TCC37145, plasmid pdBPV-MMTneo A
TCC37224, plasmid pSVneo ATCC37
149 etc. are mentioned.

As the enhancer sequence, for example, SV4
0 enhancer sequences. Examples of the polyadenylation site include the polyadenylation site of SV40. The expression vector of the present invention using an animal cell, in particular a mammalian cell as a host, has an enhancer sequence, a promoter region, a 5'-noncoding region, a start codon, a signal peptide and a DHP-encoding amino acid sequence.
The NA, the stop codon, the 3'-noncoding region, and the polyadenylation site may be prepared by continuously and circularly linking an appropriate plasmid from upstream to downstream by the conventional method described above.

When bacteria are used as a host,
Promoter, start codon, D encoding DHP-I
NA, a stop codon and a terminator region are usually serially linked from an upstream to a downstream together with an appropriate self-replicating unit, optionally using an appropriate DNA fragment (for example, a linker having a restriction enzyme recognition sequence), A desired expression vector can be constructed by ligating in a circular manner according to a method (for example, digestion with a restriction enzyme, phosphorylation using T4 polynucleotide kinase, ligation using T4 DNA ligase). Next, the expression vector of the present invention is introduced into the selected host cell. Conventional methods known to those skilled in the art (for example, in the case of animal cells, calcium phosphate method,
A transformant can be obtained by introducing it by the electroporation method or the like).

Several plasmids, various restriction enzymes, T4 DNA ligase, and other enzymes used in the practice of the present invention were obtained from commercial sources and used according to the supplier's instructions. In addition, cloning of DNA, construction of each plasmid, transfection of host, culturing of transformant and recovery of enzyme from the culture are carried out by methods known to those skilled in the art or methods described in literature [Molecular Cloning, T. et al. Ma
niatis et. al, CSH Laboratory (1983) DN
A Cloning, DM. Glover, IRL PRESS (1
985) Others].

[0022]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but the following examples do not limit the present invention, and all modifications and changes are possible within the scope not departing from the gist of the preceding and the following. It is included in the technical scope of the invention.

Example 1 Cloning of mouse DHP-I cDNA (1) Preparation of mouse kidney total RNA Immediately after slaughter, it was excised and immediately stored in liquid nitrogen (10 g).
50 ml of guanidine thiocyanate solution (5M guanidine thiocyanate, 50 mM Tris-HCl (pH
7.5), 25 mM EDTA and 8% 2-mercaptoethanol) were added and the mixture was homogenized for 2 minutes under ice cooling. After adding 15 ml of ethanol cooled to -20 ° C to the above solution and mixing them well, immediately centrifuge at 10,000 g at 4 ° C and remove the supernatant by aspiration.

The precipitate was suspended in 25 ml of a guanidine thiocyanate solution and homogenized for 30 seconds under ice cooling. The suspension was immediately centrifuged at 7,000g for 4 minutes at 4 ℃, and the supernatant was collected and cooled to 0.63ml of 1M acetic acid and -20 ℃.
When ml of ethanol was added, a precipitate was generated, which was thoroughly mixed and then cooled at -20 ° C for 3 hours. Suspension at -10 ° C
Centrifuge at 4,000 g for 10 minutes, remove the supernatant by aspiration, suspend the precipitate in 25 ml of guanidine hydrochloric acid solution (6M guanidine hydrochloric acid, 25 mM EDTA, 10 mM 2-mercaptoethanol), and add 0.63 ml of 1 M acetic acid. And 12.5 ml ethanol cooled to -20 ° C were added and mixed well, and then cooled at -20 ° C for 12 hours.

The suspension was centrifuged at 4,000 g for 10 minutes at -10 ° C. and the supernatant was aspirated off. As in the previous time, suspend the precipitate in 25 ml of guanidine hydrochloric acid solution, add 0.63 ml of 1M acetic acid and 12.5 ml of ethanol cooled to -20 ° C, mix well, and then cool at -20 ° C for 3 hours. And the suspension at -10 ° C
The mixture was centrifuged at 4,000 g for 10 minutes, and the supernatant was aspirated and removed. The precipitate was suspended again in 12.5 ml of guanidine hydrochloric acid solution, 0.31 ml of 1M acetic acid and 6.25 ml of ethanol cooled to -20 ° C were added and mixed well, and then cooled to -20 ° C for 17 hours,
The suspension was centrifuged at 4,000 g for 10 minutes at 0 ° C. and the supernatant was aspirated and removed. The precipitate was dissolved in 4 ml of distilled water, added with 4 ml of ethanol, and stored at -20 ° C (recovered total RNA: 4.8 m
g).

