JPH0665292A - Insecticidal protein against larva of coleopteran insect and new dna encoding the same - Google Patents

Abstract

PURPOSE:To obtain a new protein capable of controlling insect pests such as Anomala cuprea Hope, showing insecticidal activity against larvae of coleopteran insect, harmless to human body, comprising a plant such as turf, taro, sweet potato, peanut, etc., having a specific amino acid sequence. CONSTITUTION:The whole DNA encoding an amino acid sequence of an insecticidal protein is isolated from Bacillus thuringiensis serovar japonensis strain Buibu, cleft with a restriction enzyme and the DNA fragment is integrated into a plasmid. Escherichia coli is transformed with the recombinant plasmid. Escherichia coli containing a DNA encoding the insecticidal protein is examined by colony hybridization, a protein produced by the Escherichia coli is detected by immunoassay and the insecticidal activity of the protein is examined by biological assay. Totally positive Escherichia coli is selected and cultured to give the objective insecticidal protein against larvae of coleopteran insect, having a specific amino acid sequence.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to an insecticidal protein for larvae of Coleoptera insects and a novel DNA encoding the insecticidal protein.

[0002]

2. Description of the Related Art Conventionally, Bacillus thuringiensis
Strains known to the genus Serovar japonensis are known to produce an insecticidal protein for larvae of Lepidoptera insects. In addition, Bacillus thuringiensis bacteria such as Bacillus thuringiensis San Diego and Bacillus thuringiensis tenebrionis that kill the beetle companion, Colorado potato beetle, and the beetle companion, the beetle Thalassium thuringiensis are known (for example, (Biotechnology 4, 305-308 (1986); J. App
l. Ent. 104 (1987), 417-424)].

[0003]

However, since a strain of the genus Japonensis that produces a toxin protein other than an insecticidal protein for larvae of Lepidoptera insects has not been known, an insecticide against insects other than Lepidoptera is not known. It was not available as a drug. In addition, Bacillus thuringiensis san diego, Bacillus thuringiensis tenebrionis, etc. have no insecticidal effect on the larvae of Rhododendron buoy, which is a major pest of turfgrass, taro, sweet potato, peanut, etc. An effective insecticidal protein for the larvae of Coleoptera insects is unknown and it was difficult to provide its biopesticides. Then, the objective of this invention is to provide the insecticidal protein with respect to the larva of Coleoptera insects, and the DNA which codes the protein.

[0004]

The nucleotide sequence of the novel DNA of the present invention and the amino acid sequence of the insecticidal protein encoded by the novel DNA are shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA is The nucleotide sequence of the modified mutant DNA obtained by partially deleting it and the amino acid sequence of the mutant protein encoded by the mutant DNA are shown in SEQ ID NO: 2.

[0005]

The novel insecticidal protein of the present invention is a product produced by isolating a DNA having a nucleotide sequence encoding the amino acid sequence of the novel insecticidal protein and using the isolated DNA in a host bacterium. That is, it is a product which produces an insecticidal protein by incorporating a DNA having the above-mentioned nucleotide sequence into a plasmid, transforming a host bacterium with this plasmid, and culturing the transformed bacterium. By examining the growth of the DNA in the host by colony hybridization, the production of the protein by immunoassay, and the insecticidal activity by bioassay, the properties of the produced protein are investigated to identify the DNA and the protein. can do.

Therefore, Bacillus thuringiensis
Serobar Japonensis strain buoy (Baci
llus thuringiensis serovar japonensis strain Buibu
i) (hereinafter, referred to as buoy bacterium), the insecticidal protein can be produced in a host that is easily cultivated. The buoy buoy bacterium has been deposited with the Institute of Microbial Science and Technology, the Agency of Industrial Science and Technology, as Micro-Technology Research Institute No. 3465 (FERM BP-3465).

The DNA capable of producing the insecticidal protein has a part of its base sequence (bases encoding the 54th to 709th amino acids from the N-terminal in the amino acid sequence of SEQ ID NO: 1). Mutant D)
You can make NA. The modified mutant DN
A is capable of producing a mutant insecticidal protein having a smaller molecular weight than the insecticidal protein by isolating, incorporating the mutant DNA into a plasmid, cloning it into a host such as Escherichia coli, and expressing it. In addition, this mutant DNA has a smaller molecular weight than that of the above-mentioned DNA, and generally, the DNA used for transformation has a smaller molecular weight, so that it is easier to transform. It has become possible to easily produce a protein having insecticidal activity against Coleoptera insects. However,
It is possible to delete an amino acid further on the N-terminal side than the 709th amino acid, and the protein consisting of the 54th to 709th amino acids is not the minimum activity unit.

Further, a DNA having a nucleotide sequence encoding the amino acid sequence of the above insecticidal protein and its D
The mutant DNA obtained by modifying NA is capable of producing an insecticidal microorganism or an insecticidal plant by incorporating it into various host cells, and produces the DNA and the mutant DNA. The insecticidal protein can be used as an insecticide in various forms. Eventually, it became possible to kill the larvae of Coleoptera insects such as Douganebuibui that could not be killed by conventional microbial pesticides.

[0009]

Therefore, by using the DNA according to the present invention and the insecticidal protein, when pests are removed from plants such as grass, taro, sweet potato, peanut, etc., as compared with the case of using chemical pesticides, It is now possible to provide biopesticides that are less harmful to the human body.

The productivity of the insecticidal protein is improved by cloning the DNA to produce the insecticidal protein. Further, the mutant DNA and the mutant insecticidal protein are isolated to further improve the productivity. Mutant DNA
It was possible to enhance the easiness of cloning and the productivity of the mutant insecticidal protein.

[0011]

[Examples] First, total DNA containing a nucleotide sequence encoding the amino acid sequence of insecticidal protein was isolated from V. buibui, and the DNA was cleaved with a restriction enzyme to prepare a fragment of the DNA. DN
So-called shotgun cloning is carried out in which E. coli is transformed with the recombinant plasmid incorporating the A fragment. Next, among the DNAs produced by the transformed recombinant Escherichia coli, Escherichia coli containing a nucleotide sequence encoding an insecticidal protein is examined by colony hybridization. Furthermore, the protein produced by Escherichia coli having positive DNA for colony hybridization is detected by immunoassay. In addition, the insecticidal activity of the protein is tested by bioassay. After that, by determining the nucleotide sequence of the DNA that was positive in all of the above-mentioned colony hybridization, immunoassay, and bioassay, the DNA encoding the novel insecticidal protein was identified, and this DNA was used to It is possible to make. In addition, in determining the base sequence, shotgun cloning using the first restriction enzyme yielded a gene in which a part of the 3'end was deleted.Therefore, the restriction enzyme was changed, and the full-length base sequence was changed. The operation for reading was performed. Further, a mutant DNA was synthesized by deleting the 3 ′ end of the above DNA using exonuclease, and a mutant insecticidal protein was obtained using the mutant DNA.

Further, the DNA and the mutant DNA
The synthesis of cassette DNA for facilitating the recombination by Escherichia coli, the production of transformed plants, and the production of insecticidal preparations were carried out.

In Example 1, the novel DNA of the present invention
And a new insecticidal protein, DNA cloning,
It will be described in the order of determination of N-terminal of protein, colony hybridization, immunoassay, bioassay, and determination of nucleotide sequence. In Example 2, mutant DNA and mutant insecticidal protein will be described. Example 3
In Example 4, the synthesis of the cassette DNA is described, and in Example 4, the production of the transformed plant is described. Further Example 5
Describes an insecticidal preparation using the microorganism, DNA, and protein described in Examples 1 to 4.

Example 1 Novel DNA and Novel Insecticidal Protein <Isolation of DNA and Cloning in Escherichia coli JM109> V. buoy was cultivated on NYS agar medium [eg (Biologica
l control 2 (1992) [Insecticidal spectrum of a nov
el isolate of Bacillus thuringiensis serovar japon
ensis], Journal of Invertebrate Pathology (1992)
[Processing of delta endotoxin from Bacillus thuri
ngiensis subst.urstaki HD-1 and HD-73 bygut juices
of various insect larvae])
Incubate overnight at 0 ° C, scrape a single colony, and incubate at 30 ° C overnight in Luria liquid medium. At this time, the optical absorption of the bacterial culture at 600 nm is about OD1.5-0.7. General books, eg (A manual for genetic engen
eering: Advanced bacterial genetics eds RWDavis,
D.Botstein, JRRoth, 1980 Cold Spring Harbor La
boratories, MOlecular cloning 2nd ed Sambrook, J.,
Fritsch, EF, Maniatics, T.) etc. to isolate total DNA from buoy buoy.

