JPH06506603A - single stranded circular oligonucleotide - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] single stranded circular oligonucleotide This application is filed in U.S. Patent Application No. 675,843, filed on March 27, 1991. This is a partial continuation application. Additionally, the subject matter of this appearance is a U.S. patent issued on September 5, 1989. Disclosure Document number 2 received by the Trademark Office 34794.

The present invention applies to the National In5 positions of Heal With the support of the United States Government under Grand Number GM-46625 granted by It was done. The US government has a fixed amount of $1ff41 for 2 inventions.

Technical field The present invention is capable of binding to targeted DNA or RNA, thereby facilitating DNA replication.

A single-stranded ring that can coordinate RNA transcription, protein translation, and other processes including nucleic acid templating. oligonucleotides. Moreover, cyclic oligonucleotides can labeled for use as a probe to detect or isolate nucleic acids. ring oligonucleotides can also be used to form double helix nucleic acids without prior denaturation of the double helix. One chain can be made a length. Moreover, cyclic oligonucleotides and higher selectivity than linear oligonucleotides. Bind to target with affinity.

Background technology Oligonucleotides have hydrogen bonds between the bases of the target and the oligonucleotide. It binds to the target nucleic acid by forming . Ordinary B DNA is Conventional adenine-thymine (A-Tl and guar) with two and three hydrogen bonds Has nin-cytosine (GC) Watson and Crick base pairing. traditional hive Lid technology binds to the target nucleic acid via Watson-Crick hydrogen bonding. Based on the ability of sequence-specific DNA or RNA probes to Atoms of the base that are not included in the base pair form hydrogen bonds to other nucleotides. to form the T-TA base triat. Hoogsteen (1959゜ Acta Crystallography 12:822) was the first T-A The alternating hydrogen bonds present in T and C-(1;C) rearad were described. Even more Recently, the G-TA base triat, which can hydrogen bond with thymine centered on guanine, has been observed. (Griffin et al., 1989.5science 245:967-971 >.

If the oligonucleotide has both Watson-Crick and alternating hydrogen bonds, If they can bind to their targets, they may have a variety of in vivo and in vitro utilities. A very stable complex would be formed, but to date, It is necessary to achieve a stable target bond by both toson-click and alternating hydrogen bonds. There is no disclosure of oligonucleotides with the necessary structural features.

Oligonucleotides bind in vivo through non-Watson-Crick hydrogen bonds For example, Cooney et al., 1988.5science2 41:456 is 2 bound to a double-stranded nucleic acid via a non-Watson-Crick hydrogen bond. A 7 base-woody nucleic acid is described. However, this type of double-stranded complex The oligonucleotide is less stable only by alternating hydrogen bonds, i.e. all It is extremely stable because it binds to its target without the need for a one-click binding. Not.

Oligonucleotides have been used for a variety of purposes, e.g. target nucleic acids immobilized on filters or membranes or present in tissues. It can be used as a probe for Sambrook et al. (1989, Mo1 ecular Cloning: A Laboratory Manual, 1 -Volume 3, Co1d Spring Harbor Press, NY) is a high Provides a detailed review of bridging techniques.

Furthermore, we developed oligonucleotides as regulators of biological functions of cellular nucleic acids. Recently, there has been a great deal of interest in doing things. This interest controls protein expression. between the natural complementary or antisense RNA used by cells It arises from the observation that However, the origin of the in vivo regulation of biological processes is The development of oligonucleotides has been hampered by the low binding stability and linear oligonucleotide nuclei. It has been hampered by two longstanding problems, including lyase sensitivity.

For example, transcription of the c-myc gene in humans is dependent on binding to the c-myc promoter. Cell-free in vitro assay using a 27 base linear oligonucleotide designed to It is inhibited in the Ai system. Inhibition is performed at a temperature of 2 degrees (below physiological temperature) and Many cellular enzymes have been removed or inactivated through careful control. This was only observed using a well-designed in vitro assay system. these articles The problem is that linear oligonucleotides bind with low affinity and bind to linear sections of DNA. This is necessary because it is highly susceptible to the action of enzymes that break down molecules (Cooney et al.) .

Splicing of pre-mRNA transcripts essential for herpes simplex virus replication also inhibited by a linear oligonucleotide complementary to the receptor splice junction. .

In this case, the methylphosphonate linkage increases its nuclease resistance. used in linear oligonucleotides for This (hypochemical modification) to the culture medium Addition of oligonucleotides may reduce the risk of infection in non-infected animals, probably due to toxicity issues at high concentrations. resulting in decreased cell growth and protein synthesis (Smith et al., 1986, pro c.

Natl. Acad. Sci. USA 83:2787-2791).

In another example, linear oligonucleotides are used in human immunodeficient mice in cultured cells. used to inhibit virus replication. Terminal repeats of retroviral genomes A splice sequence complementary to and consisting of a part within or near a part complementary to a part of A linear oligonucleotide complementary to the site blocks viral replication. was most effective. However, these experiments are probably due to low binding stability and Because of the vulnerability of these linear oligonucleotides to lyases.

Large amounts of linear oligonucleotide were required before the effect was obtained (Goodc hi1+1 et al., +988. Proc, Natl, Acad, Sci, USA 8 5:5507-551.

Therefore, oligonucleotides useful as TJIta agents in biological processes preferably has the following properties. First, oligonucleotide 1z has its complementary binding to the target nucleic acid strongly enough to have the desired regulatory effect. No.

Second, oligonucleotides and their targets are generally sequence specific. Third, the oligonucleotide achieves its desired regulatory effect within the cell. It must have a sufficient half-life under in vivo conditions to be able to Therefore, the oligonucleotide must be treated with enzymes that degrade nucleic acids, e.g. The oligonucleotide must be resistant to clease at the mouth of the tube - wood-like and must be able to bind to a double-stranded target.

Although linear oligonucleotides can satisfy sequence specificity requirements, oligonucleotides are sensitive to nucleases and are commonly used in biological Requires chemical modification to increase the biological half-life. These modifications increases the cost of making otide and presents toxicity problems. Furthermore, Il-like Oligonucleotides are linked together to form double-stranded compounds similar to those found in cellular nucleic acids. form a plex. As a result, the cell's enzymes perform a double-stranded complex with the target. Linear oligonucleotides bound to REX can be easily manipulated and dissociated .

The low avidity and nuclease sensitivity of linear oligonucleotides is therefore high. necessitating the administration of a concentration of oligonucleotide that would make this administration toxic or Make it expensive. Moreover, linear oligonucleotides can form two molecules through alternating hydrogen bonds. Although it can bind to the target of the chain (e.g. Hoogs t<em>en binding), the il The l-shaped oligonucleotide has one strand that undergoes an i-transformation, thereby making it more stable. Easily dissociates double-stranded targets to form son-click binding patterns Can not.

Furthermore, increased avidity increases the effectiveness of regulatory oligonucleotides.

Therefore, oligonucleotides with high binding affinity can be used in lower doses. can. Lower doses lower cost and reduce toxicity.

Therefore, the present invention provides oligonucleotides and Nuclease resistant due to the circular nature of the main and their targeted nucleus A single-stranded circular oligonucleotide that binds to acids with strong affinity and high selectivity. provide. Furthermore, the cyclic oligonucleotide of the present invention has a structure in front of its target. It can dissociate and bind to double-stranded targets without inherent denaturation.

Types of single-stranded circles of DNA or RNA are known, e.g. The structure of the genomes of natural viruses and bacteriophages is - a circular core of heavy chains. It is an acid. Single-stranded circular forms of DNA are described by Erle et al. (1987, Bio(lle mistry　26:7150-7159 and 1989, Biochemist ry 28°268-2731. However, these None of the circular molecules are designed to bind to the target nucleic acid. .

Therefore, the present invention provides that the cyclic oligonucleotide of the present invention has high specificity and low Toxic or burning poison and exhibits higher nuclease resistance than linear oligonucleotides. On the other hand, single-stranded or double-stranded oligonucleotides are stronger than conventional linear oligonucleotides. The technology features substantial improvements over conventional techniques for binding to target nucleic acids. Show innovation.

Summary of the invention The present invention provides at least one parallel binding (P) domain and at least 1 inverse It has a parallel linkage (AP) l' main and further forms a circular oligonucleotide. A single-stranded circular oligonucleotide with a loop domain between each binding domain for provide a code. Each P and core AP domain is A P domain that binds and an AP domain that binds to the target in an antiparallel manner. sufficient phase to detectably bind to one strand of a limited nucleic acid target with Complementary. Sufficient complementarity is defined as sufficient complementarity to achieve stable or detectable binding. Between the P and/or AP domain of the circular oligonucleotide and the target nucleic acid To.

This means that there are a sufficient number of one-base pairs.

Another aspect of the invention is a reporter component that provides a probe for a target nucleic acid. by a child or by a drug or other pharmaceutical agent that enhances cellular nR drug delivery.

or by deletion capable of cleaving or otherwise modifying the target nucleic acid; Agents capable of uptake of oligonucleotides into cells or binding of targets provides a derivatized single-stranded circular oligonucleotide.

Another aspect of the invention provides a solid support for the isolation of nucleic acids complementary to oligonucleotides. A single stranded circular oligonucleotide attached to a carrier is provided.

Another aspect of the invention provides any one of the cyclic oligonucleotides of the invention. For the detection or diagnosis of target nucleic acids containing only one first container. Compartmentalization kits are provided.

Yet another aspect of the present invention! 1! provides a method for detecting target nucleic acids, and is sufficient time for the oligonucleotide-target complex to form. and a sample containing a target nucleic acid and a single-stranded circular oligonucleotide under This detection method involves contacting a fluorescent substance and detecting a complex. It is carried out by light energy transfer.

Other LI of the present invention! provides methods for regulating DNA, RNA or protein biosynthesis. provide This method involves injecting oligonucleotides into the target sequence contained in type 5gI. The nucleic acid template and the present invention are interposed between DNA, RNA or protein under conditions sufficient to effect binding. Contact one with a small number of bright circular oligonucleotides and then move to the target. binds the oligonucleotide and blocks access to the template, thereby blocking the DNA , including regulating RNA or protein biosynthesis.

The additional US of the invention comprises a biosynthetically regulated amount of at least one cyclic oligonucleotide of the invention. for regulating the biosynthesis of nucleic acids or proteins containing cleotide and a pharmaceutically acceptable carrier. Provided are pharmaceutical compositions for

Another aspect of the present invention provides a method for producing a single #AIJI-like oligonucleotide. which connects the linear precircle to the end-linked oligonucleotide. the two ends of the precyclic and the circular oligonucleotide Including harvesting the otide product.

Another embodiment of the invention is to denature the target and attach the cyclic oligonucleotide. Any one of the cyclic oligonucleotides of the invention for a time and under conditions effective to Strand positioning in a double M nucleic acid target by contacting the target with Provide an exchange method.

Brief description of the drawing Figure IA shows the binding pattern of Watson-Crick (antiparallel domain) AT and GC base pairs. 9 Figure IB drawing a turn can be formed between P, target and AP nucleotides. Draw the T-AT, C+GC and G-TA salt base triatodes.

Figure 2 schematically depicts the circularization reaction for the synthesis of single-stranded circular oligonucleotides. The linear precircular oligonucleotide is an oligonucleotide with the same sequence as the target. oligonucleotides, or end-linked oligonucleotides, to form a precircular complex. form a thicket. After the ligation reaction, the circularized oligonucleotide is attached to the end-linked oligonucleotide. separated from oligonucleotides.

Figure 3 shows the linear precursor to the cyclic oligonucleotide described in the Examples, i.e. the pre-cyclic (SEQ ID NO: 5, SEQ TD NO: 6 and SEQ ID NO: 0 1-3) with near, ';'-get (SEQ ID NO:8 and 5EQ 4, 5) with ID NO: 9, cyclic oligonucleotide (SEQ ID N 6,7.8) and linear oligos with O:5-7 and SEQ ID NO:14 Nucleotides (SEQ ID No: 10-13 and SEQ ID No: 1 Draw the arrays 9-12 and 14) with 5.

Figure 4 shows the line complexed with end-linked oligonucleotides before ligation reaction. Draw the structure of the precyclic object (.

Figure 5 shows the cyclic oligonucleotide:target combination measured by Tm. The black circles depict the effect of pH on complex formation; The black squares represent the stability of the 7:5 complex. The sequences of circular oligonucleotides 6 and 7 and targets 4 and 5 are depicted in Figure 1. is expressed in

Figure 6A shows two targets: a simple (dA)+2 target (square) and a 3 Comparison between binding to 6 nucleic acid oligonucleotide targets (circles) and Figure 6B depicts the effect of loop size on plex formation. Figure 3 depicts the effect of target and binding domain length on gas formation.

Figure 7 shows the target and circular oligomers in which the P and AP binding domains are misaligned on the target. Draw the complex formed between the oligonucleotide.

Figure 8 shows a linear oligonucleotide having SEQ ID NO: 8. ) or a cyclic oligonucleotide having SEQ ID NO: 5 (solid line) fluorescently labeled double-stranded target (SEQ ID NO: II Draw the displacement of one strand of the It was measured by the increase in Sein fluorescence intensity (Y axis).

Figure 9 shows the double helix target (SEQ ID NO: 5) at double concentrations. The observed pseudo-order rate constant K. 6. Draw a plot of the uncertainty in the rate constant is lower than ±10%, the curve drawn is the straight line resulting from the best fit. It is an angular hyperbola. Plot of the double reciprocal of the data, i.e. [cyclic oligonucleotide 1 -1 pair (K)I is linear, 8.95XlO-6 s M-1 slo bs -b and y-intercept of 39.8 seconds.

Detailed description of the invention The present invention relates to - heavy chain cyclic oligonucleotides, i.e. cyclics, which correspond to Binds to nucleic acid targets with higher affinity and selectivity than linear oligonucleotides Wear. Moreover, one of the circular products of the invention opens and binds two strands of a double-stranded nucleic acid. - Both heavy and double-stranded nucleic acids are combined with the circular oligonucleotides of the present invention. be the target of a join by a command.

Furthermore, there is a strong preference for either single-stranded or double-stranded targeting of these cyclics. binding is important in biological processes such as DNA replication, RNA transcription, RNA splicing, etc. It offers a variety of applications including methods for regulating protein synthesis and processing, protein translation, etc. flood Similarly, double-stranded nucleic acids can be dissociated and selectively and stably bound to target nucleic acids. The ability of these rings to combine makes them useful as diagnostic probes or for example in staining. It is buried as a marker that localizes to a specific part of the DNA or RNA molecule of the color body or pond. make it a blessing. Furthermore, the circular product of the present invention can be used for isolation of complementary nucleic acids or for introduction into cells. are useful for sequence-specific delivery of pharmaceuticals or other molecules.