(2) Preparation of mouse kidney mRNA To 1.5 ml (0.9 mg) of the total RNA solution obtained above, 31 μl of 5M was added.
Add sodium chloride solution and 1.13 ml of ethanol and mix well, then cool at -70 ° C for 1 hour and 24,000 g at 4 ° C.
After centrifuging for 5 minutes, the supernatant was removed by suction. The precipitate was washed with 1.5 ml of washing buffer (10 mM Tris-HCl (pH 7.
5), 1 mM EDTA, 0.5 M sodium chloride).

0.2 ml oligo (dT) in 1 ml Terumo syringe
Fill with Cellulose Type 7 (Pharmacia), 5
Double volume of distilled water, 5 volumes of 0.1N sodium hydroxide aqueous solution,
The column was washed by adding 10 volumes of distilled water and 10 volumes of wash buffer in this order. The oligo (dT) column thus prepared was loaded with the total RNA solution which had been heated at 65 ° C. for 5 minutes and then cooled to room temperature, and the void fraction was heated and cooled again and loaded on the column. Then, the column was washed with 2 ml of washing buffer, and then poly with 1 ml of elution buffer (10 mM Tris-HCl (pH 7.5) -1 mM EDTA) cooled to 0 ° C.
(A) RNA fraction was collected.

8 μl was added to the recovered poly (A) RNA fraction (0.2 ml)
l 5M aqueous sodium chloride solution and 0.5 ml ethanol were added and mixed well, and then cooled at -70 ° C for 1 hour. The mixture was centrifuged at 24,000 g for 3 minutes, the supernatant was removed, the precipitate was washed with ethanol, and then dried under reduced pressure. This RNA
30 μl of TE (10 mM Tris-HCl, 0.1 mM EDTA; pH 7.
5) Dissolved in the solution (recovered poly (A) RNA: 68 μg). this
30 μl of ethanol was added to the mRNA solution and stored at −80 ° C. (68 μl / 60 ul).

(3) Isolation and purification of mouse kidney DHP-I To 44 g of mouse kidney tissue, 200 ml of 10 mM Tris-HCl (pH 9.
0), 50 mM sodium chloride, 0.01 mM zinc chloride, and homogenized with Biotron under ice cooling.
0 ml of 10% Triton X-100 solution was added, and the mixture was stirred overnight at room temperature to extract DHP-I. This solution was 186,0 at 4 ℃.
After centrifugation at 00 g for 1 hour, the insoluble fraction-free supernatant was dialyzed 3 times against 4 l of 10 mM Tris-HCl (pH 9.0).

After dialysis, the solution (470 ml; containing 80.8 U) was added to 10 m
After applying it to a 200 ml DEAE Toyopearl 650M (manufactured by Toso Corporation) column equilibrated with M Tris-HCl (pH 9.0), wash the column with 10 mM Tris-HCl (pH 9.0), and then 0.3 M sodium chloride , 10 mM Tris-HCl (pH 9.0) with DHP-I
Was eluted. The obtained active fraction (50 ml; containing 36.1 U) was fractionated by ammonium sulfate precipitation, and the precipitate obtained with 30-75% ammonium sulfate was mixed with 5 ml of 0.05% Triton X-100,14.
After dissolved in 0 mM sodium chloride and 10 mM phosphate buffer (pH 7.0), the solution was applied to a 310 ml Sephacryl S-300 column and eluted with the same solution to obtain 25 ml of an active fraction (containing 34.3 U).

20.7 U of the active fraction thus obtained was
After applying to 1.2 ml of Cilastatin Sepharose 4B column equilibrated with 50 mM Tris-HCl (pH 7.4) -0.5 M sodium chloride, the column was washed with 25 ml of washing buffer, and then 5 ml of 10 mg / ml cilastatin was added. Contains 50 mM Tris-HCl (pH
7.4) -DHP-I was eluted by washing with 0.5 M aqueous sodium chloride solution. The eluted fraction was dialyzed against 5 l of 50 mM Tris-hydrochloric acid (pH 8.0) overnight. 5 similar dialysis
Repeated times to obtain a single purified DHP-I (150
μg / 5ml).