The obtained DNA is cleaved with the restriction enzyme EcoRI to obtain EcoRI DNA cleaved, and the expression plasmid Blue is previously prepared.
The EcoRI DNA fragment was ligated to the cleavage site of scriptIIKS (+) with the restriction enzyme EcoRI using T4 DNA ligase to prepare a recombinant plasmid. Escherichia coli JM109 strain was transformed by using the recombinant plasmid thus obtained, which migrates at about 6.3 kb, as a candidate for the recombinant plasmid. The E. coli JM109 strain transformed with the recombinant plasmid was treated with ampicillin (50 μg / ml), IP according to a conventional method.
TG (Isopropylthiogalactopyranoside), X-G
al (5-bromo-4-chloro-3-indolyl-D-
Of these Escherichia coli JM109 strains cultured overnight in a Luria broth solid plate medium containing galactopyranoside)
Those containing the EcoRI DNA fragment cannot produce galactosidase and therefore cannot metabolize X-Gal, resulting in white colonies. The blue-colored colonies were assumed to have no EcoRI recombinant plasmid, and only white colonies were transformed into recombinant Escherichia coli JM109 carrying the EcoRI recombinant plasmid to obtain about 10,000 colonies.
I got it. Recombinant Escherichia coli JM109 thus obtained
Were cultivated at 37 ° C. using a Luria agar medium containing ampicillin (50 μg / ml) until the colony diameter became about 2-3 mm.

<Purification of Protein and Determination of N-Terminus> The insecticidal protein produced by V. buibui is [Appl. Ent Zool
vol.26 p485-492 (1991)], and isolated and purified from the culture of buoy buoy. A wet weight of 1 g of the insecticidal crystal was dissolved in a sodium hydroxide solution of pH 12, adjusted to pH 8 with 50 mM Tris-HCl buffer, and then adjusted to 50 mM of pH 8.
Dialyze against Tris-HCl buffer. 1 soluble fraction
Recovered by centrifugation at 50,000 x G
Separation was performed using a (diethylaminoethyl) sepharose ion exchanger column. The soluble fraction obtained by centrifugation was packed in a column (2 cm diameter x 25 cm length), and a sufficient amount of 5
After washing with 0 mM Tris-HCl buffer (pH 8.0),
200 ml of 50 mM Tris-HCl buffer (pH 8.0)
To create a gradient of 0-0.7 M NaCl,
The protein adsorbed on the ion exchange column was continuously eluted (FIG. 1). These were further purified by rechromatography (Figure 2). By the above-mentioned operation, the insecticidal protein was eluted at a sodium chloride concentration of around 0.2 M (shown in P2 of FIG. 1 and FIG. 2B). The insecticidal protein thus obtained was treated with sodium dodecyl sulfate (SD
S) -Polyacrylamide electrophoresis (PAGE) (SD
S1%), stained with bromphenol blue and transferred to a PVDF membrane. 130k thus obtained
When the protein portion of Da was cut out and analyzed using an automatic amino acid sequencer manufactured by ABI, it was found that the N-terminal of the amino acid sequence of the insecticidal protein was as shown in Chemical formula 1. In addition, the method of SDS-PAGE is ubiquitous, for example, Appl. Ent. Zool. 2
6 Use the method of 485-492 1991. The transfer to the PVDF membrane was carried out according to a method recommended by ABI, Millipore, etc. using Immobilon manufactured by Millipore.

[0017]

[Chemical 1] Xaa Xaa Pro Asn Asn Gln Asn Glu Ile Ile Asp Ala Leu

<Colony Hybridization> By combining the amino acid sequence clarified in the above operation with the codons often contained in buoy bacillus,
The nucleotide sequence shown in was synthesized as a probe used for colony hybridization. DIG from Boehringer Mannheim was added to the probe as an end label. DIG is digoxigenin,
It is a substance that emits chemiluminescence and can be bound to a uridine nucleotide by a spacer and incorporated into a primer synthesized by using an oxygen reaction. The method was according to the method of Boehringer Mannheim Biochemica, which is the supplier.

[0019]

[Chemical 2] CCAAATAATCAAAATGAATATGAAAT

The transformed Escherichia coli JM109 strain cultivated in the above was transferred to a nitrocellulose membrane from the colony, and the transferred E. coli was alkali-solubilized by a conventional method to obtain the alkali-solubilized E. coli. Was hybridized with the hybridization probe synthesized above. The detection was performed by exposing the X-ray film to chemiluminescence from the probe. As a result, 5 of the transformed recombinant Escherichia coli colonies hybridized. These 5 strains of Escherichia coli had a buoy and a part of the total DNA integrated by shotgun cloning.
It is highly possible that the target toxin gene is present in.

<Immunoassay> An insecticidal protein crystal was purified from a buoy buoy strain culture by a two-phase partition method or the like (Goodman, NS, RJ Gottfried and MHRogoff (1
967) J. Bacteriol. 94 485). As described above, the antiserum was prepared by solubilizing it with an alkaline solution and immunizing a rabbit as an antigen. Escherichia coli was ground, and after centrifugation, all the substances contained in the soluble fraction collected in the supernatant were used as an antigen, and the antiserum prepared as described above was absorbed, and then used as an antibody for immunoassay. The antiserum used was purified to the immunoglobulin class and bound with peroxidase. A colony of recombinant Escherichia coli that was positive in the above-mentioned colony hybridization test was transferred onto a nitrocellulose membrane, which was then placed on a Luria agar medium containing 50 μg / ml of ampicillin, and cultured at 37 ° C. overnight. . Further, the recombinant Escherichia coli transferred by peeling off the nitrocellulose membrane was subjected to SDS by a conventional method.
Then, alkali treatment was performed to lyse and fix. Next, an antigen-antibody reaction was performed on the E. coli treated as described above using the immunoassay probe. The detection of the antigen-antibody reaction was carried out by the dye produced by the antibody by the enzyme reaction. As a result, all 5 strains of E. coli that were positive by colony hybridization were also positive in the immunoassay, confirming the possibility of producing proteins, particularly toxin proteins. Detection of the probe was performed using the Konica Immunostain system,
A substance using biotin or the like can be used in the same manner as long as it has a high sensitivity.

<Bioassay> Colonies of recombinant Escherichia coli which were positive in the immunoassay were cultured in Luria liquid medium and the cells were collected. The recombinant Escherichia coli was mixed with dry humus and fed to the first-year Dougane buoy. The method for evaluating the contamination of the collected Escherichia coli and its insecticidal activity is as follows. 1. Percentage of mixture: Add 1 ml of the above suspension containing E. coli to 1 g of dried mulch per larva. E. coli is 50
L-containing 50 μg ampicillin in a ml Erlenmeyer flask
Incubate with 10 ml of broth for 2 days, collect the bacteria by centrifugation, and 5 m
It was suspended in 1 l of distilled water and 1 ml thereof was used. Escherichia coli recovered at this time has a wet weight of about 0.3 g. 2. Evaluation of insecticidal property: One larva was placed in each of the plastic cups containing the dried mulch containing the recombinant Escherichia coli, and the larvae were bred for a predetermined period of time. The number of dead larvae was divided by the total number of larvae. Make an evaluation. As a result, it was found that 3 out of the 5 recombinant E. coli colonies that were positive in the hybridization and immunoassay showed insecticidal activity.

<Western blotting> Strains positive in the bioassay were cultured, all proteins were extracted with alkali, and SDS-PAGE analysis was performed. The electrophoresed protein was transferred onto a nitrocellulose membrane and subjected to Western blotting using the antibody absorbed with the antigenic substance contained in the soluble fraction of Escherichia coli. The hybridized protein migrated around 130 kDa.

<Nucleotide Sequence of Gene> Three Escherichia coli colonies that were positive in all tests of colony hybridization, immunoassay, and bioassay. Mass culture was performed using Luria broth liquid medium. Recombinant plasmids were isolated from each of these E. coli colonies and EcoR
After cutting with the I restriction enzyme, when the cut plasmid was examined by agarose gel electrophoresis, two DNA bands could be detected. Of these, one is an open-ring Blue
The size was identical to that of scriptIISK (+), and the other was considered to be DNA containing a nucleotide sequence encoding an insecticidal protein at about 3400 bp.

Fluorescently labeled primers were synthesized using the obtained DNA of about 3400 bp as a template, the synthetic primers were annealed, and various intermediates were prepared by the dideoxynucleotide method using T7-DNA polymerase and dideoxy NTP according to a conventional method. The body was synthesized. The base sequence was read using an automatic reader manufactured by Pharmasi PLKB. As a result, the nucleotide sequence that could be read is 336.
It was 6 bases. However, since a stop codon was not found in the 3366-base sequence, the 336
It was found that 6 bases did not contain the entire base sequence of the target DNA.

Therefore, the DNA isolated from the buoy bacterium was
ClaI DNA fragment was obtained by digesting with the restriction enzyme ClaI.
ClaI DNA fragments were separated by agarose gel electrophoresis.

The EcoRI DNA fragment whose base sequence could be read using EcoRI was cleaved with EcoRV to obtain about 1 k.
Southern analysis was performed using the EcoRV fragment of b as a probe for Southern analysis. (This Southern analysis probe corresponds to a portion slightly 5'-terminal side from the center of the gene of buoy buoy.) When Southern analysis was performed, the Southern analysis probe was separated by the agarose gel electrophoresis described above. It hybridized with a Cla I DNA fragment of about 6.5 kb.

