JPH06500559A - Metal ion-mediated receptor binding of polypeptide hormones - Google Patents

Abstract

(57) [Abstract] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Metal ion mediated polypeptide hormone receptor binding polypeptide hormone Creating mutant or, in special cases, mutant receptor-like binding proteins metal to the polypeptide hormone-receptor complex). By inserting or deleting ionic cofactor binding sites, cells, organs, or A novel method to control the response of animals to polypeptide hormones has been described. Ru.

Explanation of the background technology In the parenteral sustained release of Tuma 2-lopine in oil-based formulations, metal ions such as zinc [EP 17747 published October 4, 1984] No. 8; EP343696, published on November 29, 1989]. Metal ions in oily media A similar sustained-release formulation of growth hormone has been demonstrated [8 EP216485 released on April 1, 2017. dilute aqueous solution by forming a precipitate Metal ions were used to recover somatotropin from liquid [August 3, 1988] EP277043 released in Japan. Hormones that regulate zinc uptake by the prostate and prolactin was investigated [Leak et al., Journal in Endocrinology]. J. of Endocrinology, Vol. 102 (1), pp. 73-76, 1984]. Zinc deficiency was associated with a tendency toward hyperprolactinemia [Konopel et al. Man, Medical Hypotheses ), Vol. 25(2), pp. 65-68, 1988]. Commentary on the need for zinc in humans Brassade [Special Topics in Endocrinology and Medicine] Taborism (Special Topics in Endocrinolog) y and Metabolism), Vol. 7, pp. 45-76, 1985]. be able to.

Human growth hormone (hGH) is involved in many of the regulations of normal human growth and development. are doing. This 22,000 Dalton pituitary hormone is responsible for linear growth (body formation) , milk secretion, macrophage activation, insulin-like and diabetes-inducing effects, etc. [R., Chawla (1983), Anicoal. Review in Medicine (Ann, Rev, Med,) Volume 34, Page 519; C , Z. Dowas et al. (1988), Science 239, 76. 9 pages; M, O Soner et al. (1988), J, Chin, Invest, vol. 81, 7 page 45]. Deficiency of growth hormone in children leads to micro-orchidism, which is 1 It has been successfully treated by supinating hcH administration for over 0 years. Furthermore, hG characterized the immunological response of hGH when H is administered clinically, and To quantify circulating levels of hGH, to identify genotypes and post-translational modifications of hGH. There is also interest in the antigenicity of hGH. EUJ, Lewis (1984). ・Review in Physiology (Ann, Rev, Physiol,) 4 Volume 6, page 33].

hGH is derived from placental lactogen, prolactin, and other genetic and species variations. It is a member of the group of homologous hormones that include the variant or growth hormone [C9 S Nicole (1986), Endocrine L/Views (Endocrine Reviews) Volume 7, Page 169]. Among these, hGH shows broad species specificity. and cloned body formation 1: D, W Ljung et al. (1987), Nature, Vol. 330, p. 537] or prolactin receptor [J, M Boutin et al. (1988), Ce; Vol. 53, p. 69 j. It is unique in that it matches. The cloned gene of hGH was introduced into E. coli. It is expressed in a secreted form [C4N, Chunk et al. (+987), Gene] Vol. 55, p. 189 1, the DNA and amino acid sequences of (-) have been reported. (1979), Nature vol. 281, p. 544, Gray et al. 985), Gene, Vol. 39, p. 247]. h　G　The three-dimensional structure of H is obtained It has not been done. However, moderately isolated and purified porcine growth hormone ( The three-dimensional folding pattern for pGH) is based on the reported ES, S Abte Lumekinod et al. (1987), Producing/-Tings in the Su/Yonaru A Academy in Sciences USA (Proc, Nat 1. Acad, S ci, USA) vol. 84, p. 6434]. Human growth hormone receptors and antibodies epitopes were identified by homolog scanning mutagenesis [Kanin et al. Guha A et al., Sc1ence, vol. 243, p. 1330, 1989, 3. 10th of the month]. Human growth hormone hormone containing histidine 18 and histidine 21 Construction of a Novel Amino/Terminal Methionyl Growth Hormone Containing Rice-In Sequences [U.S. Pat. No. 4,880,910].

Human growth hormone (hGH) has been shown to inhibit linear bone growth and breast milk in various animal models. Including juice secretion, macrophage activation, insulin-like and diabetes-inducing effects, etc. produce various physiological and metabolic effects [R, Chawla et al., Anicoal et al. Review in Medicine (A n n u, Rev, Med,) 34 Volume 519 (1983); ○, G., P. Isakson et al., Anicoal Review. In Physiology (Annu, Rev, Phys io 1.) Volume 47 48 Page 3 (1985): C. K. Edwards et al. e) Vol. 239, p. 769 (1988); M. O. Thorner and M. L. Bans, J. Clinical Investigation (J, CI, Inv. est,) Vol. 82, p. 745 (1988); J, P Hughes and H, G.

Friesen, Annu, Rev. Phys io 1. ) Vol. 47, p. 469 (1985). These biological effects are It derives from the interaction between hGH and specific cellular receptors. two different h receptors, hGH liver receptors [D, W, Sx7, etc., 330, 537 (1987)] and human prolactin leukemia Scepter [J, M Boutin et al., Mo 1. Endoc　r　ino　Volume 1.3 1455 (1989)] has been cloned. However, human fetus Other receptors appear to exist, including discogenic lactogen receptors [M , free mark, M, piece 1G, :+-+-1 and S, handwager, en Docrinology (Endocrinol), Vol. 120, p. 1865 (1987)] . These homologous receptors contain glycosylated extracellular hormone binding domains. In, a single transmembrane domain, as well as an array of skin-sized Contains quite distinct cytoplasmic domains. l or more receptors, plays a critical role in the physiological response to polypeptide hormones It is assumed that.

One of the best characterized hormone binding proteins is growth hormone binding protein (GHBP). This GHBP is the extracellular domain of the GH receptor. In some species, it circulates in the blood and functions as GHBP [S I Immar, AC Herrington, Molecular Ant Cellular Endocrinology Nology (Mo1.Cel　Endocrinol　) (1985) Volume 41 1 53 pages, WC Smith, F. Talamantes, Endocrinology (Endocrinology) nol○gy) (1988) Vol. 123, pp. 1489-94 1M Mtner, P. Acta Endocrinologica ) (:+Penhagen) (1990) Vol. 122.3, pp. 296-302]. to humans GHBP has also been described [G Bauman, MW Stoller, K Ampa John, C.P. Balsano, B.C., DeVries, Journal in Clinical E. Endocrinology and Metaphorism (J, Cl1n, Endocrino 1, MetabX1986) Volume 62 + Pages 34-141, AC, Herrington, S , Immer, J. Stevenson, Nyanar in Clinical Investment. J. CIin, Invest, (1986) Vol. 77, 1817- 1823 pages]. The DNA encoding human GHBP was discovered on December 15, 1988. It is described in PCT publication number woB8109818 published in Japan.

Summary of the invention The effects of polypeptide hormones on mammalian cells, organs, or the entire mammalian body. A novel method of regulation is disclosed. The function of polypeptide hormones is determined by separate receptors. control by enabling the binding specificity of its polypeptide hormones to be done. Specificity for the receptor is that the metal ion the ability to bind as part of a complex and therefore also the binding specificity of the receptor mediated by the ability to determine A soluble variant of the hormone receptor , can be used to modulate the function or serum half-life of polypeptide hormones.

An example of such a polypeptide hormone system is that the receptor specificity is Human growth hormone (hGH) is regulated by lead. In conditions where zinc is low In other words, hGH exclusively interacts with the human growth hormone receptor or growth hormone binding protein. When bound to protein and under high zinc conditions, hGH exclusively acts as a human prolactin receptor. receptor or soluble prolactin receptor variant. This thing is money ions of polypeptide hormones and extracellular receptors or binding proteins. This is the first suggestion that it can mediate direct interactions between

Novel human polypeptide hormone variants and hormone-binding proteins with therapeutic uses Discloses protein mutants. This mutant has the metal ion binding site deleted (missing) or may be inserted. Some mutants lacking metal ion binding sites include Has the ability to preferentially bind to specific receptors as a function of the absence of lead binding sites There are hormonal variants. Specifically, human growth hormone variants are Long hormone histidine, 1 is histidine, glutamic acid, aspartic acid or is substituted with an amino acid other than cysteine, more specifically, histidine, 1 is a human growth hormone mutant in which is replaced with alanine. Furthermore, this human Growth hormone variants contain natural human growth hormone histidine, 8 and glutamine. 74 is other than histidine, glutamic acid, aspartic acid or cysteine may be substituted with an amino acid, more specifically, this may be substituted with alanine. Ru. Another human polypeptide hormone variant is the natural human placental lactogen. histidine, 6 histidine, 1 or glutamic acid, 74 histidine, glutamic acid, Amino acids other than luteamic acid, aspartic acid or cysteine, more specifically A human placental lactogen mutant in which ranin is substituted.

Disclosed are mammalian growth hormone variants other than human growth hormone. The human growth hormone amino acid histian 111% histidine or glucose The amino acids corresponding to tamic acid and 74 are histidine, glutamic acid, and asparagine. substituted with an amino acid other than phosphoric acid or/styne, more specifically by alanine It is a mutant. Other hormone variants include arginine substituted by alanine. Human Growth Hormone Variants Containing Aspartic Acid, 4 and Aspartic Acid, □1, and Alanine Human growth hormone modification containing non-1゜ and glutamic acid 1□4 Variants, substituted by alanine or gin 17. and glutamic acid, including 74 It is a growth hormone mutant. DNA encoding human growth hormone variant sequence, particularly when the variant contains histidine, 8, histidine, and glutamic acid, □4. Describe the l) NA sequence containing alanine instead. In addition, human growth The hormones histidine, 1 or glutamic acid, aspartic acid or DNA harboring a growth hormone variant that has been replaced by a foreign amino acid sequence, and the variants include histidine, 8, histidine, l and glutamic acid, 4 The DNA sequence that coats the growth hormone variant contains alanine instead of Describes an expression host transformed with a DNA sequence selected from the group consisting of do.

Further disclosed is the introduction of metal ions into mammalian polypeptide hormone receptors. A mammalian polypeptide hormone or receptor that chelates to a protein complex. The amino acids histidine, glutamic acid, aspartic acid or cysteine Reduction in the ability to chelate the metal ion by substituting / with another amino acid metal ion binding consisting of producing a hormone or receptor variant that Method of modifying a mammalian polypeptide hormone-receptor complex comprising a moiety [Here, the presence of metal ions in the metal ion binding site is determine the affinity of the hormone for its receptor. The metal ion is Zinc, iron, nickel, copper, magnesium, manganese, cobalt, calcium or may be zinc, most preferably zinc. Preferably the mammal Polypeptide hormone: 1 may be a prolate hormone or a placental lactogen .

The hormone receptors include growth hormone receptor, prolactin receptor, Lactoken receptor or serum binding protein with similar receptor properties The protein may be a protein, such as a growth hormone binding protein.

Further described is administering to the mammal a therapeutically effective amount of mammalian growth hormone. [where the amino acid sequence of this mammalian hormone is the amino acid sequence of human growth hormone] The amino acid histidine 18, histidine 2. and glutamic acid, the amino acid corresponding to 74 the mammalian growth hormone binds to the prolactin receptor. Physiological zinc ion concentration required to induce the lactation response. A method of stimulating a lactation response in a non-human mammal, consisting of maintaining , preferably the total concentration of physiological zinc ions is about 0.5 and 100.0 micromoles. to be maintained during the period. Additionally, human growth hormone binds to prolactin receptors. Physiological zinc ion concentration required to induce the lactation response. comprising administering to a human a therapeutically effective amount of human growth hormone while maintaining Also described are methods of stimulating lactation responses in humans, preferably using physiological zinc. The total concentration of ions is maintained between approximately 0.50 and ioo,o micromolar. Sara Zinc binding is necessary for human growth hormone to bind to prolactin receptors. administering to humans a therapeutically effective amount of a human growth hormone mutant lacking a binding site; Also described is a method of stimulating somatoplastic responses in humans, comprising:

Mutations in mammalian polypeptide hormones thought to contain metal ion binding sites [Here, gold in the metal ion binding site is The presence of genus ions indicates the affinity of the hormone for mammalian hormone receptors. ], solutions containing chelating reagents and metal ion binding sites are recommended. incubate the mammalian polypeptide hormone variant to be measured; Contacting the incubated mammalian polypeptide hormone with the hormone receptor and finally detecting the formation of the polypeptide hormone-receptor complex. A method consisting of the following is described. This method applies to zinc, iron, nickel, copper, and magnesium. a metal selected from the group consisting of aluminum, manganese, cobalt, calcium or selenium ions can be used. Preferably a mammalian polypeptide hormone The variant may be a variant of growth hormone or placental lactogen. mammal The object may be any mammal, preferably humans, cows, pigs, sheep, horses, cats, dogs and Selected from the order Orthodontia.