(4) Determination of Mouse DHP-I Amino Acid Partial Sequence Using approximately 30 μg of purified mouse DHP-I, the N-terminal amino acid sequence was determined by Applied Biosystems 470A gas phase sequencer. The determined N-terminal sequence is shown below. Asp-Ser-Phe-Arg-Asp-Gln-Ala-Val-Ala-Ile-Met-Arg- (X) -Asp-Pro-Val-

Purified mouse DHP-I solution (50 μg)
Was solidified by vacuum drying, then 200 μl of 8M urea, 200 μl
0.1 M Tris-hydrochloric acid (pH 9.0) and 2 μl of 2-mercaptoethanol were added and dissolved, 0.8 μg of lysyl endopeptidase was added, and the mixture was reacted at 37 ° C. for 16 hours. HPL using the Cosmo Seal 5C4-300 column (Nacalai Tesque) as the reaction solution
By subjecting to C (high performance liquid chromatography), 6 single peaks separated by a linear gradient of acetonitrile 0% -70% were collected. 4 of these peptide fragments
The amino acid sequence of each type was determined in the same manner as in the example shown above. DHP21: Ala-Ala-Gly-Phe-Val-Gly-Gly-Gln-Phe- (X) -Thr- (peak1) DHP22: Asp-Ala-Leu-Gln-Ile-Ser-Arg-Ala-Ala-Pro -Val-Ile- (peak2) DHP23: Arg-Leu-Leu-Asn-Asn-Met-Asn-Arg-Leu-Gly-Val-Met- (peak3) Ile-Asp-Leu- (X) -His-Val -Val- DHP25: Asp-Ser-Phe-Arg-Asp-Gln-Ala-Val-Ala-Ile-Met-Arg- (peak5) Thr-Asp-Pro-Val-Ile-Asp-Gly-His- (X ) Indicates that the analyzed sequence is not clear.

(5) Amplification and cloning of mouse DHP-I cDNA fragment by PCR method A) Synthesis of primer DNA Based on the partial amino acid sequence obtained above, two kinds of oligodeoxynucleotides (oligomer 5
8; Oligomer 29) was synthesized using an automatic nucleic acid synthesizer (Model 381A, Applied Biosystems). AspSerPheArgAspGlnAlaValAlaIleMetArgThrAspProValIleAspGlyHis ・ ・ ・ ・ ・ ・ ・ GACTCGCCTCGGGACCAGGCGGTGGCGATTATGAGGACGGATCCTGTCATYGAYGGNCTGGC29G

B) Reverse transcription-PCR reaction 1 μg of total RNA solution was dried to dryness under reduced pressure, dissolved in 12.5 μl of distilled water, heated at 95 ° C. for 3 minutes, and then rapidly cooled on ice. To this total RNA solution, add 4 μl of 5x PCR buffer, 1 μl of 20 mM d
NTP, 2 μl of 0.009 OD / μl random hexamer (manufactured by BRL), and 1 μl of 200 U / μl of reverse transcriptase were added and reacted at room temperature for 10 minutes and then at 42 ° C. for 1 hour. Replace the reaction mixture with 9
After heating at 5 ° C for 5 minutes, the mixture was rapidly cooled in an ice bath. 16μ in the reaction solution
l l of 5x PCR buffer and 50
Add 100 pmol each and 0.5 μl Taq polymerase for a final 100
The PCR reaction was performed according to the following procedure, using 1 μl.

As the reaction apparatus, a thermal reactor manufactured by Hibed Co. was used. The reaction condition is 95 ° C; 2 minutes, 95
℃; 30 seconds, 50 ℃; 1 minute, 72 ℃; 1 minute,
Was repeated 50 times. After the reaction, 5 μl of the reaction solution was subjected to 2% agarose gel electrophoresis to confirm that the DNA fragment was amplified.

C) Cloning of amplified fragment The above reaction solution was washed twice with an equal volume of ethyl ether, 10 μl of 3M sodium acetate and 250 μl of ethanol were added to the recovered aqueous layer, and DNA was recovered by ethanol precipitation. did. D
NA was dissolved in 20 μl of TE (pH 8.0), and the whole amount was subjected to 2% agarose electrophoresis. About 200 bp DNA amplified by PCR reaction
The band was cut out, the gel was frozen at -80 ° C, and the solution containing DNA was squeezed out.

The recovered DNA fragment was blunt-ended with a polymerase (Klenow fragment), and then Sma of the plasmid pUC18.
Plasmid pMPCR obtained by subcloning at I site
The DNA sequence of 03 was determined by the dideoxy method. Obtained D
The amino acid sequence deduced from the NA sequence has high homology with the N-terminal amino acid sequences of porcine and human DHP-I,
The DNA obtained by amplification by the PCR method is of mouse DHP-I.
It was inferred to be the N-terminal part of the coding region of cDNA.

(6) Preparation of probe DNA fragment (including mouse DHP-I cDNA; about 200) of the plasmid pMPCR03 in which the mouse DHP-I cDNA fragment was cloned, which was cut out with the restriction enzymes EcoRI and BamHI.
bp) was collected and used as a probe. Recovered DNA
Fragment, Nick Translation Kit (Takara Shuzo)
Was labeled with [α- ³² P] dCTP according to the manual. After the completion of the reaction, the reaction solution was purified with a 10 ml column of Sephadex G50 Super Fine (Pharmacia). The radioactive fraction that first elutes in the TE (pH 8.0) solution was collected (> 5 × 10 ⁷ cpm / total volume).