Then, the hybridized portion of the ClaI DNA fragment was taken out, and the ClaI DNA fragment was ligated to the cleavage site obtained by previously cutting the expression plasmid BluescriptIISK (+) with the restriction enzyme ClaI to synthesize a ClaI recombinant plasmid. E. coli XLI blue is transformed with this ClaI recombinant plasmid. The transformed Escherichia coli XLI blue was cultured according to a conventional method. A colony hybridization, immunoassay, and bioassay positive strains were selected from this, and a ClaI DNA fragment containing a nucleotide sequence encoding the amino acid sequence of the insecticidal protein was selected in the same manner as in the case of using the above-mentioned Escherichia coli JM109 strain. The base sequence was determined.
The base sequence encoding the amino acid sequence of the insecticidal protein was composed of a base sequence consisting of 3797 bases as shown in SEQ ID NO: 1, and the open reading frame (ORF) was found to encode 1149 amino acids. In addition, the amino acid sequence encoded by the above base sequence could be estimated, and the estimated molecular weight was found to be 129186. The microorganisms and plasmids containing the nucleotide sequence of SEQ ID NO: 1 are 13
Japan and Japan, deposited with the Institute of Microbial Technology, Ministry of International Trade and Industry, Ministry of International Trade and Industry.

In Example 1, the method for transforming Escherichia coli JM109 strain was the calcium method. However, a method capable of transforming in an ordinary method may be adopted. For example, the Hanahan method, the electric introduction method and the like are used. Is also possible.

In Example 1, E. coli was transformed with Bluescript, but other plasmids may be used.

In Example 1, the host bacterium was Escherichia coli JM.
Although 109 strains were used, the host bacteria are not limited to Escherichia coli, but Gram-negative bacteria such as Pseudomonas, Gram-positive bacteria such as Bacillus, and eukaryotic organisms such as Kaby yeast can also be used. The method of reading the entire base sequence is not limited to the shotgun method using a restriction enzyme. In fact, it is also possible to extend the EcoRI fragment containing a gene that is not full-length to the 3'-terminal side by the PCR method and read the entire base sequence in the same manner. For example, the following reading is possible. 336 in Example 1
Since it was found that NdeI restriction enzyme recognition sites were located near the 4700th position and the 2037th position downstream of the EcoRI DNA fragment which had been read up to 6 bases, the gene was cut out with NdeI and the fragment was circularized. From the NdeI restriction enzyme recognition site to the 3366th base, it is known that there is an AccI restriction enzyme recognition site in the base sequence near the 2746th position. Therefore, cut the self-circularized gene with the AccI restriction enzyme. The ring opened. Both ends of the linear DNA thus opened have AccI restriction enzyme recognition sites. Then this
A known DNA sequence near the AccI restriction enzyme recognition site, which is a base sequence consisting of 30 bases from 2974 to 3003 from the 5 terminus, and 30 bases from 2194 to 2165 as an antisense strand primer It was synthesized (shown in Chemical Formulas 3 and 4 below). Using these as primers, a DNA chain is synthesized by the PCR method. The nucleotide sequence of the synthetic chain is read by an automatic nucleotide sequence reader using the dideoxy method according to a conventional method. result,
This sequence overlapped with the 5'-terminal side of the AccI restriction enzyme recognition site in a form that included the AccI restriction enzyme recognition site, reached the NdeI restriction enzyme recognition site, and a stop codon was found in the way as expected. Thus, the entire nucleotide sequence encoding the amino acid sequence of the insecticidal protein could be read.

[0032]

[Chemical 3] 5'-CAAGAACAACAATGGCAAGACAAAATGGCA-3 '

[0033]

[Chemical 4] 3'-GCAATAAACTTCGTCTTCTTCTGGATCTAC-5 '

[Example 2]: Insecticidal formulation using insecticidal protein Buoy buoy bacterium was cultured to purify crystal protein. Crystals containing crystal proteins are produced by the microorganism and kill the larvae of Coleoptera insects such as scarabs. If this crystal is treated with alkali, the crystal protein will be dissolved and SDS
-Can perform PAGE analysis. The major component of crystal protein is 130 kDa. Purification of this solubilized protein using an ion exchange resin separates the two active ingredients. By SDS-PAGE analysis, the molecular weight was about 130 kDa and 65 kDa. 65k
The abundance of the Da protein is lower than that of 130 kDa. When the amino acids at the N-terminals of the two proteins were analyzed, the analysis results agree with the amino acid sequence of the 130 kDa protein that can be deduced from the nucleotide sequence shown in SEQ ID NO: 1. That is, the case of 130 kDa means that the data was extracted without any modification. On the other hand, comparing the 65-kDa sequence with the entire amino acid sequence shown in SEQ ID NO: 1, the 65-kDa N-terminal amino acid sequence was 130 kDa.
It matches the amino acid sequence starting from the 54th amino acid sequence of a. Therefore, it seems that the 130-kDa protein was processed during the purification process or solubilization. It exhibited insecticidal activity and killed the squirrel buoy. Both proteins can be easily separated from contaminants by adsorbing them on anion exchange resin such as DEAE and increasing the ionic strength continuously or discontinuously using NaCl etc. (Fig. 1 2). The purified protein of 130 or 65 kDa thus purified can be used for formulation as an active ingredient of an insecticidal formulation. The application method may be such as injecting it around the root of the target plant or spraying it around the root around the plant root, which is applied around the root together with compost. Since the protein is easily decomposed by microorganisms in the environment, it can be coated with various polymers to prevent it. The insecticidal preparation may be, for example, Anomala albopilo.
sa), cherry beetle (Anomala daimiana), scarab beetle (Minela splendens), beetle (Popillia japonic)
It is effective for killing insects such as a), Betpertha orientalis, Anomala rufocuprea Motschulsky, and Anomala schoenfeldti Ohaus.

Example 3 Mutant DNA and Mutant Protein The insecticidal protein revealed in Example 1 is
It has a molecular weight of about 130,000 and is called a protoxin that is converted into a toxin having a molecular weight of about 60,000 by being processed by enzymatic decomposition in the intestine of a larva of a beetle insect. Such a mechanism is commonly found in insecticidal proteins as shown in [Microbiol. Rev. 53, 242-255 (1989)] and the like. About half of the insecticidal proteins on the C-terminal side are ,
It is believed that it is not involved in insecticidal activity. In the case of insecticidal protein of buoy buoy strain,
And 6 derived from 130 kDa as shown in FIG.
A 5 kDa insecticidal protein (shown as P1 in FIG. 1 and as in FIG. 2) was also purified and showed insecticidal activity against the larvae of Spodoptera litura (FIG. 2).

In addition, in an experiment in which a deletion mutant strain was prepared using the cryIA (a) gene of Bacillus thuringiensis serovar klestakey-HD-1, it was active when it had the 645th amino acid, and further 645 It is known that when the amino acids from the 1st to the 603rd position are deleted from the C-terminal side, the activity is lost [(J. Biol. Ch.
Em. 260 6273-6280)]. Therefore, when a host cell such as Escherichia coli is transformed with a DNA encoding an insecticidal protein, the DNA revealed in Example 1
DNA even if it is not transformed into a host cell
Can be modified by deleting so that the insecticidal activity is not lost to produce mutant DNA, and the host DNA can be transformed with the mutant DNA.

Therefore, in Example 1, the cloned DNA was used to decompose and delete the 3'end of the DNA with exonuclease to delete the nucleotide sequence from the 5'end to the 2300th and subsequent nucleotides to prepare a mutant DNA. Then, the mutant DNA was cloned using E. coli. Recombinant Escherichia coli containing the mutant DNA and cultured for 1 to 2 days was washed with distilled water and then subjected to a bioassay in the same manner as in Example 1 to examine the insecticidal activity.
It was found that the mutant insecticidal protein produced by A exhibits insecticidal activity.

In the following, SEQ ID NO: 2 shows the nucleotide sequence of the deletion DNA mutant and the amino acid sequence of the mutant protein.

The 65 kDa insecticidal protein was also purified from the crystalline protein as shown in FIGS. 1 and 2 of Example 1. This purified insecticidal protein is SD
A single band was shown on S-PAGE. The 65 kDa insecticidal protein showing this single band was transferred onto a PVDF membrane by a conventional method, the corresponding portion was cut out, and the N-terminal was determined by an automatic amino acid sequencer manufactured by ABI. The N-terminal amino acid sequence of this 65 kDa insecticidal protein has a molecular weight of 130 kDa isolated in Example 1.
It is clear that the insecticidal protein is derived from the sequence of SEQ ID NO: 1, which is equivalent to the amino acid sequence starting from the 54th amino acid from the N-terminus. The molecular weight of 130
It has been shown that the portion consisting of the amino acid from the N-terminal to the 53rd amino acid and the amino acid from the 705th to the C-terminal of the insecticidal protein of kDa is not always necessary for the insecticidal expression.