In addition, mammalian prolactin binding, including soluble prolactin binding protein Protein variants are described. Preferably this soluble prolactin binding protein Prolactin is a human prolactin-binding protein. human prolactin binding tanno One variant of protein is histidine, 88 is histidine, glutamate, asno (substituted by an amino acid other than lachinic acid or cysteine, preferably alanine) has been done. Furthermore, asparagine TL in human growth hormone-binding tannocorporeal protein Other amino acids are inserted in place of the corresponding amino acids, resulting in metal mammalian growth host, preferably provided with the ability to bind zinc. Lumon binding proteins are described. The inserted amino acid is preferably histidine. glutamic acid, aspartic acid, and cysteine. The most preferred form is It is a growth hormone binding protein. These GHbP substances are In a medicinal formulation consisting of hormones, mammalian growth hormone binding protein and zinc. This mammalian growth hormone-binding protein can be incorporated into is an amino acid with histidine, glutamic acid, aspartic acid or cysteine. contains an acid substitution, creating a zinc-binding site]. A preferred formulation is asparagus Gin, human growth hormone binding protein in which 18 was replaced by histidine. contains.

Human growth hormone variant of human growth hormone [here, this variant is histidine 1 11. Histidine 2. and glutamic acid, containing alanine in place of 74 (X The DNA sequence encoding the protein is described. Soluble human prolactin receptor The DNA sequence encoding the human prolactin protein The receptor is histidine8. Preferably the amino acid position by alanine is tXj including the exchange is also written. In addition, human growth hormone-binding tanno-f Asparagine 1111 is associated with histidine, glutamic acid, and Asunokuragi. encodes an amino acid substituted with an amino acid selected from amino acid and cysteine. Also described are the DNA sequences. These DNA sequences can be incorporated into an expression system. I can do it. The expression host is 1) histidine of human growth hormone, l is glutamine acid, asno (substituted by an amino acid other than lagic acid or cysteine) DNA sequence encoding a growth hormone variant, 2) soluble human prolactin DNA sequence encoding the receptor: 3) histidine + gluta at ss Soluble human containing amino acid substitutions with minic acid, aspartic acid or cysteine DNA sequence encoding prolactin receptor, 4) histidine, □ is encodes a soluble human prolactin receptor that is replaced by ranin. DNA sequence: 5) Human in which asparagine, I, is replaced by histidine a DNA sequence encoding a growth hormone binding protein; Figure IA: hPR into the periplasm of E. coli Diagram of plasmid phPRLbp(1-211) that directs the secretion of Lbp. genetics Children are indicated by arrows and origins of replication (ori) are indicated by circles, indicating the constraints used for assembly. Restriction sites are shown.

Figure IB: Coomassie blue-stained 5DS-PAGE of purified hPRLbp (12 °5%; ref, 27). Column 15 shows 1) E. coli periplasmic fraction, 2 ) (NH,), SO4 precipitation, 3) hGH affinity affinity chromatography protein , 4) washing solution immediately before elution of hPRLbp, and 5) molecular weight standard 1 (14 to 97k D range).

Figure 2: 0.1% BSA, 140mM NaCl, 10mM MgCl, 2 hPR in the presence of 0 mM Tris (pH 7,5) and various concentrations of total ZnCl. Binding of “!5I]hGH to Lbp. hGH and hP in a defined 1:l ratio. RLbp (0.01 nM final) was added at 1% in the presence of ZnCl, at the indicated concentrations. Incubate for 6 hours and bind [l! 5 ■ hGH against hPRLbp Immunoprecipitation was performed using an affinity-purified rabbit polyclonal antibody.

Figure 3: hGH-hPRLbp? 66Zn to JF union! flat for the union of Equilibrium dialysis.

Figure 4: Proposed Zn on hGH that mediates binding to hPRLbp Binding site. The prominence of the helical ring is due to the polarity (shaded) on one side of the helix. ) and charged residues (black) and nonpolar (white) residues on the other side. The amphipathic nature of helices 1 and 4 is shown. hGH against hPRLbp Position H4518 of the putative zinc-binding ligand involved in binding, His2 1 and Glu174 are shown (★). The region where hGH binds to hGHbp is shaded. Mushroom R1 is shown roughly below. Residues marked with symbols ・, ・, ・ and ○ ( However, an alanine mutation in hGHl reduces its binding affinity for hGHbp. 2 LSL 4 times, 4 to 10 times, reduced by 10 times or more, or increased by 4 times, respectively. Represents a part.

Figure 5 = Human prolactin and human adult purified after expression in the colon. Amino acid sequence of the extracellular domain of the long hormone receptor. human growth hormone binding protein (shghr) (SEQ ID NO: 1) and human prolactin-binding protein, f The following example illustrates Shprlr (SEQ ID NO: 2). Each bonded tannocorporeal substance (±membrane The transparent areas are removed. "*" indicates the same amino acid in both sequences.

Figure 6 = hGH and hPRL binding proteins for binding to [1″51]hGH. /＜Conflicting question. The inserted graph shows the Ko between hGH and hPRLbp. In order to calculate (68 pM), we used a scanochard plot (1 This shows the data that was created.

Figure 7: Folding of pGH determined from X-ray structure with 2.8 angstrom resolution. Structural model of hGH based on the diagram. tfnel A is hPRLbp epitope A functional map is shown, panel B shows that previously determined for hGHbp. g Self-numbers (・, ・, ・ and buttons indicate that alanine substitution is the size of each receptor-binding domain. binding affinity of 2 to 4 times, 4 to 10 times, and 10 times (A and 80f), respectively. @, also; represents a site that is reduced by 80 times. hat-tbp epitope ( ○ (±, indicates position E174A that increases the binding affinity by more than 4 times) in Was. ) Kunel C (yo, alanine mutants are hGl (bp or h PRt, bp+ increases the binding affinity without substantially affecting the binding to hP+. ≧10 times (b) against RLbp, and ≧5 times (■) against GHbp ( Indicates the area to be covered. Symbol (mu) (yo, alanine mutant binds to both receptors) Indicates the site that inhibits ≧10 times.

Figure 8 Direct array number 3). The entire DNA sequence of pBO475 and the amino acid sequence of hGH Column.

Description of preferred embodiments There is a need to understand the molecular basis for hGH's pleiotropic receptor binding. Therefore, the present inventors investigated the connection between hGH and its cloned liver receptor. We undertook a systematic analysis of the binding determinants [B.C., Cunningham, P., Jura-12, P. , Ng and J.A., Wells, Science 243 1330 Page (1989): B. C. Cunningham and J. A. Wells, S. 244, p. 1081 (1989)]. In the present invention, the inventors, etc. extended this attempt to the hPRL receptor, and Zn” required for tight binding of hGH to but not required for binding to the hGH receptor I discovered that. Furthermore, metal ions that determine receptor binding specificity This ability also indicates that a new mechanism of regulation of polypeptide hormones has been discovered. It is.

A large amount of human prolactin receptor as a protein secreted from E. coli ( hGH receptor-zinc interaction using the extracellular binding domain of hpRLbp) The molecular details for this were determined experimentally. between hGH and purified hPRLbpO In optimizing the binding reaction, we determined the binding parent of hGH to hPRLbp. By adding 50 μM of ZnC1t, the compatibility was increased approximately 8000 times (KD increased from 270 nM to 50 μM). 0.033 nM).

Prior to the present invention, metal compounds complexed with polypeptide hormones and receptors of the receptor binding specificity of a polypeptide hormone determined by the presence of on. There were no known cases. The binding specificity of polypeptide hormones and hence their physiological The ability to alter effects allows for therapeutic modulation of hormonal responses that was previously impossible. make it possible. An example of this specificity is the relationship between human growth hormone and its receptor and zinc. complex formation, such that the relative receptor binding specificity is human prolactin receptor (body formation reaction at low concentrations of zinc) Changes to scepter (lactation response at high concentrations of zinc).

A Definition In the case of autocrine hormones, polypeptide hormones are to receptors on one type of cell or, in the case of non-autocrine hormones, on a second type of cell It binds specifically to the receptor on the body, causing physiological Any amino acid sequence produced in the first cell that results in a reaction stomach.

Some of these polypeptide hormones include cytokines, lymphokines, and neurotransmitters. Affinity hormone, as well as growth hormone, prolactin, placental lactochene, corpus luteum agonizing hormone, follicle-stimulating hormone, thyroid-stimulating hormone, chorionic gonadotropic hormone , corticotropin, alpha or beta melanocyte stimulating hormone, beta lipotropic hormone Anterior pituitary polypeptides such as mon, gamma-lipotropic hormone and endorphins Hormones; fluticotrobin-releasing factor, growth hormone release-inhibiting hormone, growth Hypothalamic releasing hormones such as hormone-releasing factor, as well as in/nilin, incin Urin-like growth prisoners ■ and II, and atrial natriuretic peptides A, B, and There are other polypeptide hormones such as C.

2. Metal ion cofactors are complexes with polypeptide hormones and/or receptors. Any compound that increases or decreases the affinity between hormones and receptors. It can be a divalent metal ion. Preferred metal ions include zinc, iron, nickel, and copper. , magnesium, manganese, cobalt, calcium or selenium. the metal Ions can contain any physiological ions such as chloride, phosphate, acetate, nitrate and sulfate. It may be any acceptable salt.

3. The variant polypeptide sequence notation method is as illustrated in Table 2. Define the actual amino substitutions in the mutant polypeptide. Regarding the mutant consisting of 0, Substitutions include a letter representing the original amino acid and the position of that amino acid in the polypeptide. and a second letter indicating the substituted amino acid. Therefore Each substitution is represented by a letter, followed by a number, then a letter. example For example, H18A in Table 2 has the first letter and number (II8) as unmodified hGH. This corresponds to the amino acid histidine at position 18. The last character is replaced at that position. (A or alanine).

4. The nomenclature for amino acids and polypeptide sequences is as follows: Residue 3 letter symbol 1 letter symbol Glutamic acid Glu E Glutamine Gin Q Asparadic acid Asp D Asparagine Asn N Methionine Met M Phenylalanine Phe F B. Mode of implementing the present invention ■) Kasa Atsushi-za! -bi (severe p 壓zu) A given polypeptide binds to a given receptor. The determination of whether a given metal ion and one Common divalent and trivalent metal chelating reagents, such as EDTA, or 1,1o This can be done by using transition metal chelating reagents such as phenanthroline. I can do it. 140mM NaCl, 20mM Tris (pH 7,5), 25°C (or salts and buffers in the serum) under similar buffer conditions to mimic agricultural production. in the range of 5 to 11000 II, and a metal oxide or metal buffer complex. A polypeptide hormone (10 -100 pM) and potential receptors (10-1000 pM). Nihet. receptor in the presence of metal ions and in the presence of a suitable chelating reagent. Differences in the amount of polypeptide hormone that binds to receptors may affect receptor binding. It is an indicator of the requirement for genus ions.

For example, zinc ions are necessary for hGH to bind to prolactin receptors. To determine whether hGH is Lactin receptor binding region (1010100p) along with zinc (5 0aM). hGH to prolactin receptor Measure the level of binding. Next, a second assay is identical except that no zinc is added. , a bovine rate reagent such as EDTA is added to the incubation mixture. In addition, the degree of binding of hGH to the prolactin receptor is determined by adding zinc. It is determined by subtracting the value obtained by multiplying EDTA by 0. Differences in joins It is an indicator of zinc ion requirement for lactin receptor binding.