(7) Preparation of mouse kidney cDNA library 6 μl of poly (A) RNA solution (6 μg) was evaporated to dryness under reduced pressure, and 40
μl 5x reverse transcriptase buffer, 20 μl 100 mM DTT, 5 μl
20 mM dNTP, 1.6 μl 1.25 mg / ml oligo dT, 4 μl M-ML
V reverse transcriptase was added to make the final volume 200 μl, and the mixture was reacted at 37 ° C. for 1 hour. 28 μl of 100 mM magnesium chloride, 40 μl of 1M Tris-HCl (pH 7.5), 60 μl of 100 mM ammonium sulfate, 5 μl of 0.8 U / μl RNaseH, 10 μl of 10 U /
μl DNA polymerase I, 5 μl of 20 mM dNTP, and distilled water were added to make the final 560 μl, and the mixture was reacted at 16-20 ° C. for 4 hours.

Then, 20 μl of 10 mM NAD, 6 μl was added to the above reaction solution.
63 U / μl E. coli DNA ligase and 2 μl of T4 polynucleotide kinase were added and reacted at room temperature for 30 minutes. Equal amount of phenol / chloroform (1/1) solution was added to the reaction solution for phenol extraction, then DNA was recovered by ethanol precipitation, dissolved with 50 μl TE (pH 8.0), and again ethanol precipitated. The DNA was collected and dried under reduced pressure. DNA
It was dissolved in 40 μl of TE (pH 8.0).

The cDNA library is cDNA manufactured by Amersham.
It was prepared according to the manual using a cloning system, λ11 (PRN.1280). 250 μmol EcoRI for 1 μg of cDNA
The adapter, 2 μl of L / K buffer and 5 U of T4 DNA ligase were added to make the final 20 μl, and the binding reaction was performed at 15 ° C. for 16 hours. After the reaction was stopped by adding 2 μl of 0.25 mM EDTA, the fraction of the cDNA to which the adapter was bound was collected by the gel filtration column attached to the system.

The collected solution was concentrated under reduced pressure to about 50 μl and ethanol precipitation was performed to collect DNA. 40 μl L to the recovered DNA
/ K buffer and 80 U of T4 polynucleotide kinase are added to a final volume of 400 μl, and after reacting at 37 ° C for 30 minutes, an equal volume of phenol / chloroform (1/1) solution is added to phenol extraction, and then ethanol is added. The DNA was recovered by precipitation. After drying the DNA, dissolve it in TE (pH 8.0) to approximately 20 ng / μl
Solution.

CDNA (40 ng and 100 n
(2 kinds of g), 1 μl of L / K buffer and 2.5 U of T4 DNA ligase were added to make the final 10 μl, and the binding reaction was performed at 15 ° C. for 16 hours. The reaction solution was subjected to in vitro packaging using the attached packaging extract. A part of the obtained phage (0.5 ml) was infected with the host Escherichia coli Y1090 and the λgt11 recombinant was titrated.

(8) Screening of mouse kidney cDNA library Using the mouse kidney λgt11 cDNA library prepared above, about 5 × 10 ⁴ (recombinant was prepared per 150 mm plate)
Phage fluid and indicator bacteria were both seeded so that plaques (containing 67%) would appear, and cultured at 37 ° C. for 6 hours. After cooling the plate at 4 ° C for 1 hour, a nitrocellulose filter (HATF: manufactured by Millipore) was placed on the plate at room temperature, the filter was marked with a lottling ink, and the plate was left for 2 minutes. The obtained filter was denatured with 0.5N sodium hydroxide-1.5M Tris-hydrochloric acid solution for 5 minutes, and then 1.5M.
The mixture was neutralized with sodium chloride-1.5 M Tris-HCl (pH 8) for 5 minutes. Further, this filter was immersed in a 2 × SSC solution, washed for 2 minutes, and then air-dried at room temperature for 30 minutes.

The dried filter is sandwiched between filter papers and dried under reduced pressure in a vacuum dryer at 80 ° C. for 2 hours. Then, the filter is put into a hybrid bag (manufactured by Cosmo Bio) and 5 ml of prehybridization buffer (5 × SSC ， 0.1% SD
S, 0.1% Ficoll, 0.1% Polyvinylpyrrolidone, 0.1% BSA,
50% formamide, 100 μg / ml tRNA) was added and sealed. Incubated at 42 ° C for 5 hours. After opening the bag and removing the buffer well, once again, pre-hybridization buffer 2.5 ml and 2.5 x 10 ⁶ c
After adding the probe made before pm and sealing, at 42 ℃
Incubated for 16 hours.