[Example 4]: Escherichia coli, Pseudomonas,
Encapsulation of DNA so that it can be expressed in Bacillus, etc. Escherichia coli, Pseudomonas, Bacillus, etc. include various bacteria which are practically useful in genetic engineering, agriculture, and industry. The above-described toxin DNA can be easily made into a cassette so that it can be freely inserted into a plasmid that grows and expresses in these bacteria. Since the BamHI site does not exist in the DNA encoding the insecticidal protein, the BamHI site present in the multicloning sites of many commercially available plasmids should be replaced with the initiation codon ATG.
Toxin DNA can be easily introduced into various plasmids at the BamHI site if it is introduced immediately upstream of. In addition, the plasmid is in both E. coli and Pseudomonas,
Or OR working in both Pseudomonas and Bacillus
If the cassette has I, both ends of the cassette are bound to a promoter working in the microorganism, and the translation can be stopped at a desired point, a shuttle vector having a buoy buoy gene or an expression vector is constructed at the same time. be able to. A specific method for synthesizing a cassette DNA is shown below. DNA
The oligonucleotide shown in Chemical formula 5 is synthesized using a synthesizer. This is a product in which the first 12 bases of the translation start point of the buoy bacterium gene of ATGAGTCCAAAT were linked to the BamHI restriction enzyme recognition site of GGATCC. The above-mentioned oligonucleotide can be used as a primer for a sense strand when a DNA strand is synthesized by the PCR method. On the other hand, as a primer for the antisense strand, OR of the 794th AciI site, the 555th BclI site, etc. in the ORF of the gene is used.
A restriction enzyme recognition site such as one site in F can be used as a mark, and a base sequence slightly 3 ′ to the restriction enzyme recognition site can be used. The 3 ′ end of the AciI restriction enzyme recognition site on a synthesizer can be used. The base sequence shown in Chemical formula 6 which is the side base sequence can be synthesized and used as an antisense primer.

[0041]

[Chemical 5] GGATCCATGAGTCCAAAT

[0042]

[Chemical 6] AGACGTAAACGAACATT

As a result of PCR reaction, the following double-stranded DN
A is synthesized. The following chemical formula 7 shows a double-stranded DNA synthesized by the PCR method.

[0044]

[Chemical 7] 5'-GGATCCATGAGTCCA ------- GGCCGCCTCTCTGCATTTGCTT-3 '3'-CCTAGGTACTCAGGT ------- CCGGCGGAGAGACGTAAACGA A-5'

The double-stranded DNA is double-digested with a restriction enzyme BamHI and a restriction enzyme AciI to give BamH
A toxin DNA fragment having the I site at the 5'end and the AciI site at the 3'end can be obtained. 2 of chemical formula 7 below
A cassette DNA prepared from the double-stranded DNA is shown as Chemical formula 8.

[0046]

[Chemical 8]

On the other hand, the EcoRI fragment already cloned was cleaved at the AciI site, and the DNA chain described in Chemical formula 8 synthesized by the PCR method was ligated using T4 DNA ligase to obtain 5 ′.
A toxin DNA having a BamHI site added to the end is obtained.
Then, by the exact same principle, an appropriate restriction oxygen site is inserted immediately downstream of the termination codon. The restriction enzyme site placed downstream is, for example, an OR of AccIII, BsaI, or concentration NotI.
A site that does not exist in F is convenient. For example, as the primer for the sense strand, the one shown in Sequence 9 immediately upstream of AciI in the vicinity of about 790 is preferable.

[0048]

[Chemical 9] ACCCACATATGCACAGGCCGCCTCT

The primer for the antisense strand was AAG TGA --- TAG which is the base sequence immediately 5'to the stop codon.
Chemical sequence 1 with the sequence of AGG CCT which is the recognition site of AccIII
The base sequence shown in 0 is used. As a result of the synthesis by the PCR method, the double-stranded DNA shown in Chemical formula 11 is synthesized.

[0050]

[Chemical 10] TTCACATAAGTTGTATCAGGCCT

[0051]

[Chemical 11] --- AAGTGTATTCAACATAGTCCGGA --- TTCACATAAGTTGTATCAGGCCT

The double-stranded DNA, restriction enzymes AciI and A
Site Cleavage with double decomposition by ccIII
Obtain the NA chain.

[0053]

[Chemical 12]

First, a fragment of toxin DNA in which a restriction enzyme recognition site BamHI was introduced upstream of the 5'end and AciI.
Link at the restriction enzyme recognition site. In this way DNA
It is possible to synthesize a cassette-formed fragment of DNA having intended restriction enzyme recognition sites at both ends. In the case of this example, toxin D having BamHI sites at the 5 ′ end and AccIII sites at the 3 ′ end
NA can be synthesized. By improving the commercially available multi-cloning site, a toxin DNA having each AccIII site can be synthesized. Improve the commercially available multi-cloning site to
Since it is possible to introduce a site for other purposes such as cIII, it is easy to make a cassette at a site that exists only in the ORF. A cassette having restriction enzyme sites at both ends of toxin DNA is a product that can be easily inserted into various plasmids. For example, the cassette fragment of DNA in Example 4 is about 130 kDa.
It was synthesized using the nucleotide sequence encoding the insecticidal protein having the molecular weight of about 65 kD synthesized in Example 3.
It may be synthesized using a nucleotide sequence encoding an insecticidal protein having a molecular weight of a. In this case, since there are many recognition sites, such as MseI, in the restriction enzyme near the 2300th position in the DNA, a complicated operation is required, and HindIII, Bg
It is advisable to add restriction enzyme recognition sites such as 11 and HaeII to the 3'end side following the cut ends. It is a plasmid that grows in Pseudomonas and can be inserted into the BamHI site such as pBD9 that grows in Bacillus. Further, pBR322, pUC18 and the like can be used as plasmids for propagation in E. coli. In this way, a vector capable of expressing in Escherichia coli, Pseudomonas, Bacillus, etc., containing a full-length gene or a gene modified so as not to impair the activity can be constructed. The vector used does not have to grow only in E. coli, but may be a shuttle vector that grows in multiple hosts such as E. coli and Pseudomonas, E. coli and Bacillus. That is, it is sufficient to construct a shuttle vector according to a conventional method using ORI corresponding to each host. In Example 3, Ac was added to the base sequence of the primer.
Although the base sequence near the iI site was used, this makes it easy to identify the fragment after cleavage because there is only one AciI site in the ORF, and when synthesizing by the PCR method, surely Other restriction enzyme recognition sites may be selected although they have the advantage that the length is sufficient for synthesis, and the synthesis method is not limited to the PCR method, but the number of insertion sites is small in the ORF, and if possible there is only one. It can be said that there is no site is good.

[Example 5]: Preparation of transformed plant Most of the genes encoding the 130 kDa insecticidal protein discovered so far have 5 conserved regions [(Hofte and Whiteley Bactriol R
ev (1989))]. Five conserved regions were found in the buoy buoy genes (Fig. 3). They are 760-84 in Sequence Listing 1.
It is a region corresponding to the nucleotide sequence of 9,910-1110, 1669-1815, 1885-1914, 2128-2163.
2 to 5. In 1987, three papers (Plant Phys
iol. 85 1103-1109 (1987), Bio / Technology 5 807-813
(1987), Nature 328 33-37 (1987)) was published for transformed plants, both of which were obtained by inserting a nucleotide sequence encoding the active portion of half of the toxin protein,
When all the regions were used, necrosis occurred in the cultured cells and no transformant could be obtained.
In accordance with standard methods (eg Cell 11 263-271 1977, Cell 1
9 729-739 (1980)), or half of the toxin DNA which has not lost the activity, is inserted into a plasmid system using T-DNA of Agrobacterium as a vector. This plasmid is introduced into plant cultured cells by a physical method such as particle gun, electroporation, or liposome method to prepare transformed cells having mutant DNA. A plant can be regenerated from this cultured cell to produce a recombinant plant having the mutant DNA. As the vector system, a shuttle vector system of plants and microorganisms can also be used. At this time, it is likely that this shuttle vector system with the DNA is present as a plasmid in the host plant cell. This is not suitable for Mendelian inheritance, for example, and is suitable for the generation of one-time transformed plants. The gene fragment inserted into T-DNA was ligated to the gene constructed so as to be expressed in plant cells, for example, immediately 3'to the 35S promoter of CaMV. Inserted gene, from the first 5'end of the nucleotide sequence of SEQ ID NO: 1,
Up to the 2299th was used. Setting the end to the 2299th position is an improvement to include block 5. The terminator of nopaline synthase (nos), which works in plants, was attached to the 3'end of the stop codon. By this method, regardless of dicots, monocots, rice, wheat, corn, peanuts, soybeans with the gene,
It is possible to make many transformed plants such as potato, taro, carrot and carnation. If a promoter related to the synthesis of fruit storage proteins other than the CaMB 35S promoter, a promoter that expresses only in leaves, a promoter that expresses only in roots, etc. is used, tissue-specific expression of toxin protein can be achieved. it can.