Determining metal ion specificity and pharmacology of Zn'° hGH-hPRLbp complex We analyzed the relationship between The total concentration of zinc in serum ranges from 5 to 20 aM in the adult population. Edited by EC Rentner, Scientific Tables (Sci entific Tables) 8th edition (Chihakaiki Ltd,, Arsle New York, 1981), 3@79-88, R. Berfenstam, Ak. Acta Paediat (Uppsala) 41, Supplement 8 2 (1952)], about 95% protein, mainly in complex form with serum albumin. [Solan Usuyung, Neuroendocrinology] oendocrinol, ) vol. 45, p. 233 (1987); M, C, S, Konope Lemans, ■, Greenou, D., J. Thorne and P., Tenstar, Journal I. Clinical Endocrinology and Metaphorism (J, CI in , Endocr 1nol, Metab,) Vol. 68, p. 215 (1989) 11° Therefore, the free Zn'' concentration in the serum ranges from about 0.1 to 5.0 aM or More preferably it is expected to be in the range of about 0.25 to 1 pM. This is hG The addition of (04±02 μM) to the binding of Zn′″ to the H-hPRLbp complex This indicates that natural variations in the total concentration of zinc are associated with hGH and hPRLbp. This shows that the interactions between i coalescence can be modulated.

All metals are bound to serum proteins, especially serum albumin and metallothionenes. Since there is some degree of competition between It is nearly impossible to reconstitute serum so that it can be tested independently under these conditions. Therefore, It is difficult to translate our in vitro studies into physiologically relevant settings. .

Nevertheless, in the presence of 0.1% (w/v) BSA (metal free), h GH binding to hPRLbp is regulated through physiologically relevant total zinc concentrations. (Figure 2). Under these conditions, we found that various divalent metal ions at physiological concentrations The ability to mediate binding between hGH and hPRLbp was evaluated (Example 2, Table 5). ). In 6QpM of hGH and hPRLbp, 20ttM of Zn''' is hG H and hpRL bp complex formation by about 50%, while other metals , none promote substantial binding at their maximum expected marginal serum concentrations. h At much higher concentrations of GH and hPRLbp (5 nM), zinc Supports complex formation. This includes polyclonal antibodies and polyethylene glycol represents the maximum amount of complex that can be precipitated in our assay using . Other than supporting the complex formation of Cu'° and Ca2' or 29%, other metals had no effect. There is no However, the presence of 5mM CaC1t or 20μM CuSO4 Dissociation constant (skip) of binding of hGH to hPRLbI) (determined by Charochart analysis) were 21 (:5 nM) and +1 (±3), respectively. It is r+M. These affinities are related to zinc-mediated complexes (0.03% M, Table 1). ) is 300 to 600 times weaker. Therefore, only zinc, hGH and hPRLb It can also support strong bonds between p. However, metal ions in the pond or other functions similarly in the polypeptide hormone-metal ion-receptor complex. It is possible.

Zinc plays a central role in many endocrine functions, including the action of growth hormone. JA, s Brassade, Cl1n, Endocrinol, Metals .

Vol. 14, p. 567 (1985) E. Zinc deficiency often occurs in alcoholism, pregnancy , some gastrointestinal disorders, severe burns, chronic renal failure, genetic diseases (acrodermatitis enteroenteritis and and sickle cell anemia) and are associated with malnutrition. Moderate zinc deficiency causes growth retardationε A, WAm, G, Takenodo, M, Sweetrant and E, O, Reiter, Ja. Null in Ninitori/gun (J, Nutr, Vol. 009, p. 958 (19 79); G, Honor, B Homic and R, M Bara, Endocrino o/-(E ndocrinology) 114 to 1860 pages (+984): S Kurtge, TE, Patiloglu and SE4 Caracas, Tokai Journal in Ek. Experimental and Clinical Metison (Tokai J, Exp, Cl1n, Med,) Volume 12, 325E ((1987): Yen et al./Yarnal. In no American College In-=,-hs/9　(J, Am, Co l 1. Nutr, ) Vol. 8, p. 93 (1989): and hyperprolactin Bloodemia CM, C-Novelman, Medical Hypothesis (Med, Hypot) heses) 25 @ 65 pages (1988). Our data indicate that zinc The possible molecular basis for the association between the deficiency of growth hormone and changes in the action of growth hormone. This is what we provide.

Zinc is an important regulator of transcription, especially the zinc finker protein, which is a key regulator of transcription. 'LA, crannog and Biri, Rose, Tre/Z in Biochemical Scieno/Z nd sn Biochem, Sci,) vol. 12, p. 464 (1987); R , M, X Vans and SM, Ho L/7 Berg, Cell (Ce 11) Volume 52, Page 1 ( 1988); J, M Barb, Cell 57, 1065 (1989) ]. Inulin is accumulated in a complex with zinc in secretory granules of pancreatic cells. [J, C, Hynoton, Experientia (Experient 1a) Vol. 40, p. 1091 (1984): G. Gold and G. M. Grotsky, Ex. Berientia (Experient 1a) Volume 40, Page 1105 (1984)] . Our research has shown that zinc is the link between polypeptide hormones and extracellular receptors. Zinc's influence on hormone action by showing that it directly mediates the interaction of It expands the relationship. Zinc promotes binding between hGH and hPRLbp The discovery that a highly purified structure free of cell debris and metal ions It is critically dependent on obtaining the essential protein.

As more purified hormones and receptors become available, zinc or other metal ions directly involved in other polypeptide hormone-receptor interactions. If it turns out that they are giving, they will be criticized.

Measurement assays include cell surface bound receptors, partially purified receptors, or any supply of receptors, including receptors produced by or by recombinant means; source can be used. Polypeptide hormone-metal ion-receptor complex Formation of coalescence can be determined using conventional techniques such as radionucleotides, enzyme immunoassays, or precipitation. It can be detected by the assay method used. General as described in Example 1 The method can be applied to metal ions for any specific polypeptide hormone and receptor. can be adapted to determine the requirements of

2) Determination of hGH zinc requirement Expression of hPRLbp and requirement for zinc ions determined for hGH mutants did. In order to test the binding of a number of hGH variants to the hGH receptor, we We present a large amount of highly purified extracellular material provided by the E. coli secretion system. Depending on the source of the binding domain (hGHbp) [G. Biological Chemistry (J, Bio 1.Chem,) 265 Volume 3111 (1990)]. In a similar manner, the extracellular domain of the hPRL receptor was In(hPRLbp) was expressed and secreted into the periplasm of E. coli (Figure IA). child hPRLbp was homogenized by hGH affinity chromatography and gel filtration. (Figure IB). purified hPR Lbp is a single protein with the expected molecular weight (25kD) on reduced 5DS-PAGE. gave the band. Purified hPRLbp is purified by proper cleavage of the signal peptide. The amino terminal sequence Gln-Leu-Pro-Pro-Gly-Lys-Pr It had o-Glu-I Ie-Phe-Lys.

Initially, the binding of hGH to purified hPRLbp was attributed to The binding was weaker and highly variable compared to that with purified hPRLbp. series of By dialysis experiments, chelating reagents, and treatment with divalent metal ions, hPRLbp It has been shown that zinc is required for the tight binding of hGH to. [+-J]) .

Hormone was determined by titration with ZnC1 at constant concentrations of GH and hPRLbp. Formation of Mon-receptor complex is optimal at 50 μM ZnCl. was confirmed (Figure 2).

Under these conditions, hGH binding to hPRLbp inhibits EDTAlmM. It is about 8000 times stronger in the presence of 50 μM ZnCIt than in the containing buffer (according to the Example 1, Table 1). In contrast, the binding constant of hPRL to hPRLbp is Both conditions are essentially equivalent to producing full-length recombinant hPRL receptor (2- 3 nM) close to the value previously measured for [G Hu et al., Journal Inn. ・Biological Chemistry (J, Biol, Chem,) Volume 265, 311 1 page (1990)]. Moreover, for hPRLbp in the presence of ZnCl, hGH binding is almost 100 times stronger than hPRL, and hGH's affinity for hGHbp 10 times stronger than sex” - strong. Scanochard analysis uses one hormone for - Due to the stoichiometry of hPRLbp, the binding of hGH is determined in the presence or absence of zinc. This indicates that the hormone binding on hPRLbl competes with hPRL. This suggests that the joining sites are partially overlapping. On the other hand, zinc actually reduces the affinity of hGH for hGHbp by 4-fold, and prolactin Does not bind hGHbp in the presence or absence of ZnC1f. Like this, two In addition to their well-known hormonal specificity, the receptors for It has requirements for metal ions.

The interpretation of studies of hGH binding to receptors on cultured cells or tissues is that this These materials usually contain both prolactin and growth hormone (GH) receptors. Therefore, there were often problems. To identify these receptors, researchers Traditionally, non-primate GH or prolactin have been used. Inventors' data The reason is that the binding of hGH in the presence of Znto or EDTA is This suggests that receptor groups can be easily distinguished. For example, ZnC1, promotes the binding of hGH to adipocytes in rats [A, C Herrington, Biol. Chemistry International (Biochem, Int.) Volume 11, 853 (1985)], which suggests that these cells contain prolactin-like receptors. It suggests that. Furthermore, the binding of hGH to the prolactin receptor was Analytical studies should adjust for the presence of zinc. For example, in the cell membrane IC for hGH binding to recombinant full-length hPRL receptor at .

The value was reported to be 0.26 nM [G Hu et al., Journal in Biol. Dical Chemistry (J, Bio1.chem,) Volume 265, Page 3111 (1990) K of hPRLbp in the presence of 50 μM zinc. Value 0.03nM 22-3n [J, Ray et al., More cular endocrinology (Mo 1. Endo cr i no 1. ) Vol. 4, p. 101 (1990)]. This discrepancy is due to the fact that the actual receptor This seems to reflect the difference in affinity between the two. However, previous research has does not regulate zinc levels in the body.

Zinc binds to a single site at the interface of hGH and hPRLbp. @57. Equilibrium dialysis experiments using nC1 were carried out with hGH and hPRLbp at a ratio of 1:1 (maximum). Affinity of zinc for hGH-hPRLbpi complex and stoichiometry were determined (Example 1, Figure 3). Zinc is hGH-hPRLbp complex 12 μM of hGH-hPRLbll) complex that binds to one site in the body in a non-coordinating manner. The maximum level of bound Zn''' in the presence of is 10 μM), this experiment and Average K derived from several independent experiments (not shown). is 0.4 ( ±0.2) μM.

Tight binding of zinc requires the presence of both hGH and hPRLbp, which suggests that This suggests that the zinc site is at the interface of the complex.

(Hereafter, margin) strongly mediates hGH binding to hPRLbp in the presence of ZnCIr. Scanning-mutation analysis was performed on approximately 12 side chains of hGH (actual). Example 10). Among these residues, His18, His21, and GIu174 Only the side chain of is a good candidate ligand for the coordination of Zn''. A model of hGH assembled by homology to the fold diagram reported in When mapping on a file, these three residues are clustered together (Example 1, Figure 4) [S,S.

Abdelumekinod et al., Pro 7 Zonings in the National Academy -・In Sciences (Proc, Nat 1. Acad, Sc i,) U, S, A, vol. 34, p. 6434 (1987)]. His18 and His21 are It is on the adjacent windings of Rix 1, and near GIu174 of Heli and Kus 4. To position. All three are facing the same direction, and Zn! ″ to form a suitable site for bonding. There is. In the presence of zinc, His18, His21 or Glu174 When either of these is replaced with alanine, the affinity of this hormone for hPRLbp is It is about 100 times lower than wild type hGH (Example 1, Table 2). however In the presence of 1mM EDTA, the association between these mutants and wild-type hGH was significantly reduced. There is almost no difference in affinity.