After opening the bag and completely removing the buffer, the filter is washed with 50 ml of 2 × SSC-0.1% SDS solution for 5 minutes at room temperature. Further, wash with the same amount of solution at 42 ° C for 10 minutes. The filter was dried on filter paper for 10 minutes, and then autoradiographed (exposure was performed at -80 ° C for 20 hours and then development). Phage plaques (diameter 5-10 mm range, about 10-10
(0 clone) was picked up from the plate and suspended in 1 ml of a phage dilution solution (0.1 M sodium chloride-0.2% magnesium sulfate heptahydrate-1M Tris-HCl (pH 7.5) -2% gelatin).

After the titer of the obtained phage solution was measured, the phage solution containing these positive plaques was screened in the same manner as described above to isolate clones. Positive clones were isolated by plating in a petri dish with a diameter of 150 mm so as to obtain about 500-1500 plaques of phage per filter and screening. By screening about 3 × 10 ⁵ plaques (10 plates) in this manner, a phage clone (9-2-13) containing mouse DHP-I cDNA was obtained.

(9) Construction of plasmid pUCλ13m 10 μg of λ phage DNA (clone 9-2-13) was added with 10 μl of Bam.
Add 5 μl each of HI cleavage buffer and BamHI restriction enzyme for a total volume of 5
The volume was adjusted to 0 μl and incubated at 37 ° C. overnight. The reaction mixture was electrophoresed on agarose gel with a total volume of 1%,
The band near bp was cut out, the gel was frozen at -80 ° C, and the solution containing DNA was squeezed out. 2 μl to 1 μl pUC18
BamHI cleavage buffer, 15 μl distilled water and restriction enzyme BamHI
2 μl was added and the mixture was incubated at 37 ° C. overnight. The reaction mixture was extracted with phenol-chloroform and precipitated with ethanol, and the obtained DNA was dissolved in a TE (pH8.0) solution.

12 μl of the DHP-I cDNA fragment cleaved earlier and p
To 1 μl of the UC18 vector fragment, add 4 μl of 5 × ligase buffer, 2 μl of 20 mM ATP, 1 μl of T4 DNA ligase, and 37 ° C 1
Incubated for hours. E. coli DH5α (Gib
Co BRL) was transformed with 15 μl of this reaction mixture. 60 μl of 100 mM IPTG and 20 mg / ml X-Gal DM in 25 ml of L medium containing 100 μg / ml ampicillin
40 μl of SO solution was added to make one plate. The four transformed plates were seeded with the transformed bacteria and incubated at 37 ° C overnight. White colonies of the grown bacteria were selected, and 12 clones were cultured in 1.5 ml of L medium containing 100 μg / ml ampicillin at 37 ° C. for 8 hours. Plasmids were recovered from these bacteria by the alkaline method, and it was examined by restriction enzymes whether or not the correct fragments were cloned to obtain the desired plasmid pUCλ13m.

(10) DNA mapping and sequence determination The plasmid pUCλ13m containing the cDNA was digested with various restriction enzymes to roughly map the cDNA, and the digested fragments were subcloned into pUC18. The DNA sequence was determined by the dideoxy method using these subcloned plasmid DNAs. The amino acid sequence deduced from the obtained DNA sequence is the mouse DH that was previously partially determined.
Almost the same as the amino acid sequence of PI. The results are shown in the sequence listing.

<Example 2> Construction of expression plasmid (1) Construction of pPCRNter Two 100 kinds of primer DNAs synthesized for PCR (see SPE1MUT and MDHP33 below) were respectively prepared.
PCR reaction (95 ° C., 0.5 ° C.) with mol and 10 ng of template DNA (pUCλ13m) in a total volume of 100 μl.
min. 60 ° C., 1 min. 72 ° C., 1 min. )
Was done. Then, a DNA fragment of about 750 bp was recovered by ethanol precipitation in the presence of ammonium acetate. 14 μl of distilled water, 2 μl of nick translation buffer, 1 μl of 25 mM dNTP, and 1 were added to the DNA fragment into which the restriction enzyme SpeI site had been introduced.
μl of DNA polymerase I Klenow fragment was added and reacted at room temperature for 2 hours. 12 μl of this reaction solution and 20 ng of p
After ligating the SmaI fragment of UC18 with ligase, Escherichia coli MM294 was transformed with the reaction mixture. From the clones obtained, the desired plasmid pP
CRNter was obtained. ^{SPE1MUT: 5 'GATCCCTGGGGAACTAGTAATGGTGATCATCTGG 3' MDHP33} : 5 'TACTTGTGTTCTTCACCAGC 3'

(2) Construction of pUCCMDHPSpe The plasmid pPCRNter (1 μg) constructed above was digested with a restriction enzyme SphI and treated with phosphatase to obtain a large D vector containing DHP-I cDNA.
NA fragment and plasmid pUCλ13m with restriction enzyme Sp
The 1.3 Kbp DNA fragment obtained by partial cleavage of hI was ligated with ligase, and then E. coli MM294
Was transformed. The desired plasmid pUCMDHPSpe was obtained from the obtained clones.