[Example 6]: Insecticidal preparation using a protein produced by a transformed microorganism A protein produced by a transformed microorganism can kill larvae of scarab beetles. The cultivated culture can be separated and collected by centrifugation or the like, and can be used as an active ingredient of the preparation after washing. The preparation may be in the form of powder, liquid or the like. It is also possible to stop the culture before the microorganisms undergo autolysis and sterilize it without impairing the insecticidal activity by chemical substances such as acetic acid, and use the substance in which the insecticidal protein is trapped in the bacteria as the active ingredient of the formulation. I can. The application method of these formulations is to inject around the root of the target plant,
Fertilizer is applied around the roots together with the compost. For example, it can be sprayed around the roots around the plant roots.

[0057]

[Sequence list]

SEQ ID NO: 1 Sequence length: 3797 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Bacillus thuringiensis: Serovar
Japonensis (Bacillus thuringiensis serovar japon
ensis) Co., Ltd. Name: buibui (Buibui) AATTCTAATG ACACAGTAGA ATATTTTTAA AATAAAGATG GAAGGGGGAA TATGAAAAAA 60 ATATAATCAT AAGAGTCATA CAAAAAGATT GTATGTTAAA ACAAAAAAAT CCTGTAGGAA 120 TAGGGGTTTA AAAGCAATCA TTTGAAAAGA TAGTTATATT AAATTGTATG TATAGGGGGA 180 AAAAAG ATG AGT CCA AAT AAT CAA AAT GAG TAT GAA ATT ATA GAT GCT 228 Met Ser Pro Asn Asn Gln Asn Glu Tyr Glu Ile Ile Asp Ala 1 5 10 TTA TCA CCC ACT TCT GTA TCC GAT AAT TCT ATT AGA TAT CCT TTA GCA 276 Leu Ser Pro Thr Ser Val Ser Asp Asn Ser Ile Arg Tyr Pro Leu Ala 15 20 25 30 AAC GAT CAA ACG AAC ACA TTA CAA AAC ATG AAT TAT AAA GAT TAT CTG 324 Asn Asp Gln Thr Asn Thr Leu Gln Asn Met Asn Tyr Lys Asp Tyr Leu 35 40 45 AAA ATG ACC GAA TCA ACA AAT GCT GAA TTG TCT CGA AAT CCC GGG ACA 372 Lys Met Thr Glu Ser Thr Asn Ala Glu Leu Ser Arg Asn Pro Gly Thr 50 55 60 TTT ATT AGT GCG CAG GAT GCG GTT GGA ACT GGA ATT GAT ATT GTT AGT 420 Phe Ile Ser Ala Gln Asp Ala Val Gly Thr Gly Ile Asp Ile Val Ser 65 70 75 ACT ATA ATA AGT GGT TTA GGG ATT CCA GTG CTT GGG G AA GTC TTC TCA 468 Thr Ile Ile Ser Gly Leu Gly Ile Pro Val Leu Gly Glu Val Phe Ser 80 85 90 ATT CTG GGT TCA TTA ATT GGC TTA TTG TGG CCG TCA AAT AAT GAA AAT 516 Ile Leu Gly Ser Leu Ile Gly Leu Leu Trp Pro Ser Asn Asn Glu Asn 95 100 105 110 GTA TGG CAA ATA TTT ATG AAT CGA GTG GAA GAG CTA ATT GAT CAA AAA 564 Val Trp Gln Ile Phe Met Asn Arg Val Glu Glu Leu Ile Asp Gln Lys 115 120 125 ATA TTA GAT TCT GTA AGA TCA AGA GCC ATT GCA GAT TTA GCT AAT TCT 612 Ile Leu Asp Ser Val Arg Ser Arg Ala Ile Ala Asp Leu Ala Asn Ser 130 135 140 AGA ATA GCT GTA GAG TAC TAT CAA AAT GCA CTT GAA GAC TGG AGA AAA 660 Arg Ile Ala Val Glu Tyr Tyr Gln Asn Ala Leu Glu Asp Trp Arg Lys 145 150 155 AAC CCA CAC AGT ACA CGA AGC GCA GCA CTT GTA AAG GAA AGA TTT GGA 708 Asn Pro His Ser Thr Arg Ser Ala Ala Leu Val Lys Glu Arg Phe Gly 160 165 170 AAT GCA GAA GCA ATT TTA CGT ACT AAC ATG GGT TCA TTT TCT CAA ACG 756 Asn Ala Glu Ala Ile Leu Arg Thr Asn Met Gly Ser Phe Ser Gln Thr 175 180 185 190 AAT TAT GAG ACT CCA CTC TTA CCC ACA T AT GCA CAG GCC GCC TCT CTG 804 Asn Tyr Glu Thr Pro Leu Leu Pro Thr Tyr Ala Gln Ala Ala Ser Leu 195 200 205 CAT TTG CTT GTA ATG AGG GAT GTT CAA ATT TAC GGG AAG GAA TGG GGA 852 His Leu Leu Val Met Arg Asp Val Gln Ile Tyr Gly Lys Glu Trp Gly 210 215 220 TAT CCT CAA AAT GAT ATT GAC CTA TTT TAT AAA GAA CAA GTA TCT TAT 900 Tyr Pro Gln Asn Asp Ile Asp Leu Phe Tyr Lys Glu Gln Val Ser Tyr 225 230 235 ACG GCT AGA TAT TCC GAT CAT TGC GTC CAA TGG TAC AAT GCT GGT TTA 948 Thr Ala Arg Tyr Ser Asp His Cys Val Gln Trp Tyr Asn Ala Gly Leu 240 245 250 AAT AAA TTA AGA GGA ACG GGT GCT AAG CAA TGG GTG GAT TAT AAT CGT 996 Asn Lys Leu Arg Gly Thr Gly Ala Lys Gln Trp Val Asp Tyr Asn Arg 255 260 265 270 TTC CGA AGA GAA ATG AAT GTG ATG GTA TTG GAT CTA GTT GCA TTA TTT 1044 Phe Arg Arg Glu Met Asn Val Met Val Leu Asp Leu Val Ala Leu Phe 275 280 285 CCA AAC TAC GAT GCG CGT ATA TAT CCA CTG GAA ACA AAT GCA GAA CTT 1092 Pro Asn Tyr Asp Ala Arg Ile Tyr Pro Leu Glu Thr Asn Ala Glu Leu 290 295 300 ACA AGA GAA ATT TTC ACA GAT CCT GTT GGA AGT TAC GTA ACT GGA CAA 1140 Thr Arg Glu Ile Phe Thr Asp Pro Val Gly Ser Tyr Val Thr Gly Gln 305 310 315 TCG AGT ACC CTT ATA TCT TGG TAC GAT ATG ATT CCA GCA GCT CTT CCT 1188 Ser Ser Thr Leu Ile Ser Trp Tyr Asp Met Ile Pro Ala Ala Leu Pro 320 325 330 TCA TTT TCA ACG CTC GAG AAC CTA CTT AGA AAA CCT GAT TTC TTT ACT 1236 Ser Phe Ser Thr Leu Glu Asn Leu Leu Arg Lys Pro Asp Phe Phe Thr 335 340 345 350 TTG CTG CAA GAA ATT AGA ATG TAT ACA AGT TTT AGA CAA AAC GGT ACG 1284 Leu Leu Gln Glu Ile Arg Met Tyr Thr Ser Phe Arg Gln Asn Gly Thr 355 360 365 ATT GAA TAT TAT AAT TAT TGG GGA GGA CAA AGG TTA ACC CTT TCT TAT 1332 Ile Glu Tyr Tyr Asn Tyr Trp Gly Gly Gln Arg Leu Thr Leu Ser Tyr 370 375 380 ATC TAT GGT TCC TCA TTC AAT AAA TAT AGT GGG GTT CTT GCC GGT GCT 1380 Ile Tyr Gly Ser Ser Phe Asn Lys Tyr Ser Gly Val Leu Ala Gly Ala 385 390 395 GAG GAT ATT ATT CCT GTG GGT CAA AAT GAT ATT TAC AGA GTT GTA TGG 1428 Glu Asp Ile Ile Pro Val Gly Gln Asn Asp Ile Tyr Arg Val Val Trp 400 405 410 ACT TAT ATA GGA AGG TAC ACG AAT AGT CTG CTA GGA GTA AAT CCA GTT 1476 Thr Tyr Ile Gly Arg Tyr Thr Asn Ser Leu Leu Gly Val Asn Pro Val 415 420 425 430 ACT TTT TAC TTC AGT AAT AAT ACA CAA AAA ACT TAT TCG AAG CCA AAA 1524 Thr Phe Tyr Phe Ser Asn Asn Thr Gln Lys Thr Tyr Ser Lys Pro Lys 435 440 445 CAA TTC GCG GGT GGA ATA AAA ACA ATT GAT TCC GGC GAA GAA TTA ACT 1572 Gln Phe Ala Gly Gly Ile Lys Thr Ile Asp Ser Gly Glu Glu Leu Thr 450 455 460 TAC GAA AAT TAT CAA TCT TAT AGT CAC AGG GTA AGT TAC ATT ACA TCT 1620 Tyr Glu Asn Tyr Gln Ser Tyr Ser His Arg Val Ser Tyr Ile Thr Ser 465 475 475 TTT GAA ATA AAA AGT ACC GGT GGT ACA GTA TTA GGA GTA GTT CCT ATA 1668 Phe Glu Ile Lys Ser Thr Gly Gly Thr Val Leu Gly Val Val Pro Ile 480 485 490 TTT GGT TGG ACG CAT AGT AGT GCC AGT CGC AAT AAC TTT ATT TAC GCA 1716 Phe Gly Trp Thr His Ser Ser Ala Ser Arg Asn