Other alanine variants that prevent hGH binding to hPRLbp include zinc or The presence of EDTA produces the same reduction in binding. This means that hGH-hPRL Zinc binding to the bp complex is dependent on His18, His21 and GIu174. mediated by side chains. His18, H1s21 and Glu1 Asp171 proximal to 74 (Example 1, Figure 4) is also a zinc ligand. This suggests that it is However, the D171A mutation did not change the binding of hGH and hPRLbp in (Example 1, Table 2).

His18, His21 and Glu174 in binding zinc to hPRLbp To further evaluate the direct association of Low concentration of asZn! The binding of 1 was analyzed by equilibrium dialysis (Example 1, Part 1). Table 3). The ratio of bound Zn” to free Zn’” compared to wild-type hGH is dramatically reduced for these three mutants. This data is based on these The binding-interfering effect caused by the alanine substitution of the hGH-hPRLb group It has been shown to correlate with the interference of zinc binding to pi coalescence.

The model of the zinc binding site on hGH (Figure 4) allows for the production of non-primate growth hormone. could explain weak or undetectable binding to loractin receptors .

Sequences of non-primate growth hormones (C, S, Nicol, G, L Mayer) ,S.

M51 Cell, Endocrine Rev, Volume 7 169 (1986)], all 19 non-primate GHs contain His21 and Glu1. 74 or G1n18 instead of His18. Xing Interestingly, 17 of the 19 non-primate GHs contain histidine at position 19 ( hGH contains Arg19). However, His19 and HIS21 are the law of nature.

Since it is on opposite sides of lath 1, Hi s 19 coordinates zinc with His 21. (Figure 4). Heat theory, prolactin receptors of these two GH subgroups Significant differences in binding affinity for the Other differences may also contribute.

In recent years, a natural hGH mutant known as hGH-V has become a lactogen receptor. was shown to bind more strongly to somatoform receptors than to receptors [J. Ray et al. Journal in Biological Chemistry (J, Bio 1.ch Em, ) vol. 265, p. 7939 (1990)]. This homolog is 191 of hGH. Of these, only 13 residues differ [P, +-+ nobarb, DN] A, Vol. 1, p. 239 (1982). Notably, Hi s l 3 and Instead of His21, hGH-V contains Arg18 and Tyr21 . The present inventors' research has shown that hGH-V binds Zn'' which coordinates with the hPRL receptor. and that this or that is the main reason for the weak coupling. Ru.

The zinc binding site is located at the edge of an epitope that has been identified to bind to the hG H receptor. (Figure 4). This model shows the binding of zinc or hGHbp sterically. By inhibiting the binding of hGH to hGHbp, (Example 1, Table 1). The present inventors from GIu174 to Ala It was shown that the binding to hGHbp was enhanced by about 4 times by mutation of .

That is, while Glu174 prevents the binding of hGH to hGHbp, This is required for zinc-mediated binding to hPRLbp.

Zinc typically coordinates with four ligands in proteins [B, L Vari - and A. Gartes, Advances in Enzymology and Related. Areas in Molecular Biology (Adv, Engineering) mol.

Re1. Areas Molec, Biol, ) vol. 56, p. 283 (1984): A, Kuranob and Ri, Rose, Trends in Biochemical Sciences (Tr ends in Biochem, Sci,) vol. 12, p. 464 (19 87); R, M Evans and S, M Hollenloog, Cell 52 vol. 1 Page (1988); J.

M Loop, Cell, Vol. 57, p. 1065 (1989). hGH-derived three Both hGH and hPRLbp strongly bind to zinc. With the understanding that the fourth ligand was hPRLbp We evaluated the possibility that it was derived from The inventors are retained by hPRLbp. We reasoned that the best candidate missing from hGHbp would be a His or Cys residue. h Sequence of PRLbp [J, M. Boutin et al., Mo1. Endocrinol, 3 Volume 1455 (1989)] of the four GHs [W, C, S Miss, J. Kunyosi, F.

Talamantes, Molecular Endocrinology (Mo 1. Endocr In.

1) Vol. 3, p. 984 (1989): L. S. Matthews, B. Embarb, G. No. - Suchit, Journal in Biological Chemistry (J, Bi) o1. chem,) vol. 264, p. 9905 (1989) and four PRL recipes. Sequence of Pter [J, M Boutin et al., Ceno Collection CeI I) Vol. 53, p. 88); J.A., Davis, D.1. H.

Lintzer, Mo 1. Endoc r i no Volume 1.3 Page 674 (198 9); M, -C Pree et al., Pronoddings in the National Academy Me in Sciences (Proc, Nat 1. Acad, sc i,) U, S, A, Vol. 85, p. 2112 (1989) If you line them up, His159, Cy s184 and His188 are completely conserved in all PRL receptors. However, this is not the case for GH receptors.

The present inventors separately identified His159, His188 and Cys184 as alanine. and expressed them in E. coli. These hPRLbp mutations Among the variants, only H188A showed a decrease in binding affinity (Example 1, Table 4).

In fact, the binding affinity for hG It decreased by more than 2000 times. This is below the limit of accurate measurement in the assay. Ru.

Analysis of the mutations showed that zinc has three hGH-derived ligands (His18, His 21, Glu174) and one ligand derived from hPRLbp (His188 ) supports a model that is connected by

3) Structure of hPRL receptor binding site on hGH hGHbp and hPRL Determine whether the epitopes on hGH to bp are partially overlapping Therefore, we wondered if hPRLM could be replaced with hGHbp derived from hGH. I analyzed what. hPRLbp competes with hGH-derived hQl (binding protein). (Figure 6), indicating that the binding sites of the hormones are partially overlapping. This suggests that The binding affinity of hGH to hPRLbp is Zn It is enhanced >8000 times in the presence of Clt (Table 1). hGH derived from hGH Dissociation of hGH-hPRLbp1 association measured here by competitive displacement of bl) constant (68 pM) compared to hPRLbp under equivalent concentration of ZnC1, (25 μM). It is almost the same as that measured by direct binding of hGH to. higher A high concentration of ZnCl, (50 μM) induces optimal binding between hGH and hPRLbp. (Kn = 38 pM; Table 10), while such ZnCl, The concentration of hGH decreases the affinity of hGH for hGHbp by up to 4 times.

To further localize the epitope on hGH to hPRLbp, homologues Scanning mutagenesis [B, C, Cunningham, P Nyula, P, Ng and J. A. Wells, Sc1ence, vol. 243, 1330-13. Page 35 (1989) Table 10). In this attempt, the unbound homolog cells derived from pGH or the binding competent homologs hPRL and hPL. Mutants of hGH containing fragment substitutions (7 to 30 residues in length) were expressed in hPRLb The binding to p was analyzed. segment of pGH, namely pGH(11-3 hGH mutants, including 3) and pGH(57-73), This caused significant confusion in binding affinity (in contrast, pGH(48-52) had no effect). stomach. As expected, from the binding competent hormones hPRL and hPL. Virtually all substitutions tested do not prevent binding to hPRLbp. the only The exception is hPRL (22=33), which has a high binding affinity for hPRLbp to > 15 times lower than the last. That is, binding to hPRLbp is Mutations near the central part of heli/ras l and the loop region between residues 57 and 73 very sensitive to.

Some of the segment-substituted variants have a substantial effect on receptor binding preference. Table 10), which leads to changes in hPRL and hGH receptor epitopes. This suggests that the groups are not identical. For example hPRL(22-33) or p The binding affinity of GH(11-33) is higher for hPRLbp than for hGHbp. 18 times and 130 times lower, respectively. In contrast, hPL(56-64) and hPRL(54-74) has little effect on binding to hPRLbp; showed weak binding to hGHbp with factors of 30 and 69, respectively. These preferential receptor binding effects on GH mutants as well as some models Unaltered binding properties for noclonal antibodies due to decreased receptor binding affinity This is due to changes in the local structure of the mutant hormone and is not due to changes in the overall structure. It shows that it is not due to

Next, the present inventors identified a specific protein in hGH that strongly modulates binding to hPRLbp. The side chains were identified by alanine-scanning mutagenesis (Table 11). Conclusion Homologues included in the combination - alanine in the two regions involved in scanning - scanning In addition to scanning, we scanned the helix 4 region. Because This is because it is structurally located between helix 1 and the 54-74 loop region ( Figure 7). Alanine causes a >4-fold decrease in binding affinity for hPRLbp Substitutions were made in the central part of helix 1 (residues His18, His21, and Phe2 5), loop regions (including IIe58, Asn63 and 5er62) and helicopter.

Middle of last 4 (Arg167, Lys168, Lys172, Glu174, P including he176 and Arg178). These 12 residues are When mapped onto the hGH structural model, a section is formed (FIG. 7A). helicopter The most disruptive alanine substitutions in helix 1 and helix 4 project in the same direction. ing. Three of these residues (His18, His21 and Glu174) and His188 from hpRt, bp is a high-affinity hGH-hPRLbp1 It is thought to contain the binding site for Zn''' necessary for coalescence.

Analysis of mutations reveals epitopes on hGH for hGHbp and hPRLbp. Figure 7 shows that there is a significant difference in the results. For example, Zn''' is combined If the net charge of the epitope on hGH to hPRLbp is +5 (affinity (defined by residues that cause a ≧4-fold decrease in sex) (FIG. 7A). This strong positive electric current The cargo population consists of a series of essential hydrophobic residues, Phe25, l1e58, T)' It is surrounded by r164 and Phe176. Zinc is hGH-hGHbp1 combination hGHbl) epitope (Fig. 7B) is particularly small in electropositivity. (the net charge of residues that cause ≧4-fold interference is +1). Overall, hPR The Lbp epitope is oval in shape compared to the more circular hGHbp.

Residues that cause large changes in receptor binding affinity may be due to indirect structural effects. seems to bring about this. In fact, all of the single mutants tested either hG This product retains complete binding affinity for all H monoclonal antibodies. The inventors believe that most of these disturbing effects are due to local structural changes. It is growing. Furthermore, mutants often lead to altered receptor binding preferences. , does not lead to interference with affinity for both receptors (Table 7).

In recent years, Ray et al. i n.

1) Residue 32 in hGH according to Vol. 4, pp. 101-107 (1,990) 1 to 71 or residues 72 to 125 are rat GH (rGH) or rat PRL (rPRL) sequence in rat or rabbit liver mice. This leads to changes in binding to closomes, which in turn lead to changes in binding to the PRL and GH receptors, respectively. It has been shown to be used as a crude source of rP residues 32-71 of hGH Their reported interference with substituting RL or rGH is discussed herein. The results are consistent with the data presented in the book. However, hGH induced by rPRL Substitutions of the 54-residue segment (residues 72 to 125) result in both GH and PRL receptors. It causes 10 to 1000 times more interference to the target. They believe that this sequence represents the GH receptor. Although we conclude that these proteins contain important binding determinants for Nor have we established the structural integrity of this mutant. The inventors The data (Table 1O) show that substitutions of short hPRL sequences in this region of hGH (remaining groups 88 to 95, 97 to 104, and 111 to 129) are highly purified. Retains high binding affinity for both hGH and hPRL binding proteins to show that

Furthermore, the structural integrity of the hGH mutants was confirmed by monoclonal binding experiments. confirmed. Furthermore, the present inventors have determined that the binding affinity of hPRL to hGHbp is , previously determined for hGH binding to hGHbp by alanine-scanning. 6-fold higher than hGH by introducing only 8 residues identified as important. It was shown that it can be enhanced up to These residues (S62, N63, E66, D1 71, R174, T175, R176 and R178) between positions 72 and 125 There is nothing. Segments 72 to 125 correspond to the overall structure of this hormone. seems to be the definitive answer (this is the result of four α-herinolas segments) (including two of these), but our data indicate that hormone-receptor binding is does not support its direct involvement.

Design advanced analysis functional data of receptor-specific mutants of hGH are based on hGHbp and hpRt, bp epitopes (Figures 7A, 7B) may be partially or completely overlapping (Figures 7A, 7B). This shows that it is not the case that the For example, 11e58, Lys172 and Phe 176 is important for binding to either receptor (Figure 7C). another decision The fixed groups are more important for binding to hPRLbp (especially the Zn” site). Other determinants are important for selective binding of hGHbp (particularly P he10, GIu56, ASp171, and Arg64). These data are , all of the binding determinants that recognize hGH are present in hGH and hPRL receptors. This suggests that they are not the same.