(3) Construction of pDHP15 Mouse DHP-IcD obtained by cleaving plasmid pUCCMDHPSpe with restriction enzymes SpeI and SalI.
A DNA fragment containing NA and a large DNA fragment obtained by cutting plasmid pMM324 with restriction enzymes SpeI and SalI were ligated with ligase. Then, in the reaction mixture, E. coli DH10β (Gib
co BRL) was transformed. The desired plasmid pDHP15 was obtained from the obtained clones. Further, Escherichia coli HB101 was transformed with the plasmid pDHP15, and a large amount of plasmid DNA was recovered from the obtained clone (HB101 / pDHP15). Recovered DNA
Was used as a plasmid DNA for transforming animal cells by applying RNA to a Sepharose CL-4B (Pharmacia) column to remove mixed RNA.

<Example 3> Expression of mouse DHP-I (1) Mouse L92 with expression plasmid pDHP15
Transfection of 9 cells and cloning of producing cells First, pDHP15-calcium phosphate precipitate used in this Example 3 was prepared as follows. 12 in a solution of 30 μg of pDHP15 in 880 μl of sterile distilled water
Add 0 μl of 2M calcium chloride. 1 ml of 2 × HBS (1.
0 g of HEPES, 1.6 g of sodium chloride dissolved in 100 ml of sterile distilled water) and 20 μl of 7
0 mM phosphate buffer (70 mM-dibasic sodium phosphate, 70 mM-dibasic sodium phosphate, pH 7.
(Prepared in 1)) is gradually added.

Next, the third embodiment will be described. 5 x 1
0 ⁵ mouse L929 cells were seeded on a 9 cm Petri dish, cultured overnight in 10 ml of DMEM medium, and the medium was changed 3 hours before transfection. The cells were transfected with pDHP15 (30 μg) -calcium phosphate precipitation suspension. The cells after transfection were treated with 10 ml of 10% FCS-DME.
After culturing in M medium (manufactured by Nissui) at 37 ° C for one day and then changing the medium again, 10 ml of 0.5 mg / ml
After culturing in a medium containing G418 for a whole day and night, cells grown on a Petri dish were dispersed with trypsin, diluted 1 / 10-fold and seeded on 10 new Petri dishes to give 0.5 mg /
The cells were cultured in a medium containing ml G418. The medium was replaced with a new one every 4 days.

After the colonies were sufficiently formed (about 10 days), the colonies were separated and partly transferred to a 96-well plate, 100 μl of medium was added, and the rest was added to a 48-well plate (for cell maintenance) in an amount of 0.5 ml. The cells were cultured overnight in the medium. Next day 9
The 6-well plate is 40 μM zinc sulfate-2% FCS-2
The medium was replaced with an induction medium of mM sodium butyrate and cultured overnight. Non-transfected L929 cells and recombinant cells not replaced with induction medium were used as negative controls.

Selection of transfectants expressing DHP-I and cloning of high producing cells was carried out by using DH using glycyldehydrophenylalanine (GDP) as a substrate.
The activity was measured by the PI assay and selected. The assay method is as follows.
50 μl of 1 mg / ml GD using HP-I as standard
P was added to each well, the change in absorbance at a wavelength of 330 nm per hour was measured as a reaction rate, and a standard straight line was obtained from this change in absorbance. Then, the induction medium of the sample was removed, measurement was performed under the same conditions, and the expression level was calculated from the standard line. In this way, after selecting a transfectant expressing mouse DHP-I, this cell was further cloned to produce a high-producing cell (P
DHP15-55-53-11: Expression level 2 μg / 1 × 1
0 ⁶ cells) were obtained.

[0059]

The present invention is configured as described above,
Mouse dehydropeptidase-I and method for producing the same,
Also, it has become possible to provide DNA, expression vectors, transformants, etc. involved in these gene manipulations. INDUSTRIAL APPLICABILITY According to the present invention, a large amount of mouse dehydropeptidase-I, which is useful for screening carbapenems in chemotherapy, can be efficiently supplied.