In particular, the single-stranded cyclic oligonucleotides of the invention contain at least one parallel linkage ( It has a PJ domain and at least an antiparallel binding (AP) domain of IN. has a loop domain between each binding domain, and a circular oligonucleotide is formed. Furthermore, each P and AP domain binds to the target in a parallel manner. Limited by a P domain and an AP domain that binds to the target in an antiparallel manner indicates sufficient complementarity to bind to one strand of a given nucleic acid target.

The schematic description given below combines five targets (denoted below as T). One set of P and AP oligonucleotide domains to each other as in shows an annular arrangement of.

1－－－－－－－－－＝＝＝＝＞ 5′ −−−==============>−−−−−3’P <============= Arrows indicate the 5° to 3° orientation of each strand, with the 5′ end of each domain at the tail; The 3゛ end is at the arrowhead. Therefore, as used herein, nucleic acids in a parallel manner The binding of the 5° to 3° orientation is the same for the volume of the complex or It means that they are the same. This is the connection that exists between the target and the P domain. This is the type of case. As used herein, binding of nucleic acids in an antiparallel manner refers to The 5′ to 3′ orientation of the two strands or nucleotides in the complex are in opposite directions. It's across the street. That is, the typical Watson-Crick base pair arrangement of double helix DNA strands. means that they are aligned as found in

When more than one P or AP binding domain is present, these binding domains are by a loop domain whose length is sufficient to perform binding to multiple targets. It is separated from other P and AP domains. Furthermore, AP and P with a large number of cyclic objects When having a domain, the corresponding target need not be a single strand of nucleic acid. Moreover, the loop domain of the cyclic oligonucleotide bound to the target consisting of The second target is activated when the circular oligonucleotide leaves the first target. AP or P domain for binding to the target.

According to the invention, the nucleotide sequences of the P and AP domains are shown below: Base pairing rules allow determination of nucleic acid targets from a limited sequence. target The strands can be either single-stranded or double-stranded, and have their well-known functional and structural properties. A preferred target consisting of, for example, one chosen according to the characteristics, is a coding region , origin of replication, reverse transcriptase binding site, transcriptional v4n element, RNA splicing linkage or a liposome binding site. Target can also be DNA or RNA The choice can be made based on its ability to detect or isolate the template. The preferred target is Rich in the 2 purines, adenine and guanine.

The nucleotide sequence of the target DNA or RNA is fully or partially known. ing. When the target nucleotide sequence is completely known, the P and AP The main sequence is detected by well-known methods, e.g. by a change in optical absorption or fluorescence. be designed with the necessary degree of complementarity to achieve such binding. In the example , the target sequence is represented by a consensus sequence or is only partially known. 6 For example, all classes of targets represented by consensus sequences A circular oligonucleotide (circular substance) that binds to the target consensus sequence This can be provided by designing P and AP domains from columns. In this case , the target consists of an exact match to the consensus sequence and other has double mismatched bases, but with enough mismatches to prevent binding Similarly, if part of the target sequence is known, one skilled in the art can higher affinity than linear oligonucleotides with sequences comparable to those of As shown below, design a ring that binds to its target with You can refer to base pairing rules.

Therefore, the present invention provides for a sufficient number, but not necessarily all, of the five-pronged P and AP domains. If there is a nucleotide position in the target sequence according to the base pairing rules of the present invention, have P and AP domains that bind fully complementary to the nucleic acid target determined from the Between the circular objects. The determined (i.e., known) number of positions l is their targets as detected by standard methods including changes in optical absorption; in the number of positions needed to provide sufficient complementarity for the binding of the oligonucleotide to be.

The base pairing rules of the invention combine the P domain with the target nucleotide. to the target by forming base pairs with the same 5° to 3° orientation. Make it join. In particular, these rules apply to cyclic oligomers that satisfies the degree of complementarity necessary to achieve binding of the oligonucleotides, i.e. The degree does not have to be 100% as long as binding is detectable, therefore the P domain The general criteria for determining the sequence of is as follows.

When the base between the positions in the target is guanine or a guanine analog.

P has a cytosine or a suitable analog thereof in the corresponding position.

When the base between the positions in the target is adenine or an adenine analog.

P has a corresponding thymine or uracil or a suitable analog thereof.

When the intervening base in the target is thymine or a thymine analog, P is It has a cytosine or guanine or a suitable analog thereof in the corresponding position.

When the base between position l in the target is cytosine or a cytosine analog, P has cytosine, thymine or uracil or a suitable analog thereof in the corresponding position do. and When the base between the positions in the target is uracil or a uracil analog.

P is cytosine, guanine, thymine or uracil or a suitable amine thereof at the corresponding position. Has analog.

The base pairing rule-IJ of the present invention is defined as an AP domain and a target nucleus. into the target by forming base pairs in which the cleotides are oriented in opposite directions. Make this connection. In particular, these rules apply to circular oligomers to their nucleic acid targets. Immediately satisfied to the extent necessary to achieve detectable binding of the oligonucleotide. The degree of complementarity is less than 100%, so the base pairing rules are Achieve sufficient complementarity for binding between a nucleotide and its target to be detected. Persistent only as long as it is necessary to accomplish.

Therefore, the general rules for determining the sequence of AP domains are as follows.

When the base between position l in the target is guanine or a guanine analog.

The AP has a cytosine or uracil or a suitable analog thereof in the corresponding position.

When the base between the positions in the target is adenine or an adenine analog.

AP has thymine or uracil or a suitable analog thereof in the corresponding position.

When the base between the positions in the target is thymine or a thymine analog, AP has an adenine or a suitable analog thereof in the corresponding position. and target When the base between the middle positions is cytosine or a cytosine analog.

AP has guanine or a suitable analog thereof in the corresponding position.

When the base between the positions in the target is uracil or a uracil analog, The AP has an adenine or guanine or a suitable analog thereof in the corresponding position.

In preferred embodiments, the P, AP and loop domains are not complementary to each other.

Table 1 shows which nucleotides are antiparallel to the limited target nucleotide. It summarizes whether paired or parallel base pairs can be formed.

a or suitable analogue Two complementary mononucleotide nucleic acids are immediately combined in a typical Watson-Chrysler fashion. That is, when they combine or hybridize with each other through antiparallel GC and AT base pairs, they become stable. The present invention has a stable double helix shape. The formation and stable triple helix formation is due to the P and AP domains forming a cyclic oligonucleotide. to the target sequence to achieve stable binding between the compound and the target molecule. This is achieved when sufficient complementarity is exhibited. Stable binding requires oligonucleotides. occurs when it remains detectably bound to the target under the required conditions.

Complementarity between nucleic acids is defined as hydrogen bonding or is the degree of base pairing. Therefore, complementarity is sometimes referred to as two mirror openings or two The percentage of nucleotides that base pair within a particular region or domain of a book chain. According to the present invention, sufficient complementarity means a detectable binding. A sufficient number of base pairs are present between the target nucleic acid and the circular oligonucleotide to achieve conjugation. It means that it exists between the P and/or AP domain of Otide. On top of that, Complementarity between P domain and target and between AP domain and target The degree of The degree of complementarity varies from approximately 30-40% complementarity to full Complementarity spans, generally the sum of complementarity between the P or AP domain and the target The degree of is preferably at least about 50%. However, when the P domain has lower complementarity with the target than the AP domain has with the target. , for example, the P domain has about 30% complementarity with the target, whereas the AP domain can have substantially more complementarity, e.g. 50-100% complementarity. .

Furthermore, the detection between cyclic oligonucleotides and their respective targets The degree of complementarity that results in possible binding depends on the conditions under which the binding occurs. nucleic acid The mirror-opening combination, or hybridization, of It is well known that it depends on factors. These factors include the GC content of the region. including amount, temperature, ionic power, presence of formamide and type of counterion present. , the effect these conditions have on binding is well known to those skilled in the art. One more condition.

For example, when a cyclic oligonucleotide is When made for use within, formaldehyde is not present and ionic forces , type of counterion and temperature correspond to physiological conditions. Binding conditions are in vitro to optimize the utility of the oligonucleotides of the invention. under desired conditions Established binding conditions for which one skilled in the art will design the appropriate oligonucleotide to be used. A thorough treatment of the quantitative and qualitative matters involved in , Methods Enzymol, 100:266-285 and Sa Provided by mbrook et al.

Accordingly, one skilled in the art would appreciate the ability to detectably bind to the target sequence in accordance with the present invention. Nuclei for the P and AP domains of the cyclic oligonucleotide exhibiting sufficient complementarity to As used herein, "combined" or “Stable binding” means that a sufficient amount of oligonucleotide binds to its target immediately. This means that they hybridize and the combination can be detected. join target : to either the physical or functional properties of the cyclic oligonucleotide complex. more detectable.

The bond between the target and the oligonucleotide can be both physical or functional. It can be detected by any method known to those skilled in the art, including binding assays. A bond is a bond. ii for biosynthetic processes such as DNA replication, RNA transcription, protein translation, etc. Inspection It can be detected functionally by determining whether it has a possible effect.

Physical methods for detecting binding of complementary strands of DNA or RNA are well known to those skilled in the art. Yes, and DNase I or chemical footprinting, gel shift and affinity For example, methods such as cleavage assays and optical absorption detection methods are A reliable and widely used method is that as the temperature gradually increases, Light of solution containing oligonucleotide and target nucleic acid at 0-300 am including observing changes in absorption if the oligonucleotide binds to its target. If so, the oligonucleotide and target may dissociate or melt. There is a sharp increase in absorption at characteristic temperatures.

The bond between the oligonucleotide and its target nucleic acid is is often characterized by a temperature at which 50% of the target melts from the target. This temperature is , the melting temperature (T), the higher T is complex with the lower Tm m It means a complex that is stronger or more stable than the base. double helix Regarding stability, A:T base pair has two hydrogen bonds, while G:C base pair has three. Since the hydrogen bond of the present invention increases with increasing G:C content, Ligonucleotides provide additional hydrogen bonds and are therefore more stable.

That is, the binding domain of 2fl targets a single target nucleic acid, namely the P domain and the AP This is because it can be used to bind to domains. Therefore, the target nucleic acid The triple helix formed by the linked cyclic oligonucleotides is similar to the linear oligonucleotide. It melts at a higher Tm than the double helix formed by the nucleotide and the target. There must be.

The cyclic oligonucleotide has a link between the nucleotide of the binding domain and the target. Binds to the nucleic acid target via hydrogen bonds formed. AP domain is Watso The P domain can bind by forming a click hydrogen bond (Fig. 1). , targeting nucleotides by forming non-Watson-Crick hydrogen bonds. (e.g. Figure 1 and Table 11. Two molecules from different strands of DNA or RNA When the nucleotides of are hydrogen bonded according to the base pairing rules defined here, one group A pair or double helix is formed. Nucleotides from AP and nucleos from P When both tides bind to the same target nucleotide, the base triat It is formed.

Parallel domain base pairing with the complementary chain of a nucleic acid is Watson-Crick base pairing. Although thermodynamically less favorable, both the parallel and antiparallel pairs of modes are single When present in molecules of 2, a very stable complex can be formed. Therefore.

The two opposing domains of the circular oligomer complex with the central target. by forming a triple helical structure, or by the two looped ends of the annulus. For example, this arrangement yields a coupled triple helix complex. When min binds to the target adenine, it allows the formation of up to four hydrogen bonds, When two cytosines bind to the target guanine, up to five hydrogen bonds allow the meeting.

Additionally, due to the binding properties of the P and AP domains, the cyclic oligonucleotides of the present invention oligonucleotides are more sensitive to specific targets than the corresponding linear oligonucleotides Has selectivity. At least two factors contribute to this high selectivity. Ru. First, the cyclic oligonucleotides of the present invention have dual binding to the same central target strand. do. Therefore, two domains are included in selecting the target. , the protonation of cytosine in the C+G-C triat is caused by the formation of this triat. And it is preferred only when the additional proton gives a positive charge to the triand.

This positive charge is the opposite of the negative charge resulting from the linkage of the three phosphodiester backbones. lowers the rate of development.

Unlike linear oligonucleotides, the circular oligonucleotides of the present invention are different from linear oligonucleotides.

Denaturation of the double-stranded target occurs under thermodynamically unfavorable conditions. One strand of the chain can be replaced. Linear oligonucleotides ff strands of a double helix For example, in the presence of a complementary linear oligonucleotide, The half-life of the double-stranded target is approximately 58 minutes, i.e., at that length, the linear Gonucleotides have little utility in displacing one strand of a double helix target. However, the double-stranded target does not have the presence of a cyclic oligonucleotide of the present invention. In Japan, it has a half-life of 30 seconds. Therefore, 1. the cyclic oligonucleotide of the present invention. Do is.

- Useful for binding not only heavy chain targets but also double chain targets have sex. Therefore, - both heavy and double stranded nucleic acids are present in the circular oligonucleotides of the invention. These cyclic oligonucleotides can be used as targets for leotide. can have greater utility than linear oligonucleotides, e.g. The cyclic oligonucleotide of the present invention can be produced from a corresponding linear oligonucleotide. better regulators of biological processes in the body and better diagnostic tools in vitro. It's a robe.

The nucleic acid template extends beyond the central double-stranded target:circle complex. When the P or AP domain forms a double helix at any point in the double-stranded complex, Can be combined as Therefore, target: cyclic oligonucleotide complex. The chain is partly double-stranded and partly triple-stranded, but the double-stranded part is the bonded A P without P nucleotide: target duplex or attached P nucleotide AP without leotide: target double helix. The placement of this bond is This is a gar bond arrangement.

Each P domain, AP domain and target independently has about 2 to about 200 nucleotides, with a preferred length of about 4 to about 100 nucleotides. . The most preferred length is 6-36 nucleotides.

The P and AP domains are independently structured groups having from about 2 to about 200 nucleotides. separated by a domain. The preferred loop length is about 3 to about 8 loops. nucleotides, with a particularly preferred length of about 5 nucleotides.

According to the invention, the loop domain need not consist of nucleotide bases.

Non-nucleotide loops are inexpensive to generate circular oligonucleotides of the present invention. can do. More strikingly, cyclic oligos with non-nucleotide loops Ligonucleotides are more resistant to nucleases and therefore linear Has a longer biological half-life than oligonucleotides. Moreover, uncharged or positive A loop with a charge of 2 eliminates the negative charge repulsion between the loop and the target. It can be used to promote bonding by Furthermore, uncharged or hydrophobic Circular oligonucleotides with non-nucleotides have nucleotide loops. Cyclic oligonucleotides can penetrate cell membranes.