If the change in receptor binding free energy is additive, then the two receptors Highly specific hGH by binding selective single alanine mutants It must be possible to design a similar variant. In fact, the binding of hPRLbp is Combining two single mutants (K168A and R174A) that inhibit The double mutant showed a 35,000-fold change in binding preference for hGHbp. (Table 12). Binding preference for hPRI-bp over hGHbl) can be increased approximately 150 times by combining Rf34A and D171A. can. These receptor-selective hGH mutants (K168A, R174A or R64A, Dl, 7IA) are the preferred receptors (hGHbp or h PRLbp). for both receptors It is also possible to reduce the binding at the same time. For example, both receptors individually When K172A and R176A are combined, which greatly reduces the binding affinity for Much greater inhibition of affinity than either of the two single mutants (500 to 8000 times).

In all these examples, the change in the bond free energy (△△Gbdl,,l I) is highly additive (Table 13). Such simple additivity can be used to A highly efficient method for producing hGH mutants with receptor-binding affinity and specificity. Provide powerful tools.

The existence of two or more receptors or receptor subtypes is known. There are several examples similar to hGH. For example, adrenergic receptors [M A Kaneri, G, G, Chitti, J Ablebaum, B, G, Crean, N S Heinis, and M.L. Bain/Yarnal Sub Biological Chemistry Tory (Jb i o 1. Chem,) Vol. 264, pp. 2199-2202 (19 89) I; IGF-Luceptor “MA Power/Eri, GG Chic, J Abulba Um, B.G., Green, N.S., Heinis, and M.L. Bain, Journal. Sub-biological chemistry (J, bio 1.Chem,) 264 Volume 2199-2202 (1989)]; IL-2 receptor [R, J Robb , W. C. Green and C, M raster, Journal Sub-Experimental Method. Disson (J, Exp, Med,) Volume 160, pp. 1126-1146 ( 1984): R, J Robb, C, M Rasta and M, P Niebuhr, Proc. natn, Acad, Sc, U, s, A, volume 85, pages 5654-5658 (1988) l; and ANP receptors CM, S. Chuck, D., G., Lowe. , M., Lewis, R., Hermis, E. Cheno, A., V. G., Dell., Nature (N. 341, pp. 68-72 (1989)]. one hole In these situations where the receptors exhibit broad receptor specificity, It is difficult to link the function of a terrestrial protein to a specific pharmacological action. However, The use of receptor-specific hormone analogs can greatly simplify this task. Ru. For example, catecholamine analogs can be used to target β-adrenergic receptors. Characterize subtypes and link specific receptor functions to specific pharmacological responses. Attached [R, J, Lefkopi, Tsu, J, M Stenidel, and M, G Caron, A , Rev. Biochem, Vol. 52, pp. 159-186 (1983)]. By analogy Therefore, receptor-specific mutants of hGH are important for hGH complex pharmacology. In order to determine the role of H and hPRL receptors, must be an important reagent for identifying the receptors of

soluble binding protein Lacking the transmembrane region (prolactin receptor binding protein is shown in Figure 5) Assembled as shown. Figure 5 shows the ratio of mature hcHbp and mature hPRLbp. It shows a comparison. Each of these binding proteins lacks a transmembrane region. I'm there. Variants of PRLbp have polypeptides at the amino or carboquine terminus. It can be assembled by adding sequences. Human GHBP has been described. However, it lacks an effective binding site for zinc ions. However, Sparagin 23. By mutating the DNA that feeds the growth host using conventional methods, GHBP mutants can be created with affinity for rumon (Example 14). Using such conventional methods, the DNA encoding asparagine 18 was isolated. , modified to encode alanine or histidine at position 218. hiss As a result of the presence of Chin 218, the affinity for hGH in the presence of curved lead is increased by 30 times. I was forced. Such hGH and GHBP containing zinc ion as a binding cofactor The complexes of 1-1 can be used in pharmaceutical formulations for therapeutic administration.

4) Umbrella r, Ko de town -=-! lower left) - sound Δ(V/≧hi2 ＼－Ima-Sanojo-hai" ``4-i heather polypeptide hormones or their receptor support Variants of binding proteins can be created using site-directed mutagenesis or other well-known methods. to remove the required metal ion binding site or insert a metal ion binding site. Can modify amino acid residues. Removal of metal ion binding sites by modification of long hormones and modification of soluble prolactin receptor bacteria. is exemplified. Similarly, polypeptide hormones or polypeptides that do not contain metal ion binding sites or by modifying the amino acid sequence of hormone receptors to include metal ion binding sites. Can create mutants. Such modifications include arginine, 1. instead of histidine, 1. Insert the hormone-receptor 1 containing zinc ions. exemplified by modifications to the human 5-long hormone binding protein that result in the formation of

Mammalian polypeptide hormone receptors that do not contain metal ion binding sites A method for modifying a conjugate to include a metal ion binding site is to The unintended polypeptide is the amino acid of the lumon or polypeptide hormone receptor. ``Here, the determined amino acid sequence consists of determining the acid sequence. Regions of homology to known polypeptide hormones or receptors with binding sites ]. Mammalian polypeptide hormones or hormones that do not contain metal ion binding sites. The amino acid sequence of a hormone receptor or hormone receptor is a polypeptide containing a metal ion binding site. one or more amino acids similar to tidohormones or hormone receptors Qualified to include. This results in the insertion of a metal ion binding site. Iron, Ni such as Kel, copper, magnesium, manganese, cobalt, calcium and selenium The preferred metal ion binding site is zinc, although other metals can also be used. This poly Selective method to isolate peptide hormone variants forms stable complexes with metal ions Any method that allows the selection of mutants that have the same characteristics, such as phagemid separation methods, is included.

To generate antibodies, rabbits were incubated with hPRLbp from E. coli using standard methods. immunized and serum was collected after each booster dose. Serum and hPRLbp dimethylated hGH column covalently crosslinked to hGH by reaction with rusverimidate (7) (final L14 degrees 10 mM in phosphate buffered saline (PBS)). child The hG H-hPRLbp column was treated with 2M NaCl, 8M urea, and 3M KS. A subsequent wash with CN removed non-covalently bound components. serum during hGH affinity purification with hPRLbp immunogen. Anti-hGH antibodies that could be produced at low levels of contamination with GH were removed. The effluent Adsorb onto a GH-hPRLbp column, wash with 1M NacI, and add 3M KSCN. It was eluted. Non-blocking anti-hPRLbp antibodies were dialyzed into PBS and used in this assay. It was titrated to find the optimal concentration required to precipitate hPRLbp.

2) Cloning Generally, the DNA sequence encoding the parent polypeptide is cloned and engineered to be expressed in the main. Coding the parent polypeptide The coded DNA is cD derived from mRNA from the genome library. from NA, from cells expressing the parent polypeptide, or by synthesizing the DNA sequence. can be obtained by assembling [T Maniatis et al. (1982), model Molecular Cloning, Cold ・Spring Harbor Laboratory 1N, Y,].

The parent DNA is then transformed into an appropriate plasmid or Insert into vector. Cloning and expressing DNA sequences to create segments To produce a parent polypeptide with substitutions resulting in a polypeptide variant Prokaryotes are preferred. For example, 12 strains of E. coli 294 (ATCC No. 3 1446) is large arm B, Escherichia coli X1776 (ATCC No. 31537 ), as well as the large intestine! ! Ic601 and C600h fl, large intestine mW3110 (F- 1γ-, BCl Todo 07, ATCC No. 27325), Bacillus subtiri Bacillus genus, such as Bacillus 5ubtilis, SaImonell typhimurium Or like Serratia marcesans. It can be used in other Enterobacteriaceae, as well as in various Udomonas species. preferred The prokaryote is Escherichia coli W3110 (ATCC No. 27325). prokaryotes When expressed in a plant, this polypeptide typically carries an N-terminal methionine or Contains lumylmethionine and is not glycosylated. These examples are illustrative of heat theory. It is not intended to be limiting.

In addition to prokaryotes, eukaryotes such as yeast cultures, or derived from multicellular organisms cells can be used. In principle any such cell culture can be used. deer However, vertebrate cells are the most important, and vertebrate cells in culture (tissue culture) It became a method that can reproduce the proliferation of spores [Tissigny culture (Tissue culture)]. Culture), Academic Press, Kruse and Baderin'a (19 73) Ko. Examples of such useful host cell lines are VERO and HeLa cells. , Chinese Hamster Ovary (CHO) cell line, W2B5, BHK, CO 3-7 and MD CK cell line.

Generally, a plus containing replication and regulatory sequences derived from a species that can coexist with the host cell. midvectors are used in combination with these hosts. This vector typically replicates sites, as well as tags that can provide phenotypic selection in the transformed cells. It has a sequence that encodes a protein. For example, E. coli is derived from E. coli spp. can be transformed using pBR322, a plasmid introduced by M. (1970), Journal of Sub-Molecular Biology (J, Mo. 1B i o 1. ) Vol. 53, p. 154]. Plasmid pBR322 is ampicillary and tetracycline resistance genes, thus providing an easy means of selection. I will provide a.

A preferred vector is pBO475 (Figure 8). This vector is a phage and For E. coli? contains the lIl origin, which allows for shuttle (round trip) in both hosts. , thereby facilitating mutagenesis and expression.

"Expression vector" means a vector containing suitable controls that enables the expression of the DNA in a suitable host. A DNA construct that includes a DNA sequence operably linked to a control sequence. this Such control sequences include promoters that effect transcription, and those that are desired to control such transcription. operator sequence, a sequence encoding an appropriate mRNA ribosome discovery site; and sequences that control transcription and translation termination. vector is plasmid , a phage particle, or just a possible genomic insert. Once Once introduced into a suitable host, the vector replicates and replicates independently of the host genome. function, or in some instances may be integrated into the genome itself. The plasmid is currently Since this is currently the most commonly used form of vector, it is used herein. "Plasmid" and "vector" are sometimes used interchangeably. However, the book The invention is based on a method known or as known in the art that performs an equivalent function. It is intended to encompass other types of expression vectors.

``Functionally linked'' when describing the relationship between two DNA or polypeptide regions. "Integrated" simply means that they are functionally related to each other. do not have. For example, the presequence most likely contains a cleavage signal sequence. This functions as a signal sequence by participating in the secretion of the mature protein. If so, it is functionally linked to the peptide. A promoter is a promoter that drives the transcription of a sequence. If the control is operably linked to the coding sequence: the ribosome binding site is , functionally linked to the hooded sequence if this is positioned to allow translation. are doing.

Once the parent polypeptide has been cloned, site-directed mutagenesis [P Carter (1986), Nucl, Ac1ds R eS, ) Vol. 13, p. 6487], cassette mutagenesis [J.A. Wells et al. (1985), Gene, Vol. 34, p. 315, Restriction Selection Mutagenesis [J , A. Wells et al. (1986), Philosophical Transactions I The Loisel Society in London Series A (Phi) os, Trans, R, S.

c, London 5erA) Volume 317, Page 415], or other known techniques. is applied to the cloned parental DNA to determine which segment is defined by the similar segment being replaced. A “segment replacement DNA sequence” that encodes a change in the amino acid sequence defined by can be produced. When operably linked to a suitable expression vector, the segment A substituted polypeptide is obtained. In some cases, the parent polypeptide or segment Recovery of the segment-modified polypeptide is performed using the parent polypeptide or the segment-modified polypeptide. A suitable signal sequence operably linked to the DNA sequence harboring the repeptide. The use of Wear. Such methods are well known to those skilled in the art. Heat theory, desired polypeptide In vitro chemical synthesis [G, Panrany et al. (1979), The Veptize (The Peptides) (E Gross and J, Meyenhofer rA), Akade This can be done using other methods such as Mitsuku Press, N., deceased, Vol. 2, pp. 3-254. Such polypeptides and segment replacement polypeptides can also be produced.

The following examples are intended to illustrate the best presently known methods for carrying out the invention. Although it is intended, the present invention should be construed as limited to these examples. It's not possible.