Asn Phe Ile Tyr Ala 495 500 505 510 ACA AAA ATC TCA CAA ATC CCA ATC AAT AAA GCA AGT AGA ACT AGC GGT 1764 Thr Lys Ile Ser Gln Ile Pro Ile Asn Lys Ala Ser Arg Thr S er Gly 515 520 525 GGA GCG GTT TGG AAT TTC CAA GAA GGT CTA TAT AAT GGA GGA CCT GTA 1812 Gly Ala Val Trp Asn Phe Gln Glu Gly Leu Tyr Asn Gly Gly Pro Val 530 535 540 ATG AAA TTA TCT GGG TCT GGT TCC CAA GTA ATA AAC TTA AGG GTC GCA 1860 Ke Met Lys Leu Ser Gly Ser Gly Ser Gln Val Ile Asn Leu Arg Val Ala 545 550 555 ACA GAT GCA AAG GGA GCA AGT CAA AGA TAT CGT ATT AGA ATC AGA TAT 1908 Thr Asp Ala Lys Gly Ala Ser Gln Arg Tyr Arg Ile Arg Ile Arg Tyr 560 565 570 GCC TCT GAT AGA GCG GGT AAA TTT ACG ATA TCT TCC AGA TCT CCA GAG 1956 Ala Ser Asp Arg Ala Gly Lys Phe Thr Ile Ser Ser Arg Ser Pro Glu 575 580 585 590 AAT CCT GCA ACC TAT TCA GCT TCT ATT GCT TAT ACA AAT ACT ATG TCT 2004 Asn Pro Ala Thr Tyr Ser Ala Ser Ile Ala Tyr Thr Asn Thr Met Ser ACA AAT GCT TCT CTA ACG TAT AGT ACT TTT GCA TAT GCA GAA TCT GGC 2052 Thr Asn Ala Ser Leu Thr Tyr Ser Thr Phe Ala Tyr Ala Glu Ser Gly 610 615 620 CCT ATA AAC TTA GGG ATT TCG GGA AGT TCA AGG ACT TTT GAT ATA TCT 2100 Pro Ile Asn Leu Gly Ile Ser Gly Ser Ser Arg Th r Phe Asp Ile Ser 625 630 635 ATT ACA AAA GAA GCA GGT GCT GCT AAC CTT TAT ATT GAT AGA ATT GAA 2148 Ile Thr Lys Glu Ala Gly Ala Ala Asn Leu Tyr Ile Asp Arg Ile Glu 640 645 650 TTT ATT CCA GTT AAT ACG TTA TTT GAA GCA GAA GAA GAC CTA GAT GTG 2196 Phe Ile Pro Val Asn Thr Leu Phe Glu Ala Glu Glu Asp Leu Asp Val 655 660 665 670 GCA AAG AAA GCT GTG AAT GGC TTG TTT ACG AAT GAA AAA GAT GCC TTA 2244 Ala Lys Lys Ala Val Asn Gly Leu Phe Thr Asn Glu Lys Asp Ala Leu 675 680 685 CAG ACA AGT GTA ACG GAT TAT CAA GTC AAT CAA GCG GCA AAC TTA ATA 2292 Gln Thr Ser Val Thr Asp Tyr Gln Val Asn Gln Ala Ala Asn Leu Ile 690 695 700 GAA TGC CTA TCC GAT GAG TTA TAC CCA AAT GAA AAA CGA ATG TTA TGG 2340 Glu Cys Leu Ser Asp Glu Leu Tyr Pro Asn Glu Lys Arg Met Leu Trp 705 710 715 GAT GCA GTG AAA GAG GCG AAA CGA CTT GTT CAG GCA CGT AAC TTA CTC 2388 Asp Ala Val Lys Glu Ala Lys Arg Leu Val Gln Ala Arg Asn Leu Leu 720 725 730 CAA GAT ACA GGC TTT AAT AGG ATT AAT GGA GAA AAC GGA TGG ACG GGA 2436 Gln Asp Thr Gly Phe Asn Arg Ile Asn Gly Glu Asn Gly Trp Thr Gly 735 740 745 750 AGT ACG GGA ATC GAG GTT GTG GAA GGA GAT GTT CTG TTT AAA GAT CGT 2484 755 760 765 TCG CTT CGT TTG ACA AGT GCG AGA GAG ATT GAT ACA GAA ACA TAT CCA 32 Ser Leu Arg Leu Thr Ser Ala Arg Glu Ile Asp Thr Glu Thr Tyr Pro 770 775 780 ACG TAT CTC TAT CAA CAA ATA GAT GAA TCG CTT TTA AAA CCA TAT ACA 2580 Thr Tyr Leu Tyr Gln Gln Ile Asp Glu Ser Leu Leu Lys Pro Tyr Thr 785 790 795 AGA TAT AAA CTA AAA GGT TTT ATA GGA AGT AGT CAA GAT TTA GAG ATT 2628 Arg Tyr Lys Leu Lys Gly Phe Ile Gly Ser Ser Gln Asp Leu Glu Ile 800 805 810 AAA TTA ATA CGT CAT CGG GCA AAT CAA ATC GTC AAA AAT GTA CCA GAT 2676 Lys Leu Ile Arg His Arg Ala Asn Gln Ile Val Lys Asn Val Pro Asp 815 820 825 830 AAT CTC TTG CCA GAT GTA CGC CCT GTC AAT TCT TGT GGT GGA GTC GAT 2724 Asn Leu Leu Pro Asp Val Arg Pro Val Asn Ser Cys Gly Gly Val Asp 835 840 845 CGC TGC AGT GAA CAA CAG TAT GTA GAC GCG AAT TTA GCA CTC GAA AAC 2772 Arg Cys Ser Glu Gln Gln Tyr Val Asp Ala Asn Leu Ala Leu Glu Asn 850 855 860 AAT GGA GAA AAT GGA AAT ATG TCT TCT GAT TCC CAT GCA TTT TCT TTC 2820 Asn Gly Glu Asn Gly Asn Met Ser Ser Asp Ser His Ala Phe Ser Phe 865 870 875 CAT ATT GAT ACG GGT GAA ATA GAT TTG AAT GAA AAT ACA GGA ATT TGG 2868 His Ile Asp Thr Gly Glu Ile Asp Leu Asn Glu Asn Thr Gly Ile Trp 880 885 890 ATC GTA TTT AAA ATT CCG ACA ACA AAT GGA AAC GCA ACA CTA GGA AAT 2916 Ile Val Phe Lys Ile Pro Thr Thr Asn Gly Asn Ala Thr Leu Gly Asn 895 900 905 910 CTT GAA TTT GTA GAA GAG GGG CCA TTG TCA GGG GAA ACA TTA GAA TGG 2964 Leu Glu Phe Val Glu Glu Gly Pro Leu Ser Gly Glu Thr Leu Glu Trp 915 920 925 GCC CAA CAA CAA GAA CAA CAA TGG CAA GAC AAA ATG GCA AGA AAA CGT 3012 Ala Gln Gln Gln Glu Gln Gln Trp Gln Asp Lys Met Ala Arg Lys Arg 930 935 940 GCA GCA TCA GAA AAA ACA TAT TAT GCA GCA AAG CAA GCC ATT GAT CGT 3060 Ala Ala Ser Glu Lys Thr Tyr Tyr Ala Ala Lys Gln Ala Ile Asp Arg 945 950 955 TTA TTC GCA GAT TAT CAA GAC CAA AAA CTT AAT TCT GGT GTA GAA ATG 3108 Leu Phe Ala Asp Tyr Gln Asp Gln Lys Leu Asn Ser G ly Val Glu Met 960 965 970 TCA GAT TTG TTG GCA GCC CAA AAC CTT GTA CAG TCC ATT CCT TAC GTA 3156 Ser Asp Leu Leu Ala Ala Gln Asn Leu Val Gln Ser Ile Pro Tyr Val 975 980 985 990 TAT AAT GAT GCG TTA CCG GAA ATC CCT GGA ATG AAC TAT ACG AGT TTT 3204 Tyr Asn Asp Ala Leu Pro Glu Ile Pro Gly Met Asn Tyr Thr Ser Phe 995 1000 1005 ACA GAG TTA ACA AAT AGA CTC CAA CAA GCA TGG AAT TTG TAT GAT CTT 3252 Thr Glu Leu Thr Asn Arg Leu Gln Gln Ala Trp Asn Leu Tyr Asp Leu 1010 1015 1020 CAA AAC GCT ATA CCA AAT GGA GAT TTT CGA AAT GGA TTA AGT AAT TGG 3300 Gln Asn Ala Ile Pro Asn Gly Asp Phe Arg Asn Gly Leu Ser Asn Trp 10rp 1030 1035 AAT GCA ACA TCA GAT GTA AAT GTG CAA CAA CTA AGC GAT ACA TCT GTC 3348 Asn Ala Thr Ser Asp Val Asn Val Gln Gln Leu Ser Asp Thr Ser Val 1040 1045 1050 CTT GTC ATT CCA AAC TGG AAT TCT CAA GTG TCA CAA CAA TTT ACA GTT 3396 Leu Val Ile Pro Asn Trp Asn Ser Gln Val Ser Gln Gln Phe Thr Val CAA CCG AAT TAT AGA TAT GTG TTA CGT GTC ACA GCG AGA AAA GAG GGA 3444 Gln Pro Asn Tyr Arg Tyr Val Leu Arg Val Thr Ala Arg Lys Glu Gly 1075 1080 1085 GTA GGA GAC GGA TAT GTG ATC ATC CGT GAT GGT GCA AAT CAG ACA GAA 3492 Val Gly Asp Gly Tyr Val Ile Ile Arg Asp Gly Ala Asn Gln Thr Glu 1090 1095 1100 ACA CTC ACA TTT AAT ATA TGT GAT GAT GAT ACA GGT GTT TTA TCT ACT 3540 Thr Leu Thr Phe Asn Ile Cys Asp Asp Asp Thr Gly Val Leu Ser Thr 1105 1110 1115 GAT CAA ACT AGC TAT ATC ACA AAA ACA GTG GAA TTC ACT CCA TCT ACA 3588 Asp Gln Thr Ser Tyr Ile Thr Lys Thr Val Glu Phe Thr Pro Ser Thr 1120 1125 1130 GAG CAA GTT TGG ATT GAC ATG AGT GAG ACC GAA GTG TAT TCA ACA TAGAAAG3640 Glu Gln Val Trp Ile Asp Met Ser Glu Thr Glu Val Tyr Ser Thr 1135 1140 1145 TGTAGAACTC GTGTTAGAAG AAGAGTAATC ATAGTTTCCC TCCAGATAGA AGGTTGATCT 3700 GGAGGTTTTC TTATAGAGAG AGTACTATGA ATCAAATGTT TGATGAATGC GTTGCGAGCG 3760 GTTTATCTCA AATATCAACG GTACAAGGTT TATAAAT 3797