As contemplated here, non-nucleotide loop domains are As long as it has the necessary stericity or flexibility that does not inhibit the synthesis of Consisting of tyrene glycol or oligoethylene chains or other chains. the length of these chains is equal to about 2 to about 2000 nucleotides, with a preferred length of about 3 to about 8 The most preferred length of these chains is approximately 5 nucleotides. Equal to punch line.

Preferred chains for non-nucleotide loop domains are polyethylene glycol Or an oligoethylene glycol chain. In particular, a chain with the same length as 5 nucleotides oligoethylene glycol chains such as pentaethylene glycol, hexaethylene glycol, etc. Saethylene glycol or heptaethylene glycol is preferred.

Cyclic oligonucleotides contain the bases guanine (G) and adduct in their nucleotides. has nin (A), thymine (T), cytosine (C) or uracil (U), or has any nucleotide analog that hydrogen bonds in a parallel or antiparallel manner. Single-stranded DNA or RNA. Nucleotide analog is pseudocytidine , inshaded cytidine, 3-aminophenyl-imidazole, 2'-〇-methy Ruadenosine, 7-diazaadenosine, 7-diazaguanosine, 4-acetyl Cytidine, 5-(carboxy-hydroxymethyl)-uridine, 2'-0-methane Tylcytidine, 5-carboxymethylamine methyl-2-thiolidine, 5-cal Boxymethylamino-methyluridine, dihydrouridine, 2゛-O-methyluridine Lysine, 2°-〇-methyl-shooturidine, beta, D-galactosylthio Syn, 2-0-methylguanosine, inosine, N6-inpentenyl adenosine ■-methyladenosine, l-methyl-pseudouridine, l-methylguano Syn2　-Methylinosine, 2,2-dimethylguanosine, 2-methyladeno Syn, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, 5- Methyluridine, N6-methyl-adenosine, 7-methylguanosine, 5-methy lyaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, β- Ri-mannosylkeosin, 5-methoxycarbonylmethyluridine, 5-methoxy Ciuridine, 2-methyl-thio-N6-inpentenyladenosine, N-(9- beta-D-ribofuranosyl-2-methylthiopurin-6-yl)-rupamoi ) threonine, N-(9-beta〇-ribofuranosylpurin-6-yl)- containing (N-methylcarbamoyl)threonine, preferably ribose or Any of silibose can be used with these analogs. a-gamma-like The nucleotide bases in the conformation can also be used in the cyclic oligonucleotides of the invention. Wear.

Preferred nucleotide analogs are unmodified G, A, T, C and U nucleotides, Lower alkyl, lower alkoxy, lower alkylamine, phenyl or is a pyrimidine analog with a lower alkyl substituted phenyl group and a base 7 or 8 It is a purine analog having a similar group at the position. Particularly preferred nucleotide analogs 5-methylcytosine, 5-methyluracil, diaminopurine, and lipo Nucleotides with 2′-O-methyl lipose moieties instead of deoxyribose or deoxyribose It's a punch line. As used herein, lower alkyl, lower alkoxy and lower Alkylamines have 1-6 carbon atoms and can be straight or branched. These groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl 2nd Preferred alkyl groups are methyl, including tertiary butyl, amyl, hexyl, etc. Ru.

Cyclic oligonucleotides are first made as linear oligonucleotides and then circular The 1wA-like oligonucleotide to be made into a DNA or RNA oligonucleotide 5, which can be made by any of the numerous methods known to make .

These methods include enzymatic and chemical synthesis.

Enzymatic methods of DNA oligonucleotide synthesis. As described in Sambrook et al. Like Kl now, T7. Taq or E, col 1 DNA polymerase often used. An enzymatic method of RNA oligonucleotide synthesis is Samb Often SP6, T3 or T7 RNA polymerases as described in Rook et al. Use often. Reverse transcriptase can also be used to synthesize DNA from RNA (S ambrook et al.), the enzymatic production of oligonucleotides is a chemical Synthesized or mRNA, genomic DNA, cloned genomic DNA, cloned Requires a template nucleic acid obtained as a recombinant cDNA or other recombinant DNA. DNA combination The enzymatic method of synthesis involves the use of additional brimer oligonucleotides that can be synthesized chemically. Requires a code. Finally, linear oligonucleotides can be used such as one such as '3Biki et al. 1988.5science 239:487. It can be manufactured by

Chemical synthesis of linear oligonucleotides is well known to those skilled in the art and can be carried out in liquid phase or This can be achieved by solid phase technology. Moreover, linear oligonucleotides of limited sequence are commercially available or generally by automated synthetic methods. Ito, phosphite triester, H-phosphonate and phosphotriester process 0 selected synthetic methods that can be produced by one of the different synthetic methods including depends on the desired oligonucleotide length, and this selection is within the skill of those skilled in the art. For example, phosphoramidites and phosphite triesters within the scope of technology. The method produces oligonucleotides with 1.75 or more nucleotides, but , H-phosphonate method is used for oligonucleotides of less than 100 nucleotides. Works well in conjunction with the oligonucleotide, if modified bases are not inserted into the oligonucleotide. and especially if modified phosphodiester linkages are used. The formulation method may be varied as necessary in a well known manner. Between these two, Uh 1m Ann et al. (1990, Chemical Reviews 90:543-58 4) is an oligonucleotide with a modified base and a modified phosphodiester bond. Literature and general methods of making cleotides are provided.

Synthetic linear oligonucleotides by polyacrylamide gel electrophoresis.

or a number of chromatographic techniques including gel chromatography and high performance liquid chromatography. It can be purified by 1,000 different matoographic methods. Confirm nucleotide sequence In order to Sanget array method 1 Well-known methods including capillary electrophoresis array method and moving spot array method oligonucleotides attached to ybond paper (or) can be subjected to DNA sequencing methods by using selective chemical degradation of . short cage The sequence of the oligonucleotides can also be determined by serum desorption mass spectroscopy or by fast atom bombardment. fMcNeal et al., +982. J, Am, Chem, Soc, 1 04:976, Viari et al. +987. Biomed, Environ, M assSoectrom, 14:83. Grotjahn et al., 1982, Nuc , Ac1d Res, IO:46711. The sequencing method also uses RNA oligonucleotides. Available for

The present invention provides a method for producing cyclic oligonucleotides from 1wA-like precursors (i.e., pre-circulars). 2 provides a unique method in which the precycle is synthesized and the end-linked oligonucleotide is The oligomers are linked to the leotide and further include a method in which the two ends of the precycle are linked. Any method in which the two ends of a nucleotide are joined is encompassed by the present invention, and is , for example, well-known coupling agents such as BrCN, N-cyanoimidazole, Zn Cl2, l-ethyl-3-(3-dimethylaminopropyl)carbodiimide and including chemical methods using other carbodiimides and carbonyldiimidazole .

Furthermore, the ends of the procyclics can be either 5° phosphate and 3° hydroxy, or 5° Bonding can be achieved by condensing hydroxy and 3° phosphate.

According to the present invention, *a simple one-step chemical method is provided, in which a cyclic oligo Construct nucleotides or circles. target nucleic acid i.e. end-linked oligonucleotide An oligonucleotide having the same sequence as Otide is constructed. DNA or RNA Linear linear cyclics are synthesized chemically or enzymatically and again chemically or enzymatically. The 5' or 3' end is phosphorylated by any means. Precyclics and terminal connections The oligonucleotides are mixed and annealed, thereby forming a precircular The 5° and 3° ends of form an adjacent complex as depicted in Figure 2. do. The end of the procycle is within the binding domain and preferably flat rather than within the loop. Preferably within the antiparallel binding domain rather than the row domain; It is preferred that the cyclics have a 3'-phosphate rather than a 5'-phosphate. After the formation of a new complex, the terminal is exposed to divalent metal ions and at a pH of about 7.0. In a preferred embodiment, the condensation reaction is carried out in a buffered aqueous solution containing BrCN. The agent is imidasol-C1 at pH 7.0 and contains divalent metals such as Ni, Zn, Mn or CO. Ni is the most preferred divalent metal. ii is 4- This occurs after about 6-48 hours of incubation at 37°C. Examples of other divalent metals For example, Cu, Pb, Ca and Mg can also be used.

One method of RNA circularization is preferably to promote self-splicing. inserts the appropriate nucleotide sequence into the RNA oligonucleotide in the loop domain. Enter. This is because a cyclic product is formed under appropriate conditions (Sug Imoto et al., 1988, Biochemistry 27:6384-639 2).

Enzymatic closure of the rings can be achieved by DNA ligase or under conditions appropriate for these enzymes. This is possible using RNA ligase.

Circular oligonucleotides are subjected to denaturing gel electrophoresis or melting, followed by gel electrophoresis, Size selective chromatography or other suitable chromatography or electrophoresis It can be separated from the mold using the dynamic method. One cyclic oligonucleotide was collected. used in the disclosed method, it can be further purified if necessary by standard techniques.

The present invention also provides for the use of chemical groups to facilitate uptake into cells. 1, including derivatization or chemical modification of oligonucleotides, e.g. Covalent attachment of cholesterol moieties to tide improves cellular uptake by 5-10 times. , further improving DNA binding by a factor of approximately 1O (Boutorin et al., 1989, FE BS Letters 254°129-1321. Other links between cell receptors Gand also modifies cellular uptake, including for example insulin, transferrin, etc. It has good utility. Similarly, oligonucleotides with poly L-lysine Derivatization aids the uptake of oligonucleotides by 2 cells (Schell, 1974, Biocbem, Biophys, Acta 340:323 and L amaitre et al., 1987, Proc, Natl, Acad, Sci, USA 84:6481, the protein carrier also facilitates cellular uptake of oligonucleotides. e.g. serum albumin, nuclear proteins with signals for transport to the nucleus, and Protein carriers contain viral or bacterial proteins that are capable of penetrating cell membranes. Useful when used together or in conjunction with the cyclic oligonucleotides of the invention. Therefore 1 The present invention provides that the cyclic oligosaccharides of the present invention with groups capable of promoting uptake of NJ vesicles Contains derivatized t*I atoms of nucleotides, which include hydrocarbons and non-polar groups, cholesterol role, poly L-lysine and protein, and other aryl or steroid groups and Polycations with similar beneficial effects, such as phenyl or naphthyl groups, quinoli anthracene, anthracene or phenanthracene groups, fatty acids, fatty alcohols and Including kiterpenes, diterpenes and steroids.

The invention further provides that the target nucleic acid or other nucleic acid along with or near the target Derivatization of the oligonucleotides of the invention with agents capable of cleaving or modifying acid chains. For example, viral DNA or RNA may bind to viral DNA or A circular oligonucleotide complementary to a target nucleic acid that binds to an agent that cleaves or inactivates RNA. By administering cleotide, you can target the destruction of the cell's nucleic acids without harming them. Ru. Nucleic acid destroying agents encompassed by the present invention as having cleavage or modification activity are 5 For example, RNA and DNA nucleases, ribozymes that can cleave RNA, Doproflavin, acridine, EDTA/Fe, chloroethylamine, azidof Llhlmann et al. (1990°) containing phenacyl and phenanthroline/Cu Chemical Reviews 90:543-584) describes the cyclic Oligonucleotides adapted for use with oligonucleotides Further information on methods of derivatization and use of these agents is provided.

Cyclic oligonucleotides of the invention with groups that promote cellular uptake or target binding Derivatization of cleotides and derivatization with nucleic acid disrupting agents or drugs are within the skill of those skilled in the art. This can be done by well-known methods. For example, these groups are added to the nucleotide before synthesis of the oligonucleotide.

can be attached to the T or C 5 position, and these modified T and C nucleotides are It can be used to synthesize the cyclic oligonucleotide of the present invention. In addition, selected Nuku Reotide derivatization involves the addition of groups into selected domains of cyclic oligonucleotides. For example, if the insertion of a group into a loop does not interfere with the bond, or Inserting a group into the AP or P domain to facilitate cleavage or modification of the target nucleic acid It is preferable to do so.

According to the present invention, modification in the phosphodiester backbone of a cyclic oligonucleotide Also included. These modifications aid in the uptake of oligonucleotides by cells. For example, cyclic nucleotides can be used to increase the biological half-life of these nucleotides. If the negative charge of the phosphate within the oligonucleotide is eliminated If so, it can more easily penetrate the cell membrane. This is a negatively charged phosphorus By replacing the host oxygen with a methyl group, an amine, or by replacing the negatively charged host oxygen with a methyl group, an amine, The phosphodiester bond is phosphotri-formed by the addition of an alkyl group to the sulfate oxygen. This is done by changing the ester bond. Separately, normal phosphodiester For example, N H~P, CH2-P or S-P bonds can be formed, therefore the present invention Suphonates, phosphorothioates. Phosphorodithioate, phosphotriester and the use of phosphorus-boron bonds (S o o d et al., 1990. J, Am, C hem, Soc, ] 12:9000), the phosphodiester group is a siloxane #L can be replaced by a , carbo, -, acetamidate or thioether group.

These modifications are.

It is also possible to increase the resistance of the oligonucleotides of the invention to nucleases. Repair A method for synthesizing oligonucleotides with decorated phosphodiesters was described by Uhlmann et al. More explained.

Circular oligonucleotides with non-nucleotide loops can be made by well-known methods. For example, I) uraod et al. (1990, Nucleic Ac1ds Res, 18:6353-6359) binds non-nucleotide strands to DNA. We provide a synthetic method for These approaches generally apply to the 5th order of the cyclic oligomers of the present invention. The nature of the linear oligonucleotide precursor used to produce oligonucleotides Can be adapted to perform dynamic synthesis. Generally, in standard DNA synthesis, nucleotides are Groups reactive with tide, such as phosphoramidites, H-phosphonates, dimethoxy Trityl, monomethoxytrityl, etc. are placed at the ends of two non-nucleotide chains and their Nucleotides corresponding to the ends of the P and AP domains can be attached to it.

Additionally, different nucleotide rings can be inserted into one oligonucleotide of the invention. 1 For example, RNA oligonucleotides are : Can be used because it is more stable than DNA hybrids. Additional binding stability can also be Using 2°-0-methyl lipose in the cyclic oligonucleotides of the invention This can be provided by Phosphoramidite chemistry, as described, R Can be used to synthesize NA oligonucleotides (Reese, C, B, In Nucleic Ac1ds & Mo1ecular Biology:Sp ringer-Verlag: Berlin, +989:vol, 3. p, 16 4, and Rao et al., 1987, Tetrahedron Lett, 28:48 97).