Table 1 Requirement of zinc for hGH binding to hPRL receptor The binding of hGH or hPRL to their purified binding proteins (bp) Figure 2 illustrates the dependence of zinc on against hGHbp (0.1 nM final) The dissociation constant (KO) of the binding [”5j’1hGH(2,5-7)] Assay buffer (20mM Tris-HCI (pH 7,5), 01%w/vB sA). , the binding to hPRLbp (0.011M final) is Measurements were made in assay buffer containing 50 μM ZnCl, as described for Figure 2. Established. In the presence of ZnClt, the dissociation constant is [”51] due to competition with hGH or is the same in both the M6 analysis with [”51] hPRL, and the inventor report only the values measured by substitution of r125BhaH. 1mM ED Binding to hPRLbp in the presence of TA and without the addition of divalent metal ions [”J]h, since its binding affinity is essentially unaffected by EDTA. PRL is the only suitable tracer.

Kl) (SD) nM Receptor hGHhPRL +ZnCl, 0.033 (±0.06) 2.6 (±0.6) + EDTA 2 70 (±90) 2.1 (±0.7)hGHbp +ZnC1,1,6(±0.4)>100000+EDTA O,42(, Table 2 shows the hP of various alanine mutants of hGH. Figure 3 illustrates zinc dependence for binding to RLbp. hGH and hPRLbp The dissociation constant between was determined as described for FIG. Mutants of hGH are Produced and purified as described above. The mutant has a position in hGH following the wild-type residue. and mutant residues. WT-wild type hGH; ND-not measured .

Table 2 12:=::=2---------111---11--------- ---hGH mutant + ZnC1z (50 μM) + EDTA (1 mM) mutant KI, (±SD)nM Kn(mut)/Kn(WT) Ko(±SD)nM Ko(nut)/Ko(tT)IT O,033±O,QO61270±90 1H18A 4.5±1. l 135 370±120 1.4H21A 3. O±1.0 91 200±60 0.74E174A 12.0 Sat 3. 0 356 360±120 1.3D171A O,037±0.011 1 ．． IND Table 3 shows the hGH mutant and hPRLbp at defined concentrations. (2 μM each) of free asZn! Ratio of combined ssz nt+ to + (0.2 μM in total) is illustrated. "" ZnC1t is equilibrated in a dialysis cell and bound. Zinc concentrations and free zinc concentrations were determined as described for FIG.

hGH mutant [85Znl+1 bound/free H18A 0.1±0.1 H21A 1.6±0I E174A 1.0 Sat 02 Figure 2 shows 01% BSA (High Grade Crystallization Fraction V:/Guma), 140mM NaCl ,]Om\4MgC,1,,20mM Tris (pH 7,5) and various concentrations of total The binding of [”BhcH to hPRLbp in the presence of ZnC1, This is an example of the case. A fixed 1:1 ratio of hGH and hPRLM (finally 0. 01 nM) were incubated for 16 h in the presence of the indicated J-modified ZnCl. , bound E125+1hcH to hPRLbp affinity-purified rabbit Immunoprecipitation was performed using polyclonal antibodies. Zinc concentration exceeds 100 μM and some proteins were precipitated, thus forming the native hGH-hPRLbp ? The amount of Jt coalescence is reduced.

Figure 3. Equilibrium dialysis for binding of 5sznto to hGH-hPRLbp1 complex. is exemplified. All stock solutions were made in metal-free deionized water and reagents were Made of the highest quality available. Plastic dialysis cell and 3500 molecular weight capacitor The cut-off membrane (pre-boiled and washed in 5% w/w NaHCO2) was diluted with 1mM EDT. A, 20mM Tris HCI (pH 7,5), 10mM MgC1* (Z n″″) and 140 nM Na Washed thoroughly with dialysis buffer containing C1. 0.34mM “ZnClt” solution (500μCilo in 50mM HCl, 1ml; DuPont) was lM ZnCIt, 0.05M prepared gravimetrically from water ZnC1, Prepared from HCl stock solution. Dialysis buffer in half of the dialysis cell (total 0, 2ml) hGH-hPRLbp (finally 1.2 μM) in the solution was added, and the total zinc concentration was adjusted to 0.1 μM. to 10 μM. "ZnC1, firstly hGH and hPRLb added to the side of the cell lacking p. Seal the cell and rotate slowly at 25°C for 16 hours. I let it happen. Aliquots (50 μm) from each half of the dialysis cell were counted and combined and Free zinc concentration was calculated. In order to avoid accidental binding of Zn''', this binding Tests were performed in the absence of carrier protein.

Figure 4 shows the proposed Zn″′ linkage on hGH that mediates binding to hPRLbp. The figure shows an example of a joint part. The protrusion of the helical ring is polar (negative) on one side of the helix. (marked) and charged (black comb) residues, and nonpolar (open) residues on the other side. h) Shows the amphipathic nature of helices 1 and 4 with residues. h for hPRLbp Putative zinc-binding ligands involved in GH binding, His18, His21, and The position of G1u174 is indicated (★). The region binding to hGHtJ<hGHbp is shaded. Roughly indicated by the circle with. Residues marked with symbols ・・・・・ and O are hGH The alanine mutations in 4 (@ indicates a site that is 4- to 10-fold, decreased by 10-fold or more, or enhanced by 4-fold.

Great Cold Example Z Mutated hGH and hP binding to RL receptor Table 4 is: Effect of conserved ZnCl in hPRLbp on binding of hG H under nobi injection Illustrating the effects of mutations in the i(is and Cys residues) hPRLb Mutants of p were generated by site-directed mutagenesis (25), purified, and shown in Figure 1 ．． 2 and in the presence of Zn'' as described in Table 1.

h P RL b p mutant KD (Sat SD) nMWT 0.050 Sat 0. 008 H159A0.047±0008 C184A 0.045±0.004 H188A>to.

Table 5 shows that [”JlhGH against hPRLbp (60 or 5000 pM)] The effect of divalent cations at physiological total serum concentration (19) on complex formation Illustrated. CaCI,’6HtO,Cu5O,’5HtO,CoCIt” High purity for 5Ht○, MnCl　r・4t(to, MgCl　t・5HtO The metal ion salts are 3, respectively, Ngson, Manosei, Bureautoninok, Nguma, and Mali. From Nkrot, Mallinckrodt and Gitanson - Manosei Bulotninok obtained. Binding assays were performed as described in Figure 2 with 0.1% BSA, 140 mM The formation The percentage of complexes present in the assay is calculated as the total [1! ’31 against hGH Calculated from the ratio of the amount of immunoprecipitated [Bhc, H-hPRLbp complex in .

Table 5 □□−□ Percent of complex formation Divalent metal concentration 60 pM 5000 pM None 3.8 ± 1.4 5.4 Shiryo 8 Ca"" 5mM 1.3 0.7 29.0±14Co" 5μM 1.3" :2.4 6.8j=1.5Cu" 20μM 1.7±1.5 29.0±1 ．． 4M g’″ 2mM O, 8±1.4 9.1±3,6Mn” 2μM O, 4±0.8 8.2±1.8Zn″” 20μM 46.0±3.0 74 ．． 0±1.0 Figure IA shows the protein that directs the secretion of hPRLbp into the periplasm of E. coli. Figure 3 illustrates a diagram of the lasmid phPRLbp(1-211). hPRLbp remains The gene fragment is derived from the alkaline phosphatase (phoA) promoter. It is transcribed under control and secreted under the direction of the 5tIl signal sequence. genes are arrows The origin of replication (ori) is indicated by a circle, and the restriction site used for assembly It is shown. hP in Bluescript Plasmid (Stratagene) The cDNA encoding the RL receptor (3) was developed by Dr. Paul Kelly (Roy Yar Victorian Hospital, McGill University, Montreal, Canada) I bought it from Sequence 5'-AGCCACAGAGATAACGCGTCTATGT Using an oligonucleotide having ATCATTCA-3' (SEQ ID NO: 4) This plasmid was subjected to site-directed mutagenesis (25) to induce membrane permeabilization of the receptor. After the threonine 211 codon just before the domain, there is a stop fudon and M Restriction sites (indicated by asterisks and underlines, respectively) were introduced. Next is this plasmid? et al.'s 600bpBg I I I-M! uI fragment into plasmid ph Cloned into the NsiI-MIuI backbone of GHbp(1-246) [J, M Boutin et al., Mo1. Endocrinol, vol. 3, p. 1455 <1 989) Ko. N5il and Bgll [hPR using a synthetic linker to connect the sites] Lbp is fused to the Stl+ secretion signal sequence, and the 5′ end of the hPRLbp gene is was restored. The strand below this linker has the sequence 5'-GATCTCAGGTTTTC CAGGA GGTAACTGTGCA-3' (SEQ ID NO: 5).

The upper strand is either complementary to this or 4 bp shorter at each end, matching the restriction site ends. ing. Dideoxy sequencing (26) was used to confirm this assembly.

Figure IB shows Coomassie blue-stained 5DS-PAG of purified hPRLbp. E (12.5%) [U, Laemmli, Fuichi +- (Nature) vol. 227, 680 (1970). hP RI-b P is solubilized and hGH 50 μM ZnCI was added to the ammonium sulfate precipitate before funneling onto the affinity column. Purification was performed essentially as described for hGHbp. Column is IM Wash with KSCN, 2M KSCN and 50mM NaCl, 0.02%N aN 8. Eluted with 20mM Tris-HCI (pH7.5). The eluate is K It was dialyzed into the same buffer except for SCN and stored frozen (-70°C). row l-5 are E. coli periplasmic fraction, (NHSAN SO, precipitation, hGH111 sum chromatograph), respectively. The tanning material after roughy, the washing solution just before elution of hPRLbp, and the molecular weight standard * ( range of 14 to 97 kD).

(Hereafter, margin) Example 5 Human growth hormone mutagenesis and expression vectors Effective mutagenesis To promote development, the hGH-encoding sequence was evenly distributed without spacing. A synthetic hGH gene with unique restriction sites was created. This synthetic hGH DNA The sequences are each approximately 60 base pairs (bp) long and extend from N5i1 to Bg. l　II　7 syntheses that share a 1 obp DNA fragment shown up to I was assembled by ligation of the NA cassette. ligated The fragment was purified, excised from a polyacrylamide gel, and similarly excised. The vector was cloned into the alkaline recipient vector pBO475. Phosphatase promoter and 5tII signal sequence [C, N, Chan et al. (1 987), Gene, Vol. 55, p. 189] for phage f1? J! 1205, which contains the origin of production and the origin of plasmid replication and the β-lactamase gene. Contains pBR322 up to 4361 bp. The sequence was determined by dideoxy sequence analysis [F , Sanger et al. (1987), Proceedings in the National Academy of Sciences. Demi-In Sciences USA (Proc, Nat 1. Ac d, Sci, USA), Vol. 74, p. 5463.

pBO475 was assembled as follows: Dra11Rsa of length 475 bp. The fl origin DNA from the filamentous phage contained on the fragment was transferred to pBr322. was cloned into the unique Pvu II site to create plasmid p652.

Next, p652 was restriction digested with Nhel and NarI, and the sticky ends were digested with DNA polynucleotides. merase and dNTPs to bind the large 3850 bp fragment to itself. Most of the tetracycline resistance gene was removed by ligation back. plasmid pΔ652 was created. Control p△652 with EcoRI and EcoRV The 3690 bp fragment was digested with alkaline phosphatase promoter. , phGH4R [C,N, CH] containing the 5T11 signal sequence and the native hGH gene. 1300 bp derived from [Yang et al. (1987), Gene, Vol. 55, p. 189] EcoRI, ligated to the EcoRV fragment. This assembly is It was named BO473. Clone the synthetically derived DNA into pBO473. and restriction digested with Nsi■, Bgll+, 420bpNs　i　　I　, Hin dl117 fragment, and 1170bfindll, BgllI fragment. (derived from co-ζ-synthesized NA). The resulting assembly p BO475 contains DNA encoding the polypeptide sequence of native hGH. , many new features that facilitate mutagenesis and further manipulation of the hGH gene. have different restriction sites.