[0060]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 2111 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: cDNA to mRNA Sequence characteristics Characteristic symbols: CDS Location: 251..1480 Method for determining characteristics: S Characteristic symbol: sig peptide Location: 251.2.298 Method for determining characteristics: S CGGAGACGAG GAACAGCTGA CATGTGTGAT ACATTAGTCC TGTCTGCTCT CCTTGGCACT 60CTGTGGAGCCCCGGGGAGCT TCCCTTTTAA AGAGGTGGCCGATCCACACT CTCCTTTTAA AGAGGTGGCCCTTCAAAG CTGAAGCCAC ATTGGCACCC 180 CTGACCCGCG TGTGCTCGTG GCACGGAGGT GCCAAAGCCG CTGTGGAAGC AGATCCCTGG 240 GGACCTTGAA ATG GTG ATC ATC TGG TGG TTC TGG TCT CTG CTG GCC ATC 289 Met Val Ile Ile Trp Trp Phe Tla G10 Tla Serleu Leu Lele Serleu Leu TCA TTC CGG GAC CAG GCA GTG GCT ATC ATG AGA ACC 337 Cys Ala Ser Asp Ser Phe Arg Asp Gln Ala Val Ala Ile Met Arg Thr 1 5 10 ACA CCG GTC ATC GAC GGG CAC AAC GAC TTG CCT TGG CAA CTG CTA AAT 385 Thr Pro Val Ile Asp Gly His A sn Asp Leu Pro Trp Gln Leu Leu Asn 15 20 25 TTG TTC AAC AAC CAG CTG CTG AGA CCA GAT GCT GAC TTG AAC AAG CTA 433 Leu Phe Asn Asn Gln Leu Leu Arg Pro Asp Ala Asp Leu Asn Lys Leu 30 35 40 45 GCC CAA ACA CAC ACC AAC ATC CCC AAG CTG AAG GCT GGC TTT GTC GGA 481 Ala Gln Thr His Thr Asn Ile Pro Lys Leu Lys Ala Gly Phe Val Gly 50 55 60 GGC CAG TTC TGG TCC GCA TAC ATG CCT TGT GAC ACC CAA AAC AAA GAT 529 Gly Gln Phe Trp Ser Ala Tyr Met Pro Cys Asp Thr Gln Asn Lys Asp 65 70 75 GCC GTG AAG AGA ATA CTG GAA CAG ATG GAT GTG ATA CAC CGC ATG TGC 577 Ala Val Lys Arg Ile Leu Glu Gln Met Asp Val Ile His Arg Met Cys 80 85 90 CAG CTC TAT CCT GAG ACC TTC ATG TGT GTC ACC AAT AGT TCA GAC ATC 625 Gln Leu Tyr Pro Glu Thr Phe Met Cys Val Thr Asn Ser Ser Asp Ile 95 100 105 CTA CAG GCT TTC CGG AGG GGG AAA GTG GCC AGT CTG ATC GGC GTG GAA 673 Leu Gln Ala Phe Arg Arg Gly Lys Val Ala Ser Leu Ile Gly Val Glu 110 115 120 125 GGC GGC CAC TTA ATT GAC AGC AGC CTT GGT GTC CTG CGG ACA CTC TAC 721 Gly Gly His Leu Ile Asp Ser S er Leu Gly Val Leu Arg Thr Leu Tyr 130 135 140 CAT CTG GGC ATG CGG TAT CTG ACC CTC ACC CAC AAT TGC AAC ACG CCC 769 His Leu Gly Met Arg Tyr Leu Thr Leu Thr His Asn Cys Asn Thr Pro 145 150 155 TGG GCC GAC AAC TGG CTT GTG GAC AGA GGA GAT GAT GAG GCT GAG AGC 817 Trp Ala Asp Asn Trp Leu Val Asp Arg Gly Asp Asp Glu Ala Glu Ser 160 165 170 CAT GGA CTG TCA CCC TTT GGG AAG CGC CTG CTG AAC GAG ATG AAC CGC 865 His Gly Leu Ser Pro Phe Gly Lys Arg Leu Leu Asn Glu Met Asn Arg 175 180 185 TTG GGT GTC ATG ATT GAC CTG TCC CAC GTG TCT GTG GCC ACC ATG AAG 913 Leu Gly Val Met Ile Asp Leu Ser His Val Ser Val Ala Thr Met Lys 190 195 200 205 GAC GCT TTG CAG ATC TCC AGG GCA CCA GTC ATC TTC AGC CAC TCC TCT 961 Asp Ala Leu Gln Ile Ser Arg Ala Pro Val Ile Phe Ser His Ser Ser 210 215 220 GCC TAC AGC CTG TGT CCA CAC AGG CGG AAT GTG CCC GAT GAC GTA CTG 1009 Ala Tyr Ser Leu Cys Pro His Arg Arg Asn