RNA 2°-O-methyl oligoribonucleotide and DNA oligonucleotide The composition of do is different from Chinese to Chinese. RNA2'-0-methyl oligoribonucleotide by slight modification of amidite, H-phosphonate or phosphotriester methods. (Shibahara et al., 1987, Nucleic Ac1d Res, 15:4403:5hibahara et al., 1987. Nuclei c Ac1ds Res, 17°239: Anoue et al., 1987, Nucl eic Acids Res, 15:6131).

In other aspects of the invention, the circular oligonucleotide targets a double-stranded nucleic acid target. can promote dissociation. Therefore, the double-stranded nucleic acid target is one of the circular oligonucleotides of the present invention. The cyclic oligosaccharide must be subjected to denaturing conditions before nucleotide attachment; Ligonucleotides can be used under various conditions, especially under physiological conditions - heavy and double-stranded A circular oligonucleotide of the present invention capable of binding to both nucleic acid targets has the ability to It is several orders of magnitude larger than linear oligonucleotides and promotes faster double helix nucleic acid strand displacement. proceed.

The present invention therefore provides for converting one strand of a double-stranded nucleic acid target into a double-stranded nucleic acid target. with one of the cyclic oligonucleotides of the invention without the need for prior denaturation. Provides a means to imitate i. Therefore, the present invention provides a target and a cyclic oligo of the present invention. one of the nucleotides for a time and under conditions effective to denature the target. by contacting and binding the circular oligonucleotide to the target. , the circular oligomer of the present invention provides a method for strand displacement in a double-stranded nucleic acid target. The target for oligonucleotides is 5 e.g. upon exposure to heat or alkaline pH. Two strands of either RNA or DNA that are less susceptible to denaturation! I nucleic acid.

As used herein, a nucleic acid undergoing strand displacement is defined as being present in an organism, or being impure or is a pure nucleic acid specimen, such as a tissue section, a smear of prokaryotic or eukaryotic cells, or a cluster of chromosomes. present in samples containing Furthermore, one method based on the cyclic oligonucleotide of the present invention Nucleic acid targets for strand displacement include viral, bacterial, fungal or mammalian nucleic acids. include.

According to the present invention, the target is denatured by strand displacement, thereby allowing binding to take place. Effective conditions for determining the target nucleic acid ratio include the appropriate circular oligonucleotide to target nucleic acid ratio. Further, as used herein, the cyclic oligonucleotide pairs include A suitable ratio of targets is about 1 to about 100, and preferably about 1 to about 50. It is.

Furthermore, as used herein, one F! by the oligonucleotide of the present invention! 4 substitutions Two pieces! l! The effective time to denature I nucleic acids is about 1 minute to about 16 hours. be.

The cyclic oligonucleotide first forms a double helix by binding at the P domain. Can be combined with target. This P domain binding links AP domain nucleotides. and compete for Watson-Kritzke binding to the target nucleotide. This P Nucleotide of AP domain to domain pre-bond and Watson-Crick junction The competition between Il! and 1!1ffi conversion by the cyclic oligonucleotide is detected addition Forms the basis of speed.

In short, 1 the cyclic oligonucleotide of the present invention has a triple helical oligonucleotide that undergoes double helix substitution. It has two important characteristics. First, cyclic oligonucleotides have high local concentrations. It has the ability of pre-binding to produce . @Secondly, the cyclic oligonucleotide is the second (A P), which competes for binding to the complementary strand of the double helix .

Finally, cyclic oligonucleotides have higher affinity than the substituted strands of the double helix. , thereby driving the reaction toward competition.

The present invention provides both single-stranded and double-stranded targets with their selective and stable Various properties of the cyclic oligonucleotide of the present invention made possible by its unique binding properties Utilities include, but are not limited to, binding to a solid support for affinity isolation of complementary nucleic acids. The use of circular oligonucleotides of limited sequence, polymerase chain reaction (P of the oligonucleotides of the invention for providing sequence-specific stop signals during CR). Use, drug to cyclic oligonucleotide for cell-specific drug delivery, drug Covalent addition of analogs or therapeutic agents to localize and quantify complementary target nucleic acids. Labeling of cyclic oligonucleotides with a detectable reporter molecule for identification Become a bell! Attach circular oligonucleotides to cellular or viral nucleic acid templates including, but not limited to, regulating perilla-templated biosynthesis. stomach.

The cyclic oligonucleotides of the invention can be prepared on solid supports such as silica, cellulose.

Manufactures nylon, beads, filters and column chromatography resins It can be attached to other natural or synthetic materials used in These types of solids One method of attaching nucleic acids to a support is well known, and all known methods of attachment are: Included in the present invention. A cyclic oligonucleotide attached to a solid support has a 5-order phase. Can be used to isolate complementary nucleic acids. Isolation of complementary nucleic acids involves oligonucleotides : Performed by incorporating a solid support into a column for chromatography. Can be done. Other methods of isolation include oligos in a column, for example by the use of concentration means. Nucleotides: Can be done without incorporating a solid support. Cyclic oligonucleotides Creotide: The solid support can be one such as P and AP domain poly(dT) or poly( By producing circular oligonucleotides with the Ul sequence, whole cells or viruses can be isolated. It can be used to isolate poly(A) mRNA from viral RNA. cyclic oligo Nucleotides are used because they are nuclease resistant and bind strongly to target nucleic acids. in.

Ideally suited for this type of application.

Another utility lies in the invention's origin in the field of polymerase chain reaction (PCR) technology. nucleotides are available. PCR technology uses primer binding sites and A double t encoded in a nucleic acid template between two well-known nucleic acid sequences used as Methods of synthesizing II4 DNA fragments are provided. double-stranded chain Before or after manufacturing the fragment, use fiDNA fragments for $1 each. For example, it is desirable to generate a cyclic oligonucleotide of the present invention. into one of the primer binding sites or into a site between the primer binding sites. This can be done by combining.

The present invention also provides for the use of circular oligonucleotides of the present invention to direct drugs to specific cell types. This orientation, which involves the use of cleotides, allows for the selective destruction of specific cell types. For example, inhibiting the growth of tumor cells can be achieved.

Different cell types express different genes, and concentrations of specific mRNAs may differ from others. This mRNA can be higher in one cell type than in another cell type. .

Cell type by cyclic oligonucleotide attached to drug or drug analog 111 mRNA for specific drug delivery. High concentration of target mRNA cells that have a drug complementary to and covalently attached to the target mRNA Directed for drug delivery by administering cyclic oligonucleotides to cells It will be done.

The present invention also provides a circular form of the present invention for use as a probe for detecting a target nucleic acid. labeled circular oligonucleotides, including labeling oligonucleotides; Tidoprobes can be used to localize and quantify target nucleic acids in tissues, chromosomes, or mixtures of nucleic acids. It has utility in diagnostic and analytical hybrid methods for detection or detection. Book In the cyclic oligonucleotide probe of the invention, the cyclic oligonucleotide has a double-stranded core. Since one strand of acid can be replaced, the oligonucleotide of the present invention also has binding stability. In addition to increasing the Because it has two binding domains that confer great sequence selectivity (or specificity), This represents a substantial improvement over other nucleic acid probes.

Labeling of a cyclic oligonucleotide is carried out in one of the cyclic oligonucleotides of the present invention. This can be done by inserting a nucleotide bound to the r reporter molecule J. Wear. “Reporter molecules” as defined herein are cyclic oligomers due to their chemical properties. A molecule or atom that provides an identifiable signal for detection of oligonucleotides.

Detection can be done either quantitatively or qualitatively.The present invention Contains biotin, busoralen, fluorophores, chelated heavy metals and luciferin .

The most commonly used reporter molecules, including the use of commonly used reporter molecules, The reporter molecule is attached to the nucleotides used in the synthesis of the circular oligonucleotide. 1 g of bound enzyme, fluorophore or radioactive nucleide is used. Enzymes include horseradish peroxidase, alkaline phosphatase, glucose Used with certain enzymes, including oxidase and β-galactosidase. The detectably colored product is formed by the enzyme acting on the substrate. .

For example, p-nitrophenyl phosphate is an alkaline phosphatase compound. Wasabi peroxidase is suitable for use with 1,2-phenylated Diamine, 5-aminosalicylic acid or toluidine are commonly used. Generate The probes can be used, for example, in Southern analysis, Northern analysis, tissue sections or chromosomes. In situ hybridization into masses (Sq u a s h) and other analyzes and diagnostics It has utility in detecting specific DNA or RNA in cutting methods. This hybrid Methods of using coded probes are well known, and examples of this method include S. ambr.

provided by OK et al.

The cyclic oligonucleotide of the present invention has a hybrid F:1 of a probe to a target nucleic acid. It can be used in any known detection or diagnostic method based on humans. Furthermore, the present invention cyclic oligonucleotide 1, for example, a target nucleic acid present in a sample and the present invention. between the labeled tracer target for one of the oligonucleotides of Used in any hybridization to quantify target nucleic acids by competitive hybridization can. Furthermore, it may not be necessary to produce circular oligonucleotide probes. Necessary to use this probe in hybridization method! ic! 5 is a kit It is commercially available.

The kit is compartmentalized for ease of use and contains circular oligonucleotides. A small number of (and one The first container provides reagents for labeling the precycle with a reporter molecule. at least one second container containing a reagent for cyclizing the n-cycle; at least one third container and a labeled circular oligonuclease providing at least one third container; at least one tube-necked container providing reagents for isolating leotide; can be included.

Additionally, the present invention provides kits for isolation of template nucleic acids. This kit is.

A oligonucleotide that provides a circular oligonucleotide complementary to the target contained within the template. For example, the template nucleic acid may contain cellular and/or is viral poly(A)+mRNA, and the target is poly(A)+mRNA. A) Chiobe. Therefore, this book has utility in isolating poly(A) + mRNA. The cyclic oligonucleotide of the invention comprises P and AP dots of poly(dTl or poly(U)). It has a main array.

Moreover, the present invention provides useful information when diagnosis of a disease relies on the detection of specific, well-known target nucleic acids. Provide kits for These nucleic acid targets include 2 e.g. viral nucleic acids, Extra or missing chromosomes or genes, mutant cell genes or chromosomes.

It may be abnormally expressed RNA. The kit is compartmentalized and at least one first providing a cyclic oligonucleotide attached to the Coo molecule; A small (both one Contains a second container.

One aspect of the invention is to attach one or more oligonucleotides to a target sequence contained in a template. the DNA, the RNA, or the A nucleic acid template for the protein is combined with at least one circular oligonucleotide of the invention. A method for regulating the biosynthesis of DNA, RNA or protein by contacting with Offer. Binding between one or more oligonucleotides and the target is directed to the template. , thereby regulating nucleic acid or protein biosynthesis. Access to the mold Preventing proteins and nucleic acids involved in the biosynthetic process from binding to the template. That, moving along the mold or signals encoded within the mold! ! be aware prevent it from happening. Alternatively, when the template is RNA, regulation involves selective degradation of the template. For example, the cyclic oligonucleotide of the present invention can achieve The combined RNA template is susceptible to degradation by RNase H and contains selected RNases. RNase ■ (degradation of the A template) thereby inhibiting the use of the template in the biosynthetic process v4 ! Do 5.

As used herein, 5-frame acid or protein biosynthesis refers to cellular and viral processes. Processes such as DNA replication, DNA reverse transcription, RNA transcription, RNA splicing, R NA polyadenylation includes RNA transport and protein translation; they are A or a nucleic acid template that guides the production of a protein and contains a nucleic acid template at any stage of the biosynthetic process .

As used herein, regulation of biosynthesis refers to inhibiting, stopping, increasing, promoting or UI4iIB, including delays, can be direct or indirect, i.e. DNA, RNA or Protein biosynthesis involves the use of circular oligonucleotides as templates for DNA, RNA, or proteins. The biosynthesis can be directly regulated by binding the otide or the biosynthesis can be A, encodes a protein that plays a role in regulating RNA or protein biosynthesis. can be indirectly regulated by binding of the oligonucleotide to a second template.

The nucleic acid template can be RNA or DNA, and can be single-stranded or double-stranded. The circular oligonucleotide binds to only one strand of the target present in the template. However, the double-stranded template opens during the biosynthetic process2 and is therefore available for binding. Become so. Furthermore, the P domain of the cyclic oligonucleotide of the present invention has two chain target and directs the AP domain nucleotide to the target nucleotide. It is placed in a position that competes for Watson-Crick binding to the node.

DNA replication from a DNA template occurs when they open the DNA and follow the DNA template. The present invention is mediated by a protein that binds to the origin of replication and initiates DNA synthesis. binding to one or more targets at the origin of replication to inhibit DNA replication by A cyclic oligonucleotide is selected. This binding is a protein involved in DNA replication. Block the molds approaching white. Therefore, the initiation and progress of DNA replication is inhibited. be done. Another way to inhibit DNA replication is to inhibit the expression of proteins that mediate DNA replication. The present invention can be inhibited, for example, at the level of transcription or translation.

DNA replication from an RNA template also involves regions of RNA bound by nucleic acid primers. mediated by reverse transcriptase that binds to the region. Inhibits DNA replication from RNA templates In order to By attaching a gonucleotide and thereby blocking access to that site. Can block more. Furthermore, inhibition of DNA replication may be due to the presence of sites in the RNA template. generated by attaching a cyclic oligonucleotide to That is, this combination is access to that site and the downstream site, i.e. the target or binding site, to the three-dimensional site. This is because it blocks.

To initiate RNA transcription, RNA polymerase uses a specific starting point on the DNA template. Recognizes and binds to sequences or promoters. The binding of RNA polymerase is the Additional transcriptional regulatory elements that open the template, play a role in transcription, and are located on the DNA template. Elements also exist. These transcriptional mn elements include enhancer sequences, upstream activating sequences, all of this promoter and transcriptional regulatory elements, including repressor binding sites, etc. are, alone or in combination, targets of the cyclic oligonucleotides of the present invention. be. Oligonucleotides that bind to these sites gain access to the template and thereby regulating the production of RNA, especially mRNA and tRNA, e.g. increasing or decreasing can block RNA polymerase and transcription factors. Furthermore, the present invention oligonucleotides coat the vA region or 3°-untranslated region of the DNA template. region, causing premature termination of transcription. Those skilled in the art will understand that these regulatory elements from the well-known sequence of the above, from the coding region sequence and from the consensus sequence. Oligonucleotides can be easily designed for target sequences.

RNA transcription e.g. binds a circular oligonucleotide to a negative transcriptional regulatory element. or by inhibiting the biosynthesis of proteins that can suppress transcription. Wear. Negative transcriptional regulatory elements include a repressor site or an operator site. Lesser protein binds and blocks transcription. Repressor or operator part Oligonucleotides that bind to blocking the vicinity and thereby increasing transcription.