The entire DNA sequence and hGH amino acid sequence of pBO475 are shown. pB .

hG at 475) (unique restriction sites in the sequence include homologs pGHShPL and Mutagenicity containing DNA sequences encoding similar segments derived from hPRL (7)) [J, A., Wells et al. (1985), Gene 34, 315 page] can now be inserted.

hGH and hGHfg bodies were purified as follows: cell pace l-1-2O0 Four volumes (800 ml) of 10 mM Hlis (pH 8,0) were added. Pour this mixture into the chamber The pellet was thawed by placing it in an orbital shaker at warm temperatures. Homogenize the mixture and store in a cold room The mixture was stirred for 1 hour. This mixture was centrifuged at 700 rpm for 15 minutes. Tilt the upper groove Strain, add ammonium sulfate to 45% saturation (277 g/l) and leave at room temperature for 1 hour. Stir for a while. After centrifugation at 11,000g for 30 minutes, the pellet was diluted with lQmM. Js (pH 8,0) and resuspended in 40 ml. This was mixed with 10 mM Tris (pH 8,0 ) 2 liters (dialyzed overnight. This sample was centrifuged or 0.45 micron filtered through a membrane. This sample was treated with DEAE cellulose (fast flow) at the following%’t. , Pharmacia lnc, ) into a column packed with 100ml. 1 with a gradient of 0 to 300 mM NaCl in 0 mM Tris H2CI (pH 8,0). It was conducted at night. Sample sample: Approximately 1mg/by IJ-bleb lO ultrafiltration Concentrated to ml.

Example 6 Expression and purification of soluble human growth hormone receptor derived from E. coli A clonin encoding the human growth hormone receptor hGHbllll. DNA sequences [D, W Ljung et al. (1987), Nature (Nat u r e) Vol. 330, p. 537], an expression vector derived from pBO475 - subcloned into.

Escherichia coli W3110. degP [K, L, Strauch et al. (1988), PNAS USA Vol. 35, p. 1576] was transformed with the expression vector, and in a fermenter at 30°C. “C,N Chap (1987), Gene 5 grown in low phosphate medium Volume 5, page 189]. The 246 amino acid hGHbp was used to generate preliminary data. . In the examples herein, a slightly shorter h containing amino acids 1 to 238 GHbp was used. The results obtained for that receptor are 246 amino The results were indistinguishable from those obtained for acid hGHbp.

Example 7 Introduction of binding properties of human growth hormone to placental lactogen Human placental The binding affinity of lactogen (hPL) is defined as that of hGH to the hGH receptor. [G., Bauman et al. (1986), Journal International] Clinical Endocrinology and Metabolism (J, Cl1n, Endocrinol, Metab, Volume 62, Page 134; A, C, Herrington (1986), Journal in Clinical Investigation 7gn (J , CIin, Invest, Volume 77, Page 1817]. Past mutagenesis studies The two regions (residues 54-74 and and 171-185).

The overall sequence of hPL is 85% identical to hGH. Receptor binding epi on hGH Among the three regions that broadly constitute the tope, hPL differs at seven positions. The following substitutions are made: P2Q, +4V, N12H, R16Q, E5 6DSR64M, and +179M (this nomenclature refers to the residues of wild-type hGH). one-letter code, followed by its position in mature hGH, then in hPL. The residues found are listed below. Similar nomenclature is used to describe mutants of hGH. ). One alanine substitution was created at each of these seven positions of hGH. this Among them, four alanines including 14A, E56A, R64A and 1179A Substitutions were found to reduce binding affinity by a factor of two or more. Generally, a Ranin substitutions have a greater impact on binding than homologous substitutions from human prolactin. make an impact. Therefore, some effects of hPL-derived substitutions introduced into hGH are I'm out of tune. The I179A substitution results in a 27-fold decrease in affinity, while the 1179M is only 17 times more effective. However, R64A and R64M Reduction resulted in the same and much larger decrease in binding affinity (approximately 20-fold). difference Furthermore, the double mutant (E56D:R64M) in hGH has a total of 30 times There was an even greater decrease in affinity for 4't. That is, E56D and R64M? Primarily determines the difference in receptor binding affinity between hcH and hPI. Therefore, The double mutant 056E, M64R in hPL is substantially enhances its binding affinity. Further, such as M1791 and V4I Modifications also enhance hPL binding to hGH receptors.

Example 8 Before effect of amino acid substitution at position 174 on binding to human growth hormone As pointed out, substitution of Glu174 with Ala (E174A) The affinity of human growth hormone (hGH) for human growth hormone (hGH) was enhanced by more than 4 times. 17 To determine the optimal replacement residue at position 4, hGH mutations substituted with the other 12 residues cells and measured and determined their affinity for hGHPi proteins. (Table 6). Side chain size, not charge, is the main factor determining binding affinity. Ru.

Alanine is the best substitution, Ser, GlySGln, Asn, Glu, Hi S, Lys, Leu, and Tyr force this four times.

! 4 sacs side chain E174G OOO, 15 E174A　O260,0750,22E174S　O330,110,30 E 174 D 59 N E - E174N O690,260,70 E174V O760,280,80 Wild type 89 0, 37 1.0 E174Q O950,210,60 E174HO1010,431,2 E174L O1022,366,4 E174K + 105 1.14 3.1E174R+ 136 NE - And Research (Nucleic Ac1d Res,) Volume 13 4431-4 The Kpn1 part at position 178 cloned into pBO475 by [Page 443] was raised on a mutant of the hGH gene containing the position. Oriconu used for mutagenesis The cleotide is the sequence *** 5' -AC-AAG-CTC-NNN-ACA-TTC-CTG-CGC- ATC-GTG-CAG-T-3° (SEQ ID NO: 6) [where NNN is at position 174] The asterisk represents a new codon and excludes the KpnI site starting at codon 178. It had a mismatch. The mutant codons are as follows: : Gin, CAG: Asn, AAC; Ser, AGC; Ly s, AAA; Arg, AGG; His, CAC: Gly, GGG; Va L GTG; GTG: Leu, CTG, plasmid according to heteroduplex synthesis The pool of genes was mutated by Kpn+ restriction digestion to reduce the background of wild-type sequences. We have accumulated information regarding this matter. All mutant sequences were analyzed by dideoxy sequence analysis [F-san-etc. 1977), Pro/-Dings in the National Academy Sciences U S A (Proc, Nat IAcad, Sci, U SA) Vol. 74, pp. 5463-5467].

b’) Banking value of side M is C, Chong-a (1984), Annual Rev. Annu, Rev, Bioch+v, ) Volume 53, page 537.

C) The dissociation constant is the competitive value of [''I]hGH from the hGH-binding protein. Measured by displacement. NE has a mutant hormone expression level that is too low to be isolated. Indicates that the test was not successful.

Example 9 Relationship between human growth hormone and human prolactin receptor binding site No. 7 Table illustrates comparison of binding of hGH variants to hPRLbp and hGHbp ing. Mutants of hGH generated by homologue scanning mutagenesis is a bipolar substituted from various hGH homologs: pGH, hPL, or hPRL. Name according to end segment. The exact expression of the introduced mutation is Indicated by single mutant connections separated by . One of the constituent factors The mutant has a single-letter code for the wild-type residue, then its presence in mature hGH. , and the residues of the mutants. Mutants of hGH was prepared and purified as described above. The binding of hGH mutants to hPRLbp is , except that the assay contains 50 aM Zn CI and 10mM MgCl, by competitive displacement of [”’I]hGH as described for hGHbp. It was measured.

Using an affinity-purified rabbit polyclonal antibody raised against hPRLbp The hGH-hPRLbpfi complex was precipitated. Results reported for hGHbp The relative decrease in binding affinity (Ko(mut)/Ko(hGH)) is Del Meginodo, etc., Broding's in the Seventh Academy. 100,000 Scientists USA (Proc, Nat 1. Acad, sc i, U sA), Vol. 84, p. 6434 (1987). Altered preference for receptors the ratio of the relative decrease in binding affinity for hPRLbp to hGHbp Calculated by dividing by that. WT - wild type, SA - standard deviation.

We discovered that a special side chain of hGH that strongly modulates its binding to hPRLbp were identified by scanning mutagenesis (Table 8). involved in binding Alanine scanning of two regions related to homologue scanning In addition, the inventors have shown that helix 4 is structurally similar to helix 7 hex l and 54-74. This helix 4 was also scanned since it is between the loop regions. hP Alanine substitutions that result in a >4-fold decrease in binding affinity for Rt, bp The central part of Rix1 (containing residues His18, His21, and Phe25) ), loop region (including IIe58, Asn63 and Ser62) and heli Center of box 4 (Arg167, Lys 168, Lys 172, Glu174 , Phe176 and Arg178). These 12 The residues form a section when mapped onto the structural model of hGH (Fig. 7A ). The most interfering alanine substitutions in helix 1 and helix 4 are the same It sticks out in the opposite direction.

Three of these residues (His18, His21 and Glu174) and His188 from hPRLbp is required for the high-affinity hGH-hPRLbp complex. It is believed to contain the essential binding site for Zn''.

Hana Ita No WThGH 33±3 (1) (1) (1) hPL (56-64) E 56D, R64M 70+ 14 2.1 30 0.07△(1-8) 93 ±26 2.8 NDFIOA 33:j:12 1.0 5.9 0.17N 12A 20±6 0.6 1.2 0.5L15A 33±7 1.0 1. 3 0.77R16A 33±6 1.0 1.5 0.67H18A 450 0+1100 140 1.6 88R19A 33±10 1.0 0.7 1.4H21A 3000+1000 91 NDP25A 230±50 7 ND D26E 63±11 1.9 ND F54A 47±8 1.4 4.4 0.32S55A 50+15 1. 5 1.2 1.3E56A 27±5 0.8 4.1 0.20S57A 35±11 1.0 1.4 0.71+58A 611±110 Hl 17 1. IP59A 43±22 1.3 1.9 0.68S62A 360± too 11 2.8 3.9N63A 140±46 4.3 3.3 1. 3R64A 60+15 1.8 21 0.99E65A 83±29 2. 5 0.59 4.2E66A 37i6 i,t 2.1 0.52Q68A 40±6 1.2 5.2 0.23Q69A 23±8 0.7 0.91 Q, 77L73^ 60 force 22 1.8 0,71 2.5Y1B0A 47 ±3 1.4 1.1 1.3Y164A 70±13 2.1 3.6 0. 58 [1167A 25+100±5000 770 0.75 1 in 1030 68 people 610±120 18 1.1 16D171A 37±11 1.1 7.1 0.15 to 1?2A 7200”-11002201416E174 ^ 12000±1700 356 0.22 1800T175S 7 to 15 2.3 3.5 0.66F176A 830±100 25.0 16.0 L, 5R178^ 230±20 7. OND1179^ 60±5 1.8 2.7 0.671179M 25±2 0.75 2.7 0.28V18 QA　20. t2 0.6 1.0 0.60Q181A 33±4 1.0 1.6 0.63RI83 ^ 86 generation-62,62,11,2S1848 2 7':2 0,8 0,91 0.88V185A 53:':15 1.6 4.5 0.36E186^ 33:6 1.0 0.79 1.3G187A s3+Xa 1. OL30.56S188^ 20±2 0.6 0.71 0.85 Table 9 shows hGH and hPRL binding proteins (hGHbp and hPRL Illustrating the binding of a double mutant of hGH designed to identify There is. Mutants of hG) (were produced by site-directed mutagenesis and purified [B, C Kanimegham and J, A Wells, Science (Sc 1ence) 244 Vol. 1081-1085 (1989): L, hcHbpc as listed in Table 7. C, Hiyu, M, G Markerin, S, Bass, N, McFarland, M Prochia. -1 J. H. Bourelle, D. R. Wright and J. A. Wells, Journal Benn ・Biological Chemistry (J, Bio 1.Chem,) Volume 265 pp. 3111-3115 (1990) and about binding to IthPRLbp. It was tested.