SEQ ID NO: 2 Sequence length: 2299 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Bacillus thuringiensis: Serovar
Japonensis (Bacillus thuringiensis serovar japon
ensis) Co., Ltd. Name: buibui (Buibui) AATTCTAATG ACACAGTAGA ATATTTTTAA AATAAAGATG GAAGGGGGAA TATGAAAAAA 60 ATATAATCAT AAGAGTCATA CAAAAAGATT GTATGTTAAA ACAAAAAAAT CCTGTAGGAA 120 TAGGGGTTTA AAAGCAATCA TTTGAAAAGA TAGTTATATT AAATTGTATG TATAGGGGGA 180 AAAAAG ATG AGT CCA AAT AAT CAA AAT GAG TAT GAA ATT ATA GAT GCT 228 Met Ser Pro Asn Asn Gln Asn Glu Tyr Glu Ile Ile Asp Ala 1 5 10 TTA TCA CCC ACT TCT GTA TCC GAT AAT TCT ATT AGA TAT CCT TTA GCA 276 Leu Ser Pro Thr Ser Val Ser Asp Asn Ser Ile Arg Tyr Pro Leu Ala 15 20 25 30 AAC GAT CAA ACG AAC ACA TTA CAA AAC ATG AAT TAT AAA GAT TAT CTG 324 Asn Asp Gln Thr Asn Thr Leu Gln Asn Met Asn Tyr Lys Asp Tyr Leu 35 40 45 AAA ATG ACC GAA TCA ACA AAT GCT GAA TTG TCT CGA AAT CCC GGG ACA 372 Lys Met Thr Glu Ser Thr Asn Ala Glu Leu Ser Arg Asn Pro Gly Thr 50 55 60 TTT ATT AGT GCG CAG GAT GCG GTT GGA ACT GGA ATT GAT ATT GTT AGT 420 Phe Ile Ser Ala Gln Asp Ala Val Gly Thr Gly Ile Asp Ile Val Ser 65 70 75 ACT ATA ATA AGT GGT TTA GGG ATT CCA GTG CTT GGG G AA GTC TTC TCA 468 Thr Ile Ile Ser Gly Leu Gly Ile Pro Val Leu Gly Glu Val Phe Ser 80 85 90 ATT CTG GGT TCA TTA ATT GGC TTA TTG TGG CCG TCA AAT AAT GAA AAT 516 Ile Leu Gly Ser Leu Ile Gly Leu Leu Trp Pro Ser Asn Asn Glu Asn 95 100 105 110 GTA TGG CAA ATA TTT ATG AAT CGA GTG GAA GAG CTA ATT GAT CAA AAA 564 Val Trp Gln Ile Phe Met Asn Arg Val Glu Glu Leu Ile Asp Gln Lys 115 120 125 ATA TTA GAT TCT GTA AGA TCA AGA GCC ATT GCA GAT TTA GCT AAT TCT 612 Ile Leu Asp Ser Val Arg Ser Arg Ala Ile Ala Asp Leu Ala Asn Ser 130 135 140 AGA ATA GCT GTA GAG TAC TAT CAA AAT GCA CTT GAA GAC TGG AGA AAA 660 Arg Ile Ala Val Glu Tyr Tyr Gln Asn Ala Leu Glu Asp Trp Arg Lys 145 150 155 AAC CCA CAC AGT ACA CGA AGC GCA GCA CTT GTA AAG GAA AGA TTT GGA 708 Asn Pro His Ser Thr Arg Ser Ala Ala Leu Val Lys Glu Arg Phe Gly 160 165 170 AAT GCA GAA GCA ATT TTA CGT ACT AAC ATG GGT TCA TTT TCT CAA ACG 756 Asn Ala Glu Ala Ile Leu Arg Thr Asn Met Gly Ser Phe Ser Gln Thr 175 180 185 190 AAT TAT GAG ACT CCA CTC TTA CCC ACA T AT GCA CAG GCC GCC TCT CTG 804 Asn Tyr Glu Thr Pro Leu Leu Pro Thr Tyr Ala Gln Ala Ala Ser Leu 195 200 205 CAT TTG CTT GTA ATG AGG GAT GTT CAA ATT TAC GGG AAG GAA TGG GGA 852 His Leu Leu Val Met Arg Asp Val Gln Ile Tyr Gly Lys Glu Trp Gly 210 215 220 TAT CCT CAA AAT GAT ATT GAC CTA TTT TAT AAA GAA CAA GTA TCT TAT 900 Tyr Pro Gln Asn Asp Ile Asp Leu Phe Tyr Lys Glu Gln Val Ser Tyr 225 230 235 ACG GCT AGA TAT TCC GAT CAT TGC GTC CAA TGG TAC AAT GCT GGT TTA 948 Thr Ala Arg Tyr Ser Asp His Cys Val Gln Trp Tyr Asn Ala Gly Leu 240 245 250 AAT AAA TTA AGA GGA ACG GGT GCT AAG CAA TGG GTG GAT TAT AAT CGT 996 Asn Lys Leu Arg Gly Thr Gly Ala Lys Gln Trp Val Asp Tyr Asn Arg 255 260 265 270 TTC CGA AGA GAA ATG AAT GTG ATG GTA TTG GAT CTA GTT GCA TTA TTT 1044 Phe Arg Arg Glu Met Asn Val Met Val Leu Asp Leu Val Ala Leu Phe 275 280 285 CCA AAC TAC GAT GCG CGT ATA TAT CCA CTG GAA ACA AAT GCA GAA CTT 1092 Pro Asn Tyr Asp Ala Arg Ile Tyr Pro Leu Glu Thr Asn Ala Glu Leu 290 295 300 ACA AGA GAA ATT TTC ACA GAT CCT GTT GGA AGT TAC GTA ACT GGA CAA 1140 Thr Arg Glu Ile Phe Thr Asp Pro Val Gly Ser Tyr Val Thr Gly Gln 305 310 315 TCG AGT ACC CTT ATA TCT TGG TAC GAT ATG ATT CCA GCA GCT CTT CCT 1188 Ser Ser Thr Leu Ile Ser Trp Tyr Asp Met Ile Pro Ala Ala Leu Pro 320 325 330 TCA TTT TCA ACG CTC GAG AAC CTA CTT AGA AAA CCT GAT TTC TTT ACT 1236 Ser Phe Ser Thr Leu Glu Asn Leu Leu Arg Lys Pro Asp Phe Phe Thr 335 340 345 350 TTG CTG CAA GAA ATT AGA ATG TAT ACA AGT TTT AGA CAA AAC GGT ACG 1284 Leu Leu Gln Glu Ile Arg Met Tyr Thr Ser Phe Arg Gln Asn Gly Thr 355 360 365 ATT GAA TAT TAT AAT TAT TGG GGA GGA CAA AGG TTA ACC CTT TCT TAT 1332 Ile Glu Tyr Tyr Asn Tyr Trp Gly Gly Gln Arg Leu Thr Leu Ser Tyr 370 375 380 ATC TAT GGT TCC TCA TTC AAT AAA TAT AGT GGG GTT CTT GCC GGT GCT 1380 Ile Tyr Gly Ser Ser Phe Asn Lys Tyr Ser Gly Val Leu Ala Gly Ala 385 390 395 GAG GAT ATT ATT CCT GTG GGT CAA AAT GAT ATT TAC AGA GTT GTA TGG 1428 Glu Asp Ile Ile Pro Val Gly Gln Asn Asp Ile Tyr Arg Val Val Trp 400 405 410 ACT TAT ATA GGA AGG TAC ACG AAT AGT CTG CTA GGA GTA AAT CCA GTT 1476 Thr Tyr Ile Gly Arg Tyr Thr Asn Ser Leu Leu Gly Val Asn Pro Val 415 420 425 430 ACT TTT TAC TTC AGT AAT AAT ACA CAA AAA ACT TAT TCG AAG CCA AAA 1524 Thr Phe Tyr Phe Ser Asn Asn Thr Gln Lys Thr Tyr Ser Lys Pro Lys 435 440 445 CAA TTC GCG GGT GGA ATA AAA ACA ATT GAT TCC GGC GAA GAA TTA ACT 1572 Gln Phe Ala Gly Gly Ile Lys Thr Ile Asp Ser Gly Glu Glu Leu Thr 450 455 460 TAC GAA AAT TAT CAA TCT TAT AGT CAC AGG GTA AGT TAC ATT ACA TCT 1620 Tyr Glu Asn Tyr Gln Ser Tyr Ser His Arg Val Ser Tyr Ile Thr Ser 465 475 475 TTT GAA ATA AAA AGT ACC GGT GGT ACA GTA TTA GGA GTA GTT CCT ATA 1668 Phe Glu Ile Lys Ser Thr Gly Gly Thr Val Leu Gly Val Val Pro Ile 480 485 490 TTT GGT TGG ACG CAT AGT AGT GCC AGT CGC AAT AAC TTT ATT TAC GCA 1716 Phe Gly Trp Thr His Ser Ser Ala Ser Arg Asn Asn Phe Ile Tyr Ala 495 500 505 510 ACA AAA ATC TCA CAA ATC CCA ATC AAT AAA GCA AGT AGA ACT AGC GGT 1764 Thr Lys Ile Ser Gln Ile Pro Ile Asn Lys Ala Ser Arg Thr S er Gly 515 520 525 GGA GCG GTT TGG AAT TTC CAA GAA GGT CTA TAT AAT GGA GGA CCT GTA 1812 Gly Ala Val Trp Asn Phe Gln Glu Gly Leu Tyr Asn Gly Gly Pro Val 530 535 540 ATG AAA TTA TCT GGG TCT GGT TCC CAA GTA ATA AAC TTA AGG GTC GCA 1860 Met Lys Leu Ser Gly Ser Gly Ser Gln Val Ile Asn Leu Arg Val Ala 545 550 555 ACA GAT GCA AAG GGA GCA AGT CAA AGA TAT CGT ATT AGA ATC AGA TAT 1908 Thr Asp Ala Lys Gly Ala Ser Gln Arg Tyr Arg Ile Arg Ile Arg Tyr 560 565 570 GCC TCT GAT AGA GCG GGT AAA TTT ACG ATA TCT TCC AGA TCT CCA GAG 1956 Ala Ser Asp Arg Ala Gly Lys Phe Thr Ile Ser Ser Arg Ser Pro Glu 575 580 585 590 AAT CCT GCA ACC TAT TCA GCT TCT ATT GCT TAT ACA AAT ACT ATG TCT 2004 Asn Pro Ala Thr Tyr Ser Ala Ser Ile Ala Tyr Thr Asn Thr Met Ser 595 600 605 ACA AAT GCT TCT CTA ACG TAT AGT ACT TTT GCA TAT GCA GAA TCT GGC 2052 Thr Asn Ala Ser Leu Thr Tyr Ser Thr Phe Ala Tyr Ala Glu Ser Gly 610 615 620 CCT ATA AAC TTA GGG ATT TCG GGA AGT TCA AGG ACT TTT GAT ATA TCT 2100 Pro Ile Asn Leu Gly Ile Ser Gly Ser Se r Arg Thr Phe Asp Ile Ser 625 630 635 ATT ACA AAA GAA GCA GGT GCT GCT AAC CTT TAT ATT GAT AGA ATT GAA 2148 Ile Thr Lys Glu Ala Gly Ala Ala Asn Leu Tyr Ile Asp Arg Ile Glu 640 645 650 TTT ATT CCA GTT AAT ACG TTA TTT GAA GCA GAA GAA GAC CTA GAT GTG 2196 Phe Ile Pro Val Asn Thr Leu Phe Glu Ala Glu Glu Asp Leu Asp Val 655 660 665 670 GCA AAG AAA GCT GTG AAT GGC TTG TTT ACG AAT GAA AAA GAT GCC TTA 2244 Ala Lys Lys Ala Val Asn Gly Leu Phe Thr Asn Glu Lys Asp Ala Leu 675 680 685 CAG ACA AGT GTA ACG GAT TAT CAA GTC AAT CAA GCG GCA AAC TTA ATA 2292 Gln Thr Ser Val Thr Asp Tyr Gln Val Asn Gln Ala Ala Asn Leu Ile 690 695 700 GAA TGC C 2313 Glu Cys