The primary RNA A transcript, or pre-mRNA, produced in eukaryotic cells serves as a precursor for protein translation. It undergoes a number of maturation processes before being transported into the cytoplasm. In the nucleus, introns Alternatively, it is removed from the pre-mRNA in a splicing reaction. 5° end of mRNA, A teeth.

1 variety that is modified to form a 5' cap structure, thereby stabilizing the mRNA. The polyadenylation of mRNA at the 3° end is important for export from the nucleus. The cyclic oligonucleotide of the present invention is believed to be related to these proteins. Can be used to block all attacks.

The pre-mRNA template splices the pre-mRNA concatenation and intron branch sequences. spliced in the nucleus by ribonucleoproteins that bind to 5゛and The consensus sequences for the 3° and 3° splice junctions and intron branch points are not known. Ru.

For example, inhibition of liponucleoprotein binding to splice junctions or inhibition of intron branch points. Covalent inhibition of the 5′ end of the intron can block splicing. Ru. Maturation of the pre-mRNA template may therefore prevent access to these sites. Accordingly, to a 5° splice connection, an intron branch point or a 3゛ splice connection Two blocks can be obtained by attaching the cyclic oligonucleotide of the present invention. Special Splicing of a given pre-mRNA template involves one or more specific pre-mRNA splices. A circular oligonucleotide with a sequence complementary to the intron branch or intron branch It can be inhibited by using In the pond embodiment, the relevant stages of the pre-mRNA template are The collection of pricing is - together with splices and introns. of circular oligonucleotides with different sequences complementary to the desired group of branchpoint sequences. This can be inhibited by using a mixture.

Polyadenyl f refers to a specific RNA endonuclease at a specific polyadenylation site. Recognition and cleavage of the pre-mRNA by clease. Next, the 3' end of the pre-mRNA is (includes the addition of the Al M moiety, so any of these steps may This can be inhibited by attaching gonucleotides to appropriate sites.

RNA transport from the nucleus to the cytoplasm of eukaryotic cells requires a poly(A) tail looks like. Therefore, a circular oligonucleotide is one designed according to the present invention. and binds to the poly(A1 tail), thereby blocking access to the poly(A1M part). inhibits RNA transport. For this oligonucleotide, P and Ap Both main components contain about 10 to about 50 thymine residues and preferably about 20 residues. Consists of base. Particularly preferred P and AP domains for this oligonucleotide. The length is about 6 to about 12 thymine residues.

Protein biosynthesis begins with the binding of liposomes to the mRNA template, followed by translation of the mRNA. ” begins with amino acid initiation and elongation. Protein biosynthesis, or translation, is Using a circular oligonucleotide of the present invention that binds to a template mRNA target One shot that can be blocked or inhibited by blocking access to the mold These targets included by Shine include the liposome binding site (Shine-De 1 ga rno sequence), 5° mRNA cap site, start codon, and protein including sites in the coding sequence and domains of nucleotide sequence homology. There are groups of proteins that do the same thing. Therefore, inhibition of protein biosynthesis between this group The cyclic oligonucleotide of the present invention is attached to a homologous protein domain (via a coating sequence). ).

Regulation of biosynthesis in any of the ways described above has utility for many applications. For example, a genetic disorder inhibits the production of mutated or overproduced proteins. or by increased production of underexpressed proteins, cell proliferation can be corrected by The expression of the gene encoding the 4n factor is inhibited and contributes to the spread of cancer. The functions that control and encode the virus are inhibited and the virus Fight infection.

What types of genetic disorders can be treated with the cyclic oligonucleotides of the invention?

Alzheimer's disease, a type of neuralgia, 1! Many conditions, including morphocytic anemia, type of viral infection can be prevented by using the cyclic oligonucleotide of the present invention. can be treated for influenza, rhinovirus, herpes simplex, babyro Mavirus, Cytomegavirus, Nibstein-eight Virus Adenovirus The present invention includes virus, vesicular stomatitis virus, rotavirus, respiratory syncytial virus, etc. According to the authors, viral infections of animals and plants can also be treated with the oligonucleotides of the present invention. It is treated by giving.

The C-myc gene is one example of a gene that plays a role in cell proliferation. C- Inhibition of myc expression is induced by a target 115 bp upstream of the c-myc transcription start site. It has been demonstrated in vitro using linear oligonucleotides (Cooney et al. 1988.5science 241:456 459), 5EQ shown below The cyclic oligonucleotide with ID NO: I and SEQ ID NO: 2 is c-myc protein at nucleotides -131 to -120 and -75 to -62, respectively. is complementary to the promoter and inhibits C-myc expression according to the invention. be made into These depictions of SEQ ID NO:1 and SEQ ID NO:2 When used in , N is any nucleotide or nucleotide analog.

``Example'' Dan J Ju ``Yudan'' look up l Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS). The cyclic oligonucleotide of the present invention is susceptible to HIV, which is a retrovirus that causes Of normal human cells that were stained? ! Replication of the virus without harmfully affecting the product. Provide a means to block. Retrovirus genomes consist of a single long transcript A portion of it is spliced to form the viral envelope protein. Generates encoding RNA. Inhibition of HIV infection is due to the large number of This can be achieved by designing oligonucleotides to bind to the region. It contains the coding region for the function of replicating the genome (i.e. po+ or inverted functions of enzymes) or functions that control gene expression (Piqe, tat, rev or other functions), but conventional Studies include splice sites, poly(A) addition signals, cap or start codon sites , and sites associated with ribosome assembly inhibit eukaryotic protein expression. This suggests that it is particularly effective for In addition, the retrovirus genome Terminal structures also contain control regions in which these structures mediate the rate of transcription and replication. In addition to encoding regions, these structures are turned around and oligonucleotides Retroviruses bind to each repeat and block access to it. is an excellent target for inhibiting

Therefore, the present invention provides that N may be any nucleotide or nucleotide analog; and Y is pyrimidine or pyrimidine analog SEQ ID NO: 3 and Two circular oligonucleotides shown in SEQ ID NO:4 are provided.

SEQ [D NO:3 is HIV-1 splice junction (nucleotide 6039 -52), while SEQ ID NO:4 is a part of the tat gene. (nucleotides 5974-88). SEQ ID NO:3 ring The shape is depicted below and the nucleotide number l is the first nucleotide in the P domain. The first T, which is a cleotide, corresponds to the t1 group l.

The cyclic form of SEQ ID NO:4 is depicted below and the nucleotide analog\ -1 is the -1 nucleotide of the P domain.

Circular oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4 can inhibit HIV infection both in vitro and in vivo. Against HIV infection In vitro screening for the effectiveness of cyclic oligonucleotides is within the skill of the art. oligonucleotide: to determine the stability of target binding and in vivo Efficacy and binding stability will be evaluated. To observe inhibition in vitro, a circular ori- The gonucleotide is added to the culture medium of the appropriate cell line infected with HIV.

Cells may be pre-treated with l-shaped oligonucleotides or cyclic oligonucleotides. Reotide is added at the time of infection or after infection with HIV. Added before or after infection.

Whether the oligonucleotides of the invention prevent or simply inhibit HIV infection, respectively. Evaluate any of the following.

The degree of inhibition of HIV infection or replication is determined by any of Uni's assay systems. percentage of oligonucleotide-treated cells surviving post-infection versus untreated cells. Evaluation of the number of syncytia formed in treated and untreated HIV-infected cells and measurement of the amount of viral antigen produced in treated and untreated cells.

In vivo studies of the efficacy of cyclic oligonucleotides can be performed in a suitable animal host such as a tiger. performed in genetic mice or chimpanzees. HIV antigen levels are monitored The effects of cyclic oligonucleotides on HIV replication were evaluated and Follow the flow of the situation more quickly. On the other hand, human volunteers due to AIDS or ARC Since oligonucleotides are unlikely to have cytotoxicity, oligonucleotides are administered. The disease status of these volunteers is as follows: The oligonucleotides of the present invention have been evaluated in the treatment and prevention of AIDS infections. Determine the effect of the code.

Others of this invention! Q! cyclic oligonucleotides of the present invention together with a pharmaceutically acceptable carrier. Pharmaceutical compositions comprising cleotide are provided. In particular, one oligonucleotide of the present invention is .

Approximately 0.0 kg per kg of body weight per day. lug - about 100 mg, preferably body weight per day Approximately 0.0 kg/kg. The present invention is provided in a therapeutically effective amount of 1 μg to about 10 mg. Binds to a nucleic acid by a method. Dosages are readily determined by those skilled in the art and described in this book. Formulated into pharmaceutical compositions of the invention.

[Pharmaceutically acceptable carrier] as used in Uni. Medium 5 Dispersion medium Coating, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. It is. The use of these media and agents for pharmaceutical active substances is well known to those skilled in the art. Ru. The therapeutic regimen except that any conventional vehicle or exfoliant is incompatible with the active ingredient. Its use in compositions is included. Active ingredients that support fI can also be included in the compositions.

The oligonucleotide of the present invention can be administered intravenously, intramuscularly, intraperitoneally, subcutaneously or may be administered topically or parenterally by the transdermal route, or suitably protected. When the oligonucleotide of the present invention is administered orally, the oligonucleotide of the present invention is administered orally. Oligonucleotides can be formulated into creams, solutions or suspensions for topical administration. .

For oral administration, oligonucleotides are packaged in tuf by enclosure in gelatin capsules. I can f. The oligonucleotide can be packaged in liposomes or polyester for parenteral administration. Formulated in liposomes modified with tyrene glycol. into liposomes Additional substances e.g. react with the +1111 protein found on specific target cells Formulating specific antibodies helps target oligonucleotides to specific cell types. Let's go.

Topical and parenteral administration in liposomal carriers is preferred.

Example The following examples further illustrate the invention.

Actual I*Example 1 Circularization of oligonucleotides using end-linked oligonucleotides according to the present invention. If so, a simple one-step chemical method has been developed to produce cyclic precursors from linear precursors #&J (precyclic). Build things. DNA oligonucleotide with the same sequence as the actual target is constructed, which is an end-linked oligonucleotide. Anterior circular oligonucleus Otides were assembled in the first order and chemically phosphorylated at the 5' or 3' ends. As shown in Figure 2, the precircular and end-linked oligonucleotides are mixed together. and formed a complex with adjacent ends. cyanogen bromide, Imidasol III and divalent metal were added. Incubation for 6-48 hours After tanning, the mixture was dialyzed, lyophilized, and the product was purified using modified 20% polyacrylic Separated by amide gel electrophoresis. UV shadowing is slighter than the front annular Precyclic and end-linked oligonucleotides, with one new product migrating slowly to It showed a large band that migrated with leotide. Added end-linked oligo Produced without cleotide or in the absence of 5° or 3° phosphate groups of precyclics Nothing was observed. Collect the main band, elute it from the gel, and dialyze it. Salts were removed and quantified by absorbance at 260 nm. End-linked oligonucleotide Reotide 4 and 5 (SEQ rD NO: 8 and H SEQ ID NO: respectively; 9) and 2 (SEQ ID NO: 5 and SEQ respectively) In the reaction with ID NO: 6), cyclics 6 and 7 were 40% and 58%, respectively. was obtained in a yield of . Sequences of each of these molecules and other oligonucleotides is shown in Figure 1.

The cyclic structure of fJ56 and 7 is due to the complete destruction or dephosphorylation of the linear precyclic product. Resistance to 3° exonuclease digestion and 5° dephosphorylation under reaction conditions Confirmed by gender. Therefore, the 3' exonuclea of T4 DNA polymerase ze activity cleaved linear preforms 1 and 2 but not cyclics 6 and 7. Ta.

The linear precycle was also labeled at the 5° end with 32P and then circularized. After reaction, the cyclic product is inactive towards coradialkaline phosphatase, but , the precycle left completely labeled 32P. Annular to preannular Slightly slower gel mobility was consistent with the occurrence of cyclization.

Optimal circularization conditions A number of parameters have been optimized to increase the yield of cyclic products, which Concentration of gosreotide and procyclics, temperature 1 reaction time, metal, metal concentration, BrC Improved cyclization color properties, including N concentration and pH, Compared to the conventional conditions in which tide is bound, there is less cyclic material (both have a high yield of 2@). Luebke et al., 1989. J, Am, Chem, Soc, l 11 :8733 and Kanay et al., 1986, Biochemistry 25 (423), these conditions were as follows:

50 μM pre-circular 55μM end-linked oligonucleotide 100mM N i C+ 2 200mM Imidasole MCI (pH 7,0) 125mM BrCN 25℃, 36 hours.

However, ring closure of the rings was also effective under the following conditions.

3-200 μM precyclic 3-200 μM end-linked oligonucleotide 1010-50Q NtC12 50-500mM imidasol HCl20-200mM BrCN 4-37°C, 6-48 hours.

m (7) Gold m (Z n 2”, Mf12+, Co 2+, cu2+, P, 2 +, Ca2+.

2+, 2-1- Mg) is also used in place of N1. Additionally, one reaction is pH sensitive.

Closure of AP and P domains Closing of the AP domain cyclics was superior to that of the P domain. same terminal Precircular around oligonucleotide (i.e. 5, SEQ ID NO: 9) 2 and U3 (ftLsEQ ID NO: 6 and SEQ ID NO near) (7) Comparison of Illization is cyclic t#I7 l5EQ ID NO: 6'Ft 58% when closed with API") 4 (using front ring 2) but when closed with the P domain (i.e. using precycle 3) , the yield was only 35%.

condensation reagent Two reagents namely BrCN/imidazole/NICI 2 and 1-ethyl- 3-(3-dimethylaminopropyl)carbodiimide (EDC) Commonly used for chemical ligation of RNA (Kanaya et al., +986, Bi chemistry 25 423 and Ashl ey et al., 1991. Bi chemistry 30:2927), therefore these reagents (SEQI D No.: 8) Cyclic formation using end-linked oligonucleotides Linking the precircular product to oligonucleotide 6 (Figure 3 and SEQ [) NO:51] Directly compared the effectiveness of B　CN/Imidasole/　Ni　Cl　2 under established optimal conditions was used at 25°C, although ligation effectiveness was observed at both 4°C and 25°C. . EDC was added at 20mM at 4°C or 25°C for 4 days of incubation. MgC+ at 200mM with 2.50mM MES (pH 6,0) used.

At 4 °C, BrCN was more efficient, yielding 95% cyclic product, but ED C yielded only 55% of the product. However, at 25°C, Both EDC and CrCN yielded 95% product. Therefore, BrCN is low Both EDC or BrCN have equal success at 25°C, although they are more effective at lower temperatures. Can be used at a rate. However, BrCN requires less than 24 hours to connect with BrCN. However, it has an additional advantage over EDC since coupling with EDC takes approximately 4 days.