Val Pro Asp Asp Val Leu 225 230 235 CAG CTG GTG AAG AAC ACA AGT AGT CTG GTG ATG GTG AAC TTC TTC AGC 1057 Gln Leu Val Lys Asn Thr Ser Ser Leu Val Met Val Asn Phe Phe Ser 240 245 250 AAC TTT GTG TCC TGT TCA GAC AGC GCC ACC TTG CCC CAA GTG GCT GAC 1105 Asn Phe Val Ser Cys Ser Asp Ser Ala Thr Leu Pro Gln Val Ala Asp 255 260 265 CAC CTG GAC CAC ATC AAG AAG GTG GCA GGC GCT GGG GCT GTG GGC CTT 1153 His Leu Asp His Ile Lys Lys Val Ala Gly Ala Gly Ala Val Gly Leu 270 275 280 285 GGA GGA GAT TAT GAT GGT GTT ACT ATG CTT CCT GTG GGA CTG GAG GAT 1201 Gly Gly Asp Tyr Asp Gly Val Thr Met Leu Pro Val Gly Leu Glu Asp 290 295 300 GTT TCT AAG TAC CCA GAC CTG ATA GCT GAG CTT CTC AGG AGG AAC TGG 1249 Val Ser Lys Tyr Pro Asp Leu Ile Ala Glu Leu Leu Arg Arg Asn Trp 305 310 315 ACA GAG ACC GAG GTC AGA GGT TTG CTA GCT GAC AAC CTG ATT CGG GTC 1297 Thr Glu Thr Glu Val Arg Gly Leu Leu Ala Asp Asn Leu Ile Arg Val 320 325 330 TTC TCT GAA GTG GAA CTG GTA AGC AGT AAC ATG CAG TCT CCT GAG GAA 1345 Phe Ser Glu Val Glu Leu Val Ser Ser Asn Met Gln Ser Pro Glu Glu 335 340 345 GTC CCT ATC ACC CTG AAA GAG CTG GAC GGC TCC TGC AGG ACA TAC TAT 1393 Val Pro Ile Thr Leu Lys Glu Leu Asp Gly Ser Cys Arg Thr Tyr Tyr 350 355 360 365 GGC TAC TCT CAA GCT CAC AGC ATC CAC TTG CAG ACA GGA GCC CTG GTG 1441 Gly Tyr Ser Gln Ala His Ser Ile His Leu Gln Thr Gly Ala Leu Val 370 375 380 GCC TCT CTG GCT TCC CTG CTC TTC CGT CTC CAT CTT CTG TGACATCCGA 1490 Ala Ser Leu Ala Ser Leu Leu Phe Arg Leu His Leu Leu 385 390 CCCAGCCCCCACACCCCCCCACACCCAACCTCAGGCTCAATCTCAG 1610 GCTCAAGACA CAGGCATGCA ATAAATGCAA TGAGCCTTAG TGCTGAGTGG GCACGCTGTA 1670 TCTCAGCCCT GGGAGATTCT TCTGAGCCTC TGGAGAGCAG ATGCTGAGAA CAGCCCTGTG 1730 TGAACAGGAC GTGGGAGCAC CTGAGTTCTT GGAGGGGAGG ACTAGAAGGG ACCCAGAAGT 1790 TAGCAAAGTG TCTCACGTAA GCACTAGCTA GTTTGAAAAA TCATGGTCCA CATTTAAGTG 1850 GCTACCTTCC CCCATCACTG TGCATGTACC ACATGCACAT GAACCCCTCC TCCCCCCTTA 1910 CACATGTACT CATGTGCACA CAGGCACATA TAGACATTCA GATGCATTAT ACATATCATA 1970 CATGGGCACA TGTATTCTGA CGCATACCAT ATGAGAGTCA CACATATCTC TCTGGGTTCT 2030 GTA ATTCAGA CTACATAGGT AATGGGTAAC CTCGATCTGG TCCAGCCTTG GTGGGTGGGA 2090 TCCTCTAGAG TCGACCTGCA G 2111

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Office reference number FI technical display location // (C12N 9/80 C12R 1:91) (C12N 5/10 C12R 1:91)

Claims (5)

[Claims] 1. A mouse dehydropeptidase-I having the amino acid sequence set forth in SEQ ID NO: 1 in the Sequence Listing. 2. A DNA encoding the mouse dehydropeptidase-I according to claim 1. 3. An expression vector containing the DNA according to claim 2. 4. A transformant transformed with the expression vector according to claim 3. 5. A method for producing mouse dehydropeptidase-I, which comprises culturing the transformant according to claim 4 in a medium and collecting mouse dehydropeptidase-I from the resulting culture.