[Brief description of drawings]

FIG. 1 DEAE column chromatography of solubilized toxin protein.

FIG. 2: Re-chromatography of the 130 kDa, 65 kDa protein obtained in FIG. 1, (A) 65 kDa,
(B) is 130 kDa

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI technical display location C12N 1/21 7236-4B 5/10 15/32 15/70 15/75 15/78 // C12P 21/02 C 8214-4B (C12N 1/21 C12R 1:19) (C12N 1/21 C12R 1:38) (C12N 1/21 C12R 1:07) (C12P 21/02 C12R 1:19) (C12P 21 / 02 C12R 1:38) D06M 13/18 (72) Inventor Hidetaka Hori 5-6 Koyodai, Ryugasaki City, Ibaraki Prefecture Tsukuba Laboratory, Kubota Technology Development Laboratory (72) Inventor Shoji Asano 5 Koyodai, Ryugasaki City, Ibaraki Prefecture ―6 Kubota Technology Development Laboratory Tsukuba Laboratory (72) Inventor Tadaaki Kawasugi 5-6 Koyodai, Ryugasaki City, Ibaraki Prefecture 6-6 Kubota Technology Development Laboratory Tsukuba Laboratory (72) Inventor Akira Sato 1-3-22-22-37 Nukiikitamachi, Koganei-shi, Tokyo (72) Koganei civil servant housing (72) Inventor Michio Ohba 5-4-12-1103 Hakozaki, Higashi-ku, Fukuoka-shi, Fukuoka (72) Hidenori Iwahana, Noga 1521-44 Tanimachi

Claims (16)

[Claims] 1. An insecticidal protein for the larvae of Coleoptera insects, which has the amino acid sequence of SEQ ID NO: 1. 2. A DNA containing a nucleotide sequence encoding an insecticidal protein for larvae of Coleoptera insects, which has the amino acid sequence of SEQ ID NO: 1. 3. A plasmid having the nucleotide sequence of the DNA according to claim 2 and expressed in a host bacterium. 4. The plasmid according to claim 3, wherein the host bacterium is selected from the group consisting of Escherichia coli, Pseudomonas, and Bacillus thuringiensis. 5. A microorganism having the plasmid according to claim 3 and producing the insecticidal protein. 6. An insecticide containing the insecticidal protein according to claim 1 as an active ingredient. 7. A mutant insecticidal protein for larvae of Coleoptera, which has the amino acid sequence of SEQ ID NO: 2. 8. The amino acid sequence of SEQ ID NO: 1, comprising the N-terminal to the 53rd amino acid and the 705th amino acid.
A mutant DNA containing a nucleotide sequence encoding an amino acid sequence modified by deleting an amino acid from the number C to the C-terminus. 9. A plasmid having the nucleotide sequence of the mutant DNA according to claim 8 and expressed in a host bacterium. 10. The plasmid according to claim 9, wherein the host bacterium is selected from the group consisting of Escherichia coli, Pseudomonas, and Bacillus thuringiensis. 11. A microorganism having the plasmid according to claim 9 and producing the mutant insecticidal protein according to claim 7. 12. An insecticide, wherein the active ingredient is a mutant insecticidal protein produced by the microorganism according to claim 11. 13. An insecticide, wherein the active ingredient contains the microorganism according to claim 11 together with the mutant insecticidal protein. 14. An insecticide obtained by killing the microorganism according to claim 11, wherein the active ingredient contains the mutant insecticidal protein. 15. A recombinant plant into which the DNA according to claim 2 has been introduced. 16. A recombinant plant into which the DNA according to claim 8 has been introduced.