Use of 5' or 3°-phosphates Under certain linking conditions, linking the 3'-phosphate with the 5'-OH Combining the '-phosphate with 3'-OH resulted in the linked product ( Ashley et al.).

Therefore, by a 5′-phosphate precyclic or by a 3°-phosphate precyclic The % conversion of cyclic oligonucleotide 6 (Figure 3) was compared.

The cyclic 1-hi reaction was performed using a dA12-terminal pigeon-linked oligonucleotide and established optimal conditions. with the exception of 4 μmol of precyclic and end-linked oligonucleotides. Chido was used. The products are visible to the naked eye under UV light after separation by denaturing gel electrophoresis. It was observed in

Conversion to cyclic product is 60% (±5%) when 5′-phosphate is present. and 3°-increase in 0 reaction time which was 95% when phosphate is present or No increase in yield was observed when increasing reagent concentrations were used.

Therefore, the use of 3'-phosphate rather than 5'-phosphate promotes cyclization. Improve.

Example 2 Circular oligonucleotides target nucleic acids with higher affinity than linear oligonucleotides. combine with Annulars 6 and 7 (SEQ ID NO: 5 and 7 respectively) to their targets The binding affinity of SEQ ID NO: 6) is determined by the cyclic complex and linear complex. Rex's! It was measured by a single point comparison. Is the solution +00m? v! +7)N aC1, 10mM MgCl2, and 10mM Tris-MCI (pH 7, O containing oligonucleotide and target (3 μM each) in a 1:1 ratio in The mixing curve measured at 260 nm shows that a l;1 complex was formed. It was confirmed. The free energy of the complex (-ΔG°3□) is was derived from the melting data using a curve fitting method (P fm et al., ■983, Bf.

chemistry 22:256).

The results show that cyclic oligonucleotides target their targets with linear precursors or than Watson-Crick complementary target-sized oligonucleotides do. (Table II), for example, target 4 (SEQI D NO: 8) is the size of that target with Tm of 37.1'C. A double helix was formed with the son-click complement, but the procyclic 1: target 4 complex (i.e., SEQ ID No. coupled to SEQ LD No. 8: 5) had a T of 44.7°C. Annular object 6 having the same arrangement as the previous annular object 1 teeth.

It binds to target 4 at a Tm of 57.5°C, and the free energy of the binding is It was 8.6 kcal 11 moles preferable to the corresponding Watson-Crick double helix.

The association constant corresponding to tf at 37 °C is 6XlO “M”, which is A similar effect, larger than the 6th order, for the Toson-Crick double helix is Annular object 7 (SEQ ID NO: 6) to get 5 (SEQ ID No. 9) ), and this complex had a Tm of 623 °C. However, the corresponding Watson-Crick double helix melted at 43.8°C. this data show that the binding of circular oligonucleotides is similar to that of linear oligonucleotides to targets. Indicates that the bond is stronger than that of cleotide.

To know the characteristics of the join when the target array is embedded into a longer array 36 nucleotide oligonucleotides are synthesized, with a 12 base target sequence (target sequence) in the middle. 4). Melt testing of this longer oligonucleotide so that it binds to a target that has the same size as the ring binding domain. The T of the annular object 6 with the target 4 is 59.8°C. For a 36 base oligonucleotide containing an integrated target, T is 634°C. It was shown that Therefore, the binding of cyclics with embedded targets The strength was higher than that with targets of the size of the binding domain.

The binding affinity of circular f6 to RNA targets is determined by the oligoribonucleotide rA The total temperature was 58.3'C. The data show that cyclics have a higher R Indicates that it binds to the NA target as strongly or more strongly.

Example 3 Cyclic oligonucleotides are more selective as targets than linear oligonucleotides. combine selectively To measure the sequence selectivity of cyclic oligonucleotides, one variable salt A series of target oligonucleotides were constructed. These targets and 6 Selectivity, which measures the binding energy of the cyclic substances that make up the complex, is determined by the correction array. defined by the free energy difference between and the mismatched sequence. cyclic structure The selectivity obtained by A direct comparison was made.

DNA oligonucleotides were prepared using the β-cyanethylbosporamidite method. Synthesized by machine. Cyclic oligonucleotide 8 is SEQ rD NO near 5' - linear procyclic with pTCTTTCCACACCTTTCTTTTCTTCAC Final Table II Oligonucleotide ° Complex T 5°C-ΔG°3□ Target (kca11 mol) Using BrCN/imidazole to close the bond of the sequence 5'-AAG End-linked oligonucleotide having AAAAGAAAG (SEQ ID NO: 91) The ring was broken by the assembly around Leochi 1:. The cyclic structure is 3゛　-ex Confirmed by its low resistance to sonuclease and 5'-phosphatase. Ta.

The sequence selectivity of circular product 8 is that the target containing a single mismatched base and The strength of the complex obtained by hybridization and thermal denaturation is ΔG°37 ) was measured by measuring. 8F! targets are synthesized and they are , cyclics 8 and linear oligonucleotides, except for a single centrally located variable base. was complementary to leotide 9 (X or Y = A, G, C, Tl, 4fl target It is.

A change that matches two opposing Ts in a cyclic substance and produces a T-X-Tl-riasode. It has one possible group X. In the remaining 4!1 targets, the changeable base Y is Matches two opposing Cs in the ring to produce a C-Y-C triat. this For comparison with the circular complex, a linear oligonucleotide 9 was used; A double helix with a central T-X pair in the first four experiments or a C- Creates a double helix with Y bear.

＝　　　　　　　　　Jimezu - Riichi Kawara 5°-AAGAXAAGAA, AG ACTTCTTTTCTTTCCA 5’-AAGAAAAYAAAG Thermal denaturation of 16 complexes was performed with target and cyclic or is the concentration of linear oligonucleotide, 10mM MgC12, 100mM Performed in the presence of NaCl and 10mM Tris-HCI (1)H7,0) . The experiment was repeated twice. Results were averaged. Oligoscleotide; target Melting of the complex was monitored at 260 nm. Resulting temperature versus absorption curve indicates a single transition from bound to free oligonucleotide. did.

The free energy of association is obtained by fitting the data to a bimorphic curve fit method. The obtained 1M fruit was determined by measuring the association energy using the fan't-hop method. One choice was checked in two cases and a good agreement was found between the two methods. degree is a complex between matched and mismatched oligomers. It is defined as the difference in the free energy of oxidation (ΔG).

Table In shows the results of mismatch experiments, Experiments 1-4 show the T of the DNA double helix. −X indicates the effect of target mismatch, as expected, true match (X= Al has the most preferable complex (−ΔG　’　37=　10.3　k　c a, l 1 mole), and the mismatch (XΔG, C, T) is the bond energy Mismatch's research, which resulted in a loss of 3.2-4°4kca11mol in study and good (match)

Experiment 5-8 shows that, by comparison, T-X-T for the cyclic complex bond strength Showing the effect of mismatch 6 Once again, true match (X = A) is the most preferable A complex of three products (-ΔG' 37 = 16.4 kca11 is given.

but.

Target mismatch (X=G, T, C) for linear oligonucleotides binding energy (6,2-7,6 kca 11 mol).

Similarly, experiments 9-12 demonstrate the effect of C-Y mismatch on the double-stranded duplex. Give. The matched base (Y=G) is a double chain of -10,3 kca 11 moles. Give the free energy of the meeting. Mismatch (Y=A, T, C) is Published data result in a loss of 5.2-5.8 kca11 moles of combined energy. It pretty much matches. In contrast, the effect of C-Y-C mismatch is (Experiments 13-16), and Matsushi (Y=G) was -16.4kca1. Give a bond energy of 1 mole, and the mismatch (Y=A, T, C) is 7. 1-7.5 kcal 11 moles Not stable.

Therefore, in all cases considered, the cyclic ligand is It shows even greater selectivity for its corrected matched sequences than for the corrected matched sequences.

The selectivity advantage is from 1.3-2.2 kcal 11 mol to T in the C-Y-C series. -X-T series ranging from 3.0-3.4kca11mol, these are 5 Resulting from a single base change, in the case of the T-X-T series, a cyclic oligonucleotide This is not at all noticeable, considering that the This is a significant difference. This difference in selectivity is 1-2 orders of magnitude in the binding constant at 37°C. corresponds to

There are two factors that can explain this high selectivity. First, the cyclic oligonus The two domains of the cleotide bind the central eye eltl, so the cyclic oligo Nucleotides are actually sequence checked twice to correct for matches.

Second, the protonation of the cytosine within C+G-C1-Realad also increases the selection It is a factor in degree. This protonation causes guanine to have both positive charges. It appears to be preferable only when there is base triat formation, and the fact is that the salt The pKa of cytosine within the radical is 2- This suggests that it is 3 units higher. This positive charge addition causes the holes in the complex to Reduces the repulsion of negative charges resulting from the high density of sulfonates, thereby reducing bond stability. Increase quality.

′Thus, cyclic oligonucleotides, as described here, of higher binding affinity and selectivity than can be achieved with Rick double helices alone. It has both.

Example 4 Factors affecting complex formation l) Effect of solution, cyclics: target Examining the effects of NaCl, Mg2+, spermine and pH on the complex Ta. The ring with cytosine in the binding domain is sensitive to pH, and at low pH It showed great stability in terms of value. However, these and other cyclics: target comp Rex is quite stable at physiological pH of 7.0-7.4 (Figure 5), Comp. Rex exhibits salt concentration sensitivity comparable to double helices, but with small amounts of Mg 2+ or spermine significantly increases the stability of the complex, e.g. At a concentration of ImM Mg + 10 at pH 7.0 with the addition of A constant 7:5 ring:target complex was formed. salt added When a free 20 μm solution was used.

A 7:5 complex with T of 56°C was stably formed. Mg+“ and Both spermine and spermine are present in mammals at least in these concentrations, and Object: The target complex will be stable under physiological conditions.

2) Loop size, the optimal number of nucleotides between the loop domains of a circular product is , complex formation between cyclics and targets with different loop sizes It was determined by observing the Procyclic linear oligonucleotide similar to procyclic 2.3.4.5, 6 and 1 using any sequence of residues with alternating C and A Synthesized using a 0-base loop. Each of these pre-annulars is made from an A12 mold (immediately It was designed to bind to target 4 (SEQ ID NO: 8)). .

4. A cyclic T with 5, 6 and 10 base loops is a 5-nucleotide loop. The droop size is the bonding of the ring to the mold A1□ or A12! @Includes joint parts It was shown that the combination of cyclics into long 36-mole arrays was optimal for either (See Figure 6A).

3) Binding domain length, cyclicity, and cyclicity relative to the Cougett complex melting point. The effect of the length of the oligonucleotide binding domain is that double helices with the same length compared to the melting of. Circles with binding domains of one size are constructed.

4. Concatenate one strand with ff1dAn so that n is equal to 8, I2 and 18 nucleotides. The plexed 1 Figure 6B has a fairly high T but the same length as the binding domain. cyclic object, target complex compared to the Watson-Crick double helix with (NaCl of sail LM, pH 7), e.g. A 2-base cyclic complex melts at about the same temperature as a 24-base double helix. Ta.

Although the 4jJi-based cyclic complex melted at 34°C, the corresponding Watsonian The temperature of the double helix T was lower than 0°C.

4) Methylation, methylation at the C-5 position of cytosine forming a large number of bases m5C between unmethylated sequences, which increases the Tm of the resulting double helix DNA. It has been known for a long time that (Zmudzka et al., 1969. mistry 8:30491. The addition of this methyl group creates a cyclic product: a target compound. To examine whether it stabilizes the plex, cyclic 1ff7 (SEQ rD Two analogues of (with NO:6) were synthesized. In one ring, the bonding Six Cs in the main were methylated, leaving an unmethylated loop (Me6 1° In the second ring, all 12fli Cs were methylated (Me + 2 1. The melting point of these methylated cyclic complexes with target 5 is The measured 9Me6 combresox was an unmethylated ring with a Tm of 71.1'C. ), and the T of 72.4°C for the Me + □ ring. It had m. Therefore, the use of the natural base m5C in place of C substantially improves the stability. increased and, in one case, soluble 10.6°C higher than the unmethylated ring. 28.6'C from the corresponding unmethylated Watson-Chrysocuniplex helix. A highly melting 12 base complex was produced.

Example 5 Replacement of a nucleotide loop domain by a non-nucleotide loop domain The loop domains of the oligonucleotides are polyethylene or oligonucleotides of different lengths. Substituted by tyrene glycol chain, cyclic oligonucleotide binding and nuclease Effects of these synthetic loops on Zee resistance! 111-value.

Method Cyclic with tetra, penta or hexa-ethylene glycol chain loop domain Oligonucleotides were synthesized. In each case, ethylene glycol The chain was determined using the method of Durand et al. (1990, Nuclejc Ac1ds Re s, +8:6353-6359) using automated DNA synthesis methods. was created. Briefly, phosphoramidites are made by adding hydrogen at one end of an ethylene glycol chain. oxy group and dimethoxytrityl (DMT) moiety to the other terminal ethylene placed on the glycol hydroxyl group. This derivatized ethylene glycol chain is then mobilization was added to the growing linear oligonucleotide at the appropriate stage of DNA synthesis. annular The oxidation step was carried out in the manner described in Example I. Tetraethylene looped Linear oligonucleotide precycles with mains are not efficiently circularized. It was. These results indicate that the two-tetraethylene loop domain provides optimal binding to the target. indicates that it is too short.

Two types of linear oligonucleotides are used as a target for circular oligonucleotides. used as target binding domain. Target I is a non-target nucleus. Target II is a 12-base oligonucleotide that does not have an otide. It was a 36 base oligonucleotide with a 12 base target inside. used The obtained target sequence is 5°-AAGAAAAGAAAG-3' (S EQ ID NO: 9) and 5'-AAAAAAAAAAAAAAA-3° (SEQ T D NO: 8), the latter being named poly(dA112 target sequence).

The melting point (TITl) of a cyclic oligonucleotide with a polyethylene loop is 1 pH 7.0 (10mM) in 0mM MgC12 and 100mM NaCl HC1). Each linear target and each circular oligonuclear Creotide was present at a 3 μM concentration.

result CACAC nucleotide loop sequence and poly(dA) between P and AP domains T of the cyclic oligonucleotide having 12 sequences is poly(dA)1□ tag. The temperature was 578°C when bound to the tsut sequence. The same P and AP domain sequences A cyclic oligonucleo with a hexaethylene glycol loop domain The Tm of Tide was 51.4°C when bound to the same target.

Pentaethylene glycol (PEG) and hexaethylene glycol (HE (1 ;) wL observed Tf for cyclic oligonucleotide with loop domain A comparison of iffi is shown in Table 1v.

Table IV -1-1-2-7-Sat Engineering□ pTTCTTTTCTTTCp PEG AAGAAAAGAAAG PEG 51.5 47.5pTTCTT TTCTTTCp pTTCTTTTCTTTCp HEG AAGAAAAGAAAG HEG 58.0 51.1pTTCTT TTCTTTCp pTTTTTTTTTTTT HEG AAAAAAAAAAAAHEG 51.4 46.5pTTTT TTTTTTTTp The T value observed for a cyclic oligonucleotide with a HEC loop is Its temperature is approximately 4.5 °C higher than that of the cyclic oligonucleotide with an EG loop. Therefore, a cyclic oligonucleotide with a hexaethylene glycol loop domain Cyclic oligonucleotides with tetra- or penta-ethylene glycol loops Binds with greater stability than otide.

nuclease resistance The cyclic oligonucleotide can be used both when unbound and when bound to the target oligonucleotide. tested for nuclease resistance. All circular oligonucleos The tide can be bound or unbound (but not completely conjugated to the exonuclease). resist. Endonuclease sensitivity was determined using Sl nucleases according to the manufacturer's suggestions. It was evaluated (2) using

Ratio of resistance of bound and unbound cyclic oligonucleotides to S1 nuclease A comparison is shown in Table V.

Table V 1 dispute 1 0.

p TTCTTTT CTTTCp pTTCTTTTCTTTCp HEG AAGAAAAGAAAG HEG > 24 hours pTTCTTTCT TTCp ACTTCTTTTCTTTCCA ACTTCTTTTCTTTCCA CAAGAAAGAAAG C40 minutes ACTTCTTTTCTTTTCCA These data demonstrate that unbound circular oligonucleotides are susceptible to 51 nuclease. However, when bound to a target, the polyethylene loop domain a cyclic oligonucleotide having a nucleotide loop domain; oligonucleotides (both far more resistant to 3fllS1 nuclease) It is resistant.

Nuclease resistance of circular and linear oligonucleotides also Comparisons were made when the nucleotides were incubated in human serum for various times.

Cyclic oligonucleotide 7 and its precursor tb, m-shaped oligonucleotide Tide 2 was incubated at a concentration of 50 uM in serum at 37°C. some part The samples were removed at various times and the cleavage products were separated by gel electrophoresis. Nuclair Measure resistance by observing whether degradation products are evident on the gel. Evaluated.

When incubated in human serum, the half-life of linear oligonucleotide 2 is , it was 20 minutes. In contrast, cyclic oligonucleotide 7 There was no measurable nuclease degradation during the incubation. Similarly, the annular ori The half-life of the gonucleotide is longer than 48 hours in human serum, i.e., it has the same sequence. It is more than 140 times longer than linear oligonucleotides.

Example 6 The circular oligonucleotides described in this example can selectively bind to RNA. The experiment differs from linear oligonucleotides. Cyclic oligonucleotide is DN It can selectively bind to the RNA target rather than the A-couget.

Two deoxyoligonucleotides were prepared as targets, namely rTJI SEQ ID No.: II) Target and rdUJ (SEQ ID No. :12) Target.

T target: 5'-AAGAAUG-3'dU+-get: 5 '-AAGAA beans AGAAAG-3゜SEQ ID NO: 14 Oligonucleotides were also produced.

For comparison, linear oligonucleotides complementary to the T and aU targets were also synthesized. (i.e. linear oligonucleotide, SEQ ID NO: l3) 5'-CT TTCTATTCTT-3'.

Cyclic oligonucleotides versus linear oligonucleotides that bind to each of the targets The th points (T) observed for Tide are provided in Table 1 Vl.

Linear oligonucleotides can be used to increase dU-tutter in amounts significantly greater than the limit of experimental error. This difference in Tm titer is 1.7 kcal. It corresponds to the difference in free energy of bonds of 1 mole.

However, in contrast to linear oligonucleotides, cyclic oligonucleotides Bonds more strongly to the target. Therefore, cyclic oligonucleotides are It is possible to show selectivity for RNA over DNA coupons.

Moreover, the increased binding strength of circular oligonucleotides to RNA targets , at 37°C the RNA targets are approximately 3° l preferable to the corresponding DNA targets. This corresponds to a free energy difference of 0.8 kcal 11 moles indicating that the

Example 7 Chain replacement by cyclic oligonucleotide Cyclic oligonucleotide 6 (Figure 3) is , 9 kca, 11 mol larger than Il-like dT1□ oligonucleotide (Example 2) It bound to the dA1□ target with excellent stability.

This increase in stability is due to the cyclic oligonucleotide:target complex.

Linear oligonucleotides: proving thermodynamically superior to their targets .

Furthermore, circular oligonucleotides facilitate the dissociation of double-stranded DNA target sequences. actually promotes (or catalyzes) the formation of a complex with one strand of the double helix. Can be done.

Circular oligonucleotides readily dissociate double helix DNA and To test whether to displace one strand of a DNA target, use the Strand Displacement The kinetics of the duplex in the presence of complementary linear or cyclic oligonucleotides The DNA target was detected.

It has a fluorescein group on one chain and a tetramethylrhodamine group on the other chain. DNA double helix targets with were produced using published methods ( Cardullo et al., +988. Proc, Natl, Acad, Sci, US A 85:8790: Cooper et al., 1990. Biochemistry2 9:92611. m-helix target (SEQ ID NO: 15) (7) structure The construction was as follows.

5゛　-Fluorescein-AAAAAAAAAAAAAAA3゛-Rhodamine-TTT TTTTTTTTT.

The Trrl of this labeled double helix target is normal and therefore fluorescent The compound had no significant effect on associative force dynamics. Additionally, full The emission maximum of olecein-dA y4 was 523 nm, but rhodamine-d T.

The emission maximum of the two strands is 590 nm, and the associative force of the two strands can be measured separately. made it possible to monitor.

Strand displacement reactions were performed at 10 °C in a 1 cm fluorescent cell.6 Reaction conditions were 100 °C. mM NaCl, 10 mM MgCl2 and lomM Tris) (C1, pH 7 0, and the volume of one reaction was 3 ml. The labeled double helix is at least Equilibrate for 1 hour at 10°C and then add a 40-fold excess of linear or cyclic oligonucleotides. (final concentration 0.01 μM) was added. 5pe with slit width of 5mm x FIurolo FIIIA'tL optical equipment was used. 450nm excitation wavelength and a monitored emission wavelength of 523 nm was used. The results show that the excitation wavelength and The zero response, which was unrelated to both the emission wavelength and the monitored emission wavelength, was at least 5. The decline continued.

The addition of rhodamine-dT+2 to fluorescein-dT12 This resulted in a decrease in rhodamine fluorescence and an increase in rhodamine fluorescence. These effects occur between fluorescent moieties. (Cardullo et al.).

The association rate constant of two fluorescently labeled strands is determined by mixing axillary under pseudo-secondary conditions.

and was determined by monitoring the rate of decline in fluorescein emission. l The association constant u observed in OoC is 3.2XIO6M's-1, and In good agreement with the published rates of association between DNA oligonucleotides (Ne lson et al., +982. Biochemistry 21:5289:Turn er et al., +990 in Nucleic Acids (subvolume C), W. Sanger, Ed. Springer-Verl ag, Berl. in:201-2271.

having a single linear chain (SEQ ID NO: 8) or SEQ ID NO: 5 The cyclic oligonucleotide (i.e. cyclic oligonucleotide 6) is a double helix DN. Excess unlabeled linear or cyclic oligomers were added to compare the rate of exchange with the strands in A. The oligonucleotides were mixed with a fluorescently labeled double helix DNA target. . Increase in fluorescein emission is an indication of first-order double helix target strand dissociation. i+ was observed at a temperature well below the Trn of the double helix target.

Figure 8 shows 40III excess of unlabeled dA at IO’C, □ (dotted line) or cyclic Time taken for dissociation of double helix target by oligonucleotide 6 (solid line) Cyclic oligonucleotides as indicated showing a representative kinetech assay. Dissociation of double helix targets by The first-order rate constant for dissociation by linear oligonucleotides is also quite fast. ．． 0x10-4 s-1, but the time during dissociation by the cyclic oligonucleotide The second-order rate constant is 2.0XIO-2s-1, which is almost second-order in magnitude. early.

This difference is due to the targeting in the presence of linear vs. circular oligonucleotides. More becomes clear when the half-life of the double helix is calculated. At 10°C, The double helix has a half-life of dissociation of 58 minutes in the presence of linear oligonucleotides However, in the presence of cyclic oligonucleotides, it is only 30 seconds.

The rate of reaction between linear oligonucleotides and double helices is different from that of cyclic oligonucleotides. The rate of reaction between the gonucleotide and the double helix depends on the cyclic oligonucleotide added at low concentrations. dependent on the concentration of the gonucleotide, and at higher concentrations Michael's-Me It exhibits nton-type saturation behavior (Figure 9).

The dissociation rate of the labeled double helix at 10 °C is determined by the double helix association rate constant and Δ "It can be derived from 10 sake. This rate constant, 8.5XIO" sec-1, is a double helix. As derived from the predicted thermodynamic harameter for the complex, fB Reslauer et al., 1986. Proc, Natl, Acad, Sci.

USA 83:37461. This rate depends on the positioning of the strand by the linear oligonucleotide. The rate constant for the addition of Il-like oligonucleotides is significantly slower than the rate constant for conversion. Increased helical dissociation is evident in other cases (Chamberlin et al., 1 965, J, Mo1. Biol, 12:410) that of unassisted double helix dissociation. Comparison of rates between cyclic oligonucleotide-catalyzed reactions for 151g1er et al., +962. demonstrating speed increase. J, Mo1. Bio yields K of l. K is either a single strand of dA, 2 or dT I 2 and two weight m cat 100 times larger than the observed rate constant obtained for the reaction with Zen.

The observed saturation behavior (Figure 9) suggests that the complex is complex with the cyclic and double-stranded target. It is suggested that it is formed between K using the above Km value. ata Ru. This value is based on Pjlch et al. (1990, Nucleic Ac1ds Res , 18:5743). Approximately -9 between the P domains in a 121-base triple helix consisting of a base triazodine It is similar to the determined value of kca l mol-I.

array list (1) General information (i) Applicant: Kool, Er1c T.

(ii) Name of the invention double-stranded cyclic oligonucleotide (iii) Number of sequences: 1 5 (iv) Contact information: (A) Destination: 5cully, ScottlMurphy & Pre (B) Strike REIT: 400 Garden C1ty Plaza (C) City: Garden C1ty (D) State: New York (E) Country: USA CF) ZIP: 11530 (V) Computer readout form: (A) Media type: Floppy disk (B) Computer: IBM PC compatible (C) Operating system M: PC-DO5/MS-DO3(D) Software: PatentInR e1ease #1.01Version #1.25 (vi) Recent application data: (A) Appearance number: United States (B) Application mill: (C) Classification: (viii) Agent/representative information: (A) Name: McNulty, W+11iamE.

(B) Registration number: 22606 FC+ reference reference/socket number 8085Z(ix) communication information.

+A) Telephone: f516) 742-4343 (B) Fax (516)7 42-4366 (2) SEQ ID No.: Information between I.

Characteristics of m array: (A) Length: 34 base pairs (B) Type: Nucleic acid (C) Two chain elements (D) Topology: cyclic (xi) Sequence description: SEQ ID NO:l:cTcccccccc TCN NNNNNCTCCCCACCCCTCNNNNNN34 (2) SEQ I [NO: 2+, m interval N: (il array special?! i: (A) Length: 38 base pairs (B) Type: Nucleic acid (C) Element of ill, single product (D) Topology, circular (xi) Sequence description: SEQ [) NO12: TCTTTTTTCT TTT CNNNNNCTTTTTCTTTTTTTCTNNNNN38 (Information between 21SEQ ID NO: 3: Characteristics of fil array: (A) Length, 38 base pairs (B) Type nucleic acid (C) Two strands of crab elements (D) Topology: circular (x t) Array f) Description: SEQ TD NO: 3: DingTTCYTCGTT CGTCNNNNNCCTACTTAC GCTTTTNNNNN38 (2) Information between SEQ TD No. 4 (i) Characteristics of array.

(Al length: 4oI! base pair CB) Type: Nucleic acid (C) Chain element (one piece) Product D) Topology: Annular (xi) Sequence description: SEQ ID NO: 4:TCCTTCTTCY CCT CTNNNNNN TCTCCGCTTCTTCCTNNNNN 4゜ (2) Information between SEQ ID NO: 5: (i) Specification of the array? Ii: (A) Length: 34 base pairs CB) Type: Nucleic acid (The product of two elements of ChI!l (D) Topology (both) (xi) Sequence description: SEQ ID NO: 5: TTTTTTCACA CTT TTTTTTTTTTTCACACTTTTT34 (2) Information between SEQ ID NO: 6: (+) Array characteristics: (A) Length: 34 base pairs (Bl type: Nucleic acid (The product of two elements of C1all (D) Topology fxi) Array description: SEQ ID NO: 6: TCTTTCCCACA CCT TTCTTTTTCTTCACACTTTTT34 (2) Information between SEQ ID NO: (i) Array characteristics: (A) Length゛34 base lamp (B) Type nucleic acid (C) Chain element double strand (D) Topology °Both (Description of xil array: SEQ ID NO Near: TTTCTTCACA CTT CTTTCT　TTCCACACCTTCT34 f2) Information regarding SEQ ID NO:8.

(i) Sequence characteristics.

(A) Length: 12 base pairs (B) Type ° Nucleic acid (C) Element of F14, single product (D) Topology m-shape (xi) Sequence description: SEQ ID No, 8゜AAAAAAAAAAA, 2 (2) Information regarding SEQ ID No: 9: (i) Sequence characteristics: (A) Length: 12 base pairs (Bl type, nucleic acid (C1 chain element single stack (D) Topology ° linear (xi) Sequence description: SEQ ID NO: 9: AAGAAAAGAA AG, 2 (2) Information regarding SEQ ID No: 10; (i) Sequence characteristics: (A) Length: 12 base pairs CB1 type: Nucleic acid fCl! Product of 11 elements (D) Topology: Linear (xi) Sequence description: SEQ ID NO:]O: CTTTCTTTTCTT.

(2) Information between SEQ ID NO: 1]: (i) Characteristics of array: (A) Length: 12 base pairs (Bl type: Nucleic acid (C) Chain element knee heavy chain (D) Topology: Linear (xi) Sequence description: SEQ ID NO: 11: AAGAATAGAA AG 12 (2) SEQ ID No.: Information between 12.

(i) Characteristics of array: (A) Length: 12 base pairs CB1 type: Nucleic acid (The product of two elements of the C1 chain (D) Topology: ls shape (xi) Sequence description: SEQ ID NO: 12: AAGAAUAGAA AG ,2 (2) Information between SEQ ID NO: 13: (i) Array special 8! : (A) Length: 12 base pairs (B) Type: Nucleic acid (C) Chain element, single stack (D) Topology: Linear (xi) Sequence description: SEQ TD NO: 13: CTTTCTATTCTT, 2 (2) Information between SEQ ID No. 14: (i) Characteristics of array: (A) Length: 34 base pairs CB1 type: Nucleic acid (Elements of CAM knee heavy chain (D) Topology: Both (xi) Sequence description: SEQ ID NO: 14: TTCTTCTCTT TC CACACCTTTCTATTCTTCAC34 (2) Information between SEQ ID NO:]5.

(i) Characteristics of array: (A) Length: 12 base pairs (B) Type: Nucleic acid (C) Element of M: double strand (D) Topology: Linear (xi) Sequence description: SEQ ID NO: 15:AAAAAAAAAAA ,2 FIG, IA AT GC FIG, IB F；η Takashi Figure 3 (continued) 9 5'-CTTTCTTTTCTT (SEQ ID No. 10) Figure 5 Effect of pH on Tm pH Tm,'C Tm. C Figure 7 5′ Figure 8 Figure 9 Submission of translation of written amendment (Article 184-8 of the Patent Law) September 22, 1993

Claims (64)

[Claims] 1. A loop domain between each binding domain to form a circular oligonucleotide. at least one parallel binding (P) domain with an in and at least one opposite including parallel binding (AP) domains, each P and corresponding AP domain being defined as P has sufficient complementarity to detectably bind to one strand of the nucleic acid target The domain binds to the target in a parallel manner and the AP domain binds to the target in a reverse plane. A single-stranded circular oligonucleotide that binds in a specific manner. 2. The target is then in the P domain and the corresponding AP domain. The nucleotide sequence for a sufficient number of positions is determined from the target sequence. a position in the target with respect to the P domain; When the relevant base is guanine or a guanine analog, P is at the corresponding position. cytosine or a suitable analog thereof, and the base for the position in the target is When P is adenine or an adenine analog, thymine or ura is present at the corresponding position. sil or a suitable analogue thereof, and the base for the position in the target is timid. When P is a cytosine or thymine analog, P is a cytosine or guanine or a thymine analog at the corresponding position. has a suitable analogue thereof, where the base for the position in the target is cytosine or is a cytosine analog, P is cytosine, thymine or ura at the corresponding position. sil or a suitable analog thereof, and when the base for the position in the target is uracil or a uracil analog; , P is cytosine, guanine, thymine or uracil or a suitable one thereof at the corresponding position has an analog Furthermore, regarding the AP domain, when the base for the position in the target is guanine or a guanine analog; , AP has a cytosine or uracil or a suitable analog thereof in the corresponding position, when the base for the position in the target is adenine or an adenine analog; , AP has thymine or uracil or a suitable analog thereof in the corresponding position; When the base for the position in the target is thymine or a thymine analog, AP has an adenine or a suitable analog thereof in the corresponding position, and the target When the base for the position in is cytosine or a cytosine analog, AP corresponds to guanine or a suitable analogue thereof at a position in the target; When the base is uracil or a uracil analog, AP is attached at the corresponding position. having a denine or guanine or a suitable analog thereof, a sufficient number of said positions being having sufficient complementarity to said oligonucleotide to detectably bind to said target. 2. The oligonucleotide of claim 1, wherein the oligonucleotide is in a number of positions. 3. The P domain is a nucleotide sequence determined from the known nucleotide sequence of the target. Contains a cleotide sequence, when the base for the position in the target is guanine or a guanine analog; , P has a cytosine or a suitable analogue thereof in the corresponding position in the target. When the base for the position is adenine or an adenine analog, P corresponds to having thymine or uracil or a suitable analog thereof at the position in the target. When the base for the position is thymine or a thymine analog, P is substituted for the corresponding position. tosine or guanine or a suitable analogue thereof, with respect to its position in the target. When the base to be used is cytosine or a cytosine analog, P is a cytosine at the corresponding position. cine, thymine or uracil or a suitable analog thereof, and when the base for the position in the target is uracil or a uracil analog; , P is cytosine, guanine, thymine or uracil or a suitable one thereof at the corresponding position has an analog And further, the AP domain is a nucleus determined from the sequence of the target below. Contains a cleotide sequence, when the base for the position in the target is guanine or a guanine analog; , AP has a cytosine or uracil or a suitable analog thereof in the corresponding position, when the base for the position in the target is adenine or an adenine analog; , AP has thymine or uracil or a suitable analog thereof in the corresponding position; When the base for the position in the target is thymine or a thymine analog, AP has an adenine or a suitable analog thereof in the corresponding position, and the target When the base for the position in is cytosine or a cytosine analog, AP corresponds to guanine or a suitable analogue thereof at a position in the target; When the base is uracil or a uracil analog, AP is attached at the corresponding position. The oligonucleosome of claim 1 having lanine or guanine or a suitable analogue thereof. Chido. 4. The target, the P domain and the AP domain independently have about 2 to about 20 The oligonucleotide according to any one of claims 1 to 3, comprising 0 nucleotides. . 5. The target, the P domain and the AP domain independently have about 6 to about 36 5. The oligonucleotide of claim 4, comprising 5 nucleotides. 6. Each loop domain independently consists of about 2 to about 2000 nucleotides. 4. The oligonucleotide of any one of claims 1-3 comprising: 7. Each loop domain independently contains about 3 to about 8 nucleotides. The oligonucleotide of claim 6. 8. The method according to any one of claims 1 to 3, wherein the target is single-stranded or double-stranded. oligonucleotide. 9. The method according to any one of claims 1 to 3, wherein the target is RNA or DNA. oligonucleotide. 10. Any of claims 1 to 3, wherein the target is a domain contained in a nucleic acid template. Oligonucleotide of one of the terms. 11. The P domain and the AP domain connect to the target in a staggered binding configuration. 4. An oligonucleotide according to any one of claims 1-3, which binds to. 12. Any of claims 1-3, wherein sufficient complementarity is less than 100% complementarity. One term oligonucleotide. 13. 13. The oligonucleotide of claim 12, wherein sufficient complementarity is about 30 to about 40% complementarity. Creotide. 14. Any one of claims 1 to 3, wherein the oligonucleotide is RNA or DNA. One term oligonucleotide. 15. 3. A preferred analogue of cytosine is 5-methylcytosine. oligonucleotide. 16. 3. A preferred analogue of uracil is 5-methyluracil. oligonucleotide. 17. 4. A preferred analogue of adenine is diaminopurine. Ligonucleotide. 18. The nucleotide is 2'-O-methyl instead of ribose or deoxyribose. Oligonucleotide according to any one of claims 1 to 3, comprising luribose. 19. Any one of claims 1 to 3, wherein the oligonucleotide is taken up into cells. Oligonucleotides in the section. 20. The oligonucleotide has a cell receptor, a cholesterol group, an aryl group, The orifice of claim 19 further comprising a ligand for a steroid group or a polycation. Gonucleotide. 21. Claim 1- The oligonucleotide further comprises a drug or drug analog. An oligonucleotide according to any one of 3. 22. Claims 1-3, wherein the loop domain comprises a non-nucleotide loop domain. Oligonucleotide of any one of the terms. 23. 2. The non-nucleotide loop domain is ethylene glycol. 2 oligonucleotide. 24. The polyethylene glycol includes pentaethylene glycol, hexaethylene glycol, 24. The oligonucleo of claim 23, which is glycol or heptaethylene glycol. Chido. 25. The oligonucleotide contains at least one methylphosphonate, phosphonate, lotioate, phosphorodithioate, phosphotriester, siloxane, carbon further containing bonate, acetamidate or thioether groups and phosphorus-boron bonds. An oligonucleotide according to any one of claims 1 to 3. 26. 4. The oligonucleotide further comprises a reporter molecule. Oligonucleotide of one of the terms. 27. A oligonucleotide that provides a cyclic oligonucleotide according to any one of claims 1 to 3. for detecting or diagnosing a target nucleic acid, comprising at least one first container. Conversion kit. 28. A oligonucleotide that provides a cyclic oligonucleotide according to any one of claims 1 to 3. a converting member for isolation of template nucleic acids, comprising at least one first container; In the template kit, the oligonucleotide is attached to the target contained within the template. Complementary compartmentalization kit. 29. 29. The kit of claim 28, wherein the template is poly(A)+mRNA. 30. sufficient to bind the oligonucleotide to the target sequence contained in the template. A nucleic acid template relating to DNA, RNA or protein under suitable conditions and any one of claims 1 to 3. contacting at least one of the cyclic oligonucleotides of one term; bind the oligonucleotide to the target and block access to the template or performs its degradation and thereby regulates the biosynthesis of DNA, RNA or proteins. A method of regulating DNA, RNA or protein biosynthesis, comprising: 31. The template includes a double-stranded nucleic acid target, and the conditions target the target by strand displacement. 31. The method of claim 30, wherein the method is effective for denaturing the cut to thereby effectuate the conjugation. 32. The biosynthesis involves DNA replication, DNA reverse transcription, RNA transcription, and RNA splicing. ng, RNA polyadenylation, RNA transport, and protein translation. 31. The method of claim 30. 33. Claim wherein the template for DNA replication is an RNA template or a DNA template. 32 methods. 34. The target of the oligonucleotide for regulating DNA replication is 34. The method of claim 33, wherein the site is an origin of replication or a primer binding site. 35. The target of the oligonucleotide for regulating DNA reverse transcription is , a primer binding site, a site in the retroviral genome or a site in mRNA. 33. The method of claim 32. 36. The target of the oligonucleotide for regulating the RNA transcription is Promoter, repressor binding site. Operators, enhancers, transcriptional regulation 33. The method of claim 32, wherein the site is in an element or mRNA encoding region. 37. the target of the oligonucleotide for regulating the RNA splicing; Targets include 5' splice junctions, intron branch points, or 3' splice junctions. 33. The method of claim 32, which is at least one. 38. the target of the oligonucleotide for regulating the RNA polyadenylation; 33. The method of claim 32, wherein the target is a polyadenylation site. 39. The target of the oligonucleotide for modulating the RNA transport is 33. The method of claim 32, wherein the poly(A) tail is a poly(A) tail. 40. 33. The method of claim 32, wherein said template for said protein translation is an mRNA template. 41. The target of the template may include a ribosome binding site, a 5'mRNA cap, or a 41. The method of claim 40, wherein is a site in a protein coding region. 42. 31. The method of claim 30, wherein the template is a viral DNA or RNA template. 43. The oligonucleotide is SEQ ID NO: 3 or SEQ ID NO: 4. 43. The method of claim 42, comprising a nucleotide sequence. 44. effective to denature the target and bind circular oligonucleotides. of the cyclic oligonucleotide according to any one of claims 1 to 3 under the time and conditions. double-stranded nucleic acid target by contacting any one target with the target. How to replace strands. 45. The conditions effective to denature the target include denaturing the rings in a ratio of about 1 to about 100. 45. The oligonucleotide according to claim 44, comprising the presence of a oligonucleotide and the target. Law. 46. The time effective to denature the target ranges from about 1 minute to about 16 hours. 46. The method of claim 45. 47. The double-stranded nucleic acid target targets viral, bacterial, fungal or mammalian nucleic acids. 45. The method of claim 44, comprising: 48. The double-stranded nucleic acid target is a source of replication, promoter, and repressor binding. site, operator, enhancer, transcriptional regulatory element or mRNA encoding 48. The method of claim 47, wherein the site is in a recording area. 49. The double-stranded nucleic acid target may be a pure or impure nucleic acid sample, tissue section, 45. The method of claim 44, wherein the method is present in a cell smear or chromosomal mass. 50. 4. The oligonucleotide is covalently bound to the reporter molecule. 49 methods. 51. A small amount of the oligonucleotide according to any one of claims 1 to 3 in the biosynthesis regulating amount. a substance that modulates the biosynthesis of nucleic acids or proteins, comprising at least one species and a pharmaceutically acceptable carrier; A pharmaceutical composition for 52. Attach a linear precycle to an end-linked oligonucleotide, and connect two of the precycles. and collecting the single-stranded circular oligonucleotide. A method for producing a single-stranded cyclic oligonucleotide according to any one of claims 1 to 3. . 53. 53. The method of claim 52, wherein said linear procyclic has a 3'-phosphate. 54. The above two ends are connected to the AP nucleotide of the single-stranded circular oligonucleotide. 54. The method of claim 53, comprising two nucleotides corresponding to nucleotides. 55. The bond is BrCN, 1-ethyl-3-(3-dimethylaminopropyl) Claim 5 carried out with carbodiimide or N-cyanoimidasol ZnC12 Method 4. 56. Formed between the nucleotide of any one of claims 1 to 3 and the target complex. 57. a) covalently linked to the oligonucleotide of any one of claims 1-3; Administer the combined drug to the animal, b) binding said oligonucleotide to target mRNA present in said cell type death, c) a specific method whereby said drug is delivered to said specific cell type. Methods of cell type drug delivery. 58. Sufficient time to form oligonucleotide-target complex Any of claims 1 to 3, wherein the sample to be tested for containing said nucleic acid under conditions and or one term of the cyclic oligonucleotide, and the complex is detected. give out A method for detecting a target nucleic acid. 59. The nucleic acid includes a double-stranded nucleic acid target, and the conditions denaturing the target thereby denaturing the oligonucleotide-target complex. 59. The method of claim 58, which is effective for binding said oligonucleotides to form a base. Law. 60. The sample may be a pure or impure nucleic acid sample, tissue section, cell smear or stain. 59. The method of claim 58, wherein the method is in a mass of color bodies. 61. The conditions effective to denature the target include denaturing the rings in a ratio of about 1 to about 100. 59. The method of claim 58, comprising the presence of a oligonucleotide and the target. Law. 62. The time effective to denature the target ranges from about 1 minute to about 16 hours. 59. The method of claim 58. 63. The complex is detected by fluorescence energy transfer assay. The method of Section 58. 64. 13. The oligonucleosome of claim 12, wherein sufficient complementarity is at least about 50%. Chido.