Kn(mut) hGHbp Ko(a+ut)/Kn(hGH)/hPRL bp / Ko (hGH) K168^, E174A 350000±80000 9100 120±10 0.27 34000R64A, DITl8 12± 7 1.9 120000±15000 280 0.006111 Table 10 is , mutations in hGH that affect binding to hGH or hPRL binding proteins. This example illustrates the additional effect of Binding free energy of mutants compared to wild type hGH The change in ghee (△△G b + nd + ng) is changed from the decrease in binding affinity to △△G 1l ll’llll□,,,= RT l nlK o(muD/K o(hG H )] I was calculated accordingly. LK of single or multiple mutant hormones The value of o(nut)/　K　o(hG　H)3 was taken from Table 8-11.

Change in binding free energy △△Gbl,,,,l□ (kca1/m01) mutation hGHbp hPRL bp K 168A ↓0, ■ +17 E174A -0.9+3.5 168A, E174A (expected) -0.8 5.2 (actual) -0.8 + 5° 4 R64A +1.8 ÷03 D171A ↓1.2 +0.1 R64A, D171 (expected) +3.0 +0.4 (actual) +3.4 +0.4 172A +1.6 +3.2 F176A +1.7 +1.9 K 172A, F 176A (expected) +33 ↓51 (actual) +3.8 +5 ．． 4 FIG. 6 shows hGH and hPRL binding protein binding proteins for binding to C”’l2 hGH. Illustrating the conflict between qualities. -”’1 co-hGH and purified hcHbp domain The concentration was fixed at 0.2+IM. Add increasing amounts of purified hPRLbp and Two constituent factors were 25μM ZnC1, 20mM Tris-HCI (pH 7.5) and Equilibrate for 12 hours at 25°C in assay buffer containing 0.1% W/vBsAG. It was to so.

Non-neutralizing monoclonal antibody against hGHbp [Mab263, R. , P.G., Bundesen, D.B., Rillanoto and M.J., Waters, Endok. Endocrinology, Vol. 15, pp. 1805-1813 (1) 984)'], and ["51]h still bound to hGHbp as described above. hGHbp was precipitated with GH. The inserted graph shows hGH and hPRL. Republish on a Scanochard plot to calculate the KD (68 pM) between bp The formula data is shown below.

Figure 7 shows the folding of pGH determined from the 2.8 angstrom resolution X-ray structure. Illustrating the structural model of hGH based on the diagram [S, S, Abdel-Megnid , H, S. C., W., W. Smith, H. E., Dillinger-1B, N., Bioland and Biri, A.

Bentl, Proc, Na tn, Acad, Sc i, U, s, A, vol. 84 6 434-6437 (1987)]. Panel A shows the epitope structure of hPRLbp. Panel B shows that previously determined for hGHbl) [S,S , Abdel-Megi.

et al., Proceedings Ben the National Academy Ben Saye ns U, S, A, (Proc, Nat 1. Acad, sc i, U, S, A.) Vol. 84, p. 6434 (1987)]. Symbols・・・・・and・ , the alanine substitution reduces the binding affinity for each receptor binding domain to 2, respectively. 4 times, 4 to 10 times, 10 to 80 times, or >80 times represents. ○ in hGHbp epitope (panel B) increases binding affinity by more than 4 times The increasing position E174A is represented. Panel C shows that the alanine mutant without substantially affecting binding to hGHbp or hPRLbp, respectively. Binding affinity 510 times (b) for hPRLbp or ≧5 for hGHbp Indicates the area to be lowered (intestine). The symbol mu is that alanine mutants have both receptors. Sites that prevent binding to ≧10-fold are shown.

Xuil Zinc dependence of human growth hormone on human prolactin receptor sexual union Human Growth Hormone (hGH) to Human Prolactin (hPRL) Receptor It was shown here that the binding of is zinc-dependent (Table 11). Data (family knowledge) The predicted K for the given ligand. normalized to. Binding assays containing zinc 1mM EDTA (without zinc or 10mM MgCl and 50μM ZnC) l, (with zinc), the labeled release from the prolactin receptor This was done using substitutions of hGH (Table 12). Unlabeled hGH competition assay for each experiment C,: included and used for standardization of Kd values. Zinc-free binding assay is Mg” In addition, prolactin receptors (without the addition of ``Zn'' and in the presence of 1mM EDTA) This was carried out using the replacement of labeled hPRL by Peter A. et al.

Table 11 Kd hormone for binding of hormone to hPRL receptor with zinc Zinc none hPRL 2.6nM 2.8nM h G H33pM 270nM hPL 50pM hPRL PPTS with zinc is 50μM ZnCl2 and 1 Add 0mM MgCl, add 1mM EDTA and add zinc or zinc. No addition of gnesium h) ivy. hPL and hPRL at high concentrations of hPL aggregates with prolactin receptors to form a precipitate. Presence of 1mM EDTA Bottom, PE of hPL in the absence of zinc (as assayed using labeled hPRI7). resulting in the formation of a G precipitate. Half-maximal precipitation of hPRL was at 240 nM hPL. Happened. The concentration of hPLIm in pregnant women (approximately 300 nMl), this is This is physiologically important. Zara 1, prolactin receptor is prolactin It has the ability to compete with hPL for binding to the protein.

Binding of hPL to prolactin receptors has a Kd of greater than 1QnM.

Table 12 shows that using displacement of labeled hGH from the prolactin receptor, hPRL receptor in the presence of 10 mM MgCl and 50 μM zinc - shows the binding of hPL mutants to -.

E174A >9000 >270 1111791 33 1, 0 Kd of D56ESM64R, Nl791 27 0.8 hPl- mutant ( nM) values using recombinant human growth Narmon binding protein (hGHbp). It was decided (Table 13).

2, v41 446.8) t 55.80 1062.003, E174 people 3 Q9.12 20.60 736. GO4, HGH (65-191) 279. 30 35.71 665.005, Nl791 189.42 44.21 451.006, D561″, 143.64 43.75 342.007, hGH (25-64) 62.5g 13.00 149.008, M64R4 2,8430,23102,009, D56ESM1791 20.20 15 ．． OCl Jllolo, M64R, Nl791 13.90 22.50 3 3.10+1. D56ES SA64RS ¥1791 6. Ql　24.20　1 4.3012, :13+T34A, 11153D 5.54 17.80 13 ．． 201av41. D56E, shadow 4RJ1791 4.70 14.7 [111 ,2014,313+H47Q,S4gP 2.20 28.50 11.00 +5. D56E, ¥64RSE174AJ1791 2.53 31.05 6.0216, V41, D56E, M64R, E174AJ179 1.72 17.07 4. LO17, hGl+ (25-191) 1. II 20.4 9 2.64 Example 14 Mutation that binds human growth hormone in a zinc-dependent manner body human growth hormone receptor human growth hormone (hGH) and human prolactin receptor (hPRLr) Extracellular domain interaction studies were performed to determine binding affinity in the presence of 50 μM ZnCl. [B, C Cunningham et al. (1990), Science (Sc 1ence) Vol. 250, pp. 1709-1712]. These training The study further found that the interaction with zinc is related to the growth hormones His18, His21 and Glu174 and the amino acid residue of His188 of the prolactin receptor It has been proven that it is a mediator.

Table 14 lists growth hormone and prolactin receptors from several different species. Figure 2 shows a comparison of some of the amino acid sequences of protein. 1 of the prolactin receptors Histidine at position 88 is conserved, and in addition, the corresponding position (residue 218) Histidine is not present in any growth hormone receptor. hPRLbl ) site-directed mutagenesis of residue 188 of It was proven that this is essential for intercalation (Example 1, Table 4).

Rabbit GHr VRVR3RQR3SEKYGEFSE (SEQ ID NO: 8)? ’＋ GHr VRVR3RQR3FEKYSEFSE (SEQ ID NO. 9) Hr VRVR3RQR3FEKYSEFSE (SEQ ID NO: 10) human PRLr VQVRCKPDHGYWSAWSPA (SEQ ID NO: 11) Rabbit PRLr VQVRCKPDHGFWSVWSPE (SEQ ID NO: 12) Mouse PRLr V QTRCKPDHGYWSRWGQQ (SEQ ID NO: 13) Rat PRLr VQ TRCKPDHGYWSRWSQE (SEQ ID NO: 14) zinc-mediated binding to hGH: In an attempt to introduce hGHbp interactions, site-directed mutagenesis This was carried out on the Asn218 residue of p. hGHbp mutants N218H and N21 Two mutant genes encoding 8A were constructed. Histiji to 218th place As in the case of the hGH:hPRLbp interaction, the introduction of Zn! "of The mutant hGHbp is able to interact with hGH through It was expected. Studying the impact of removing asparaquine without introducing new functional groups To investigate this, we created the N218A mutant as a "neutral" control. hGHbp Expression vectors have been previously described [G. Heu et al. (1990), Journal. In Biological Chemistry (J, Biol, Chem, ) 26 5 @ pages 3111-3115], similar to hPRI = bp expression hector in Figure 1. , with the hGHbp gene instead of the hPRLbp gene. part finger Directed mutagenesis is Kunkel's method [T, A Kunkel et al. (1987), Melins ・In Enzymorono (Methods EnzyIIlol,) Volume 154 367-382] and the mutant oligonucleotides used were N218+-(5°-TCCAAACAACGACACTCTGGA AATTAT-3' (SEQ ID NO: 15), 5°-TCCA for N218A AACAACf'; AGCCTCTGGAAATTAT-3° (SEQ ID NO: 16) Met.

Binding protein mutants were expressed in E. coli KS330 cells and treated with 45% sulfate. /monium fractionation for partial purification or hGH affinity column for high-level purification. Purified. for hGH in the presence of 50 μM ZnCIy or 1 mM EDTA. JIth51]h by the unlabeled hGH described above. IS measured by competitive displacement of GH, A. Spencer et al. (1988), J. Null in Biological Chemistry (J, Biol, Chem, ) Volume 263, pages 7862-7867. Wild type or mutant used for assay CI! measures the amount of binding proteins in the body. Titration of bound proteins with 511hG H It was determined empirically by 1 of the binding proteins in the assay in the pre-titration. It was chosen to give approximately 20% bound C1151',hQH.

Table 15 Wild type and mutant hG in the presence or absence of 50 μM ZnClt KD value variants for Hbp interaction: without ZnCL, with ZnC1, WT 0.42±0.07 1.6±0.4N218A 1 04±0.13 0.2 5 samurai territory 07N218H 0.58i0.06 0.047±0.009 Table 15 to wild type hGHbI) and hGHbp mutants N218H and N218A. The effect of 50 μM ZnC1* on the binding of hGH to is shown.

For the N2 18H mutant, binding was significantly different from the wild type in the absence of zinc. However, binding was dramatically (>30-fold) enhanced in the presence of 50 μM ZnCIt. , this is probably due to the zinc ligand intervening in the interaction. N The 218A mutant was created without introducing a zinc ligand (with the asparagine side chain removed). In the absence of Zn, the binding to growth hormone is similar to that of the wild type. It becomes about 2 times weaker, and 6 times stronger in the presence of Zn''. In the presence of asparagine 0, replacement of asparagine by alanine relaxes undesirable intermolecular contacts. On the other hand, the histidine, 1, region in the mutant was The strong binding is due to the introduction of a new interaction between the inserted histidine and zinc. It shows that it is something. growth hormone, growth hormone binding protein and The existence of such strong bonds between zinc facilitates the production of stable formulations.

Similarly, growth hormone binding protein containing histidine 218 in the presence of zinc administration will facilitate the formation of stable complexes with endogenous growth hormone.

Sequence list (1) General information (1) Patent applicant/Kobu Tech, Incorporated Manuse, Divid tobo jay Wells, James Nee (1. Title of the invention Metal ion-mediated receptor binding of polypeptide hormones (iii) Number of arrays: 16 (1v) Contact information/ (A) Addressee: Jefuntech, Inc. (B) Street Points ・460 Saint Bluff Boulevard (C) City South Saint Fragges State (D) California (E) Country/United States of America (F) ZIP:94080 (v) Hunbueter decoding format/ (A) Media type: 5.25 inch, 360Kb floppy disk (B) Computer Computer/IBM PC compatible (C) Operating system/PC-DO 3/MS-DO5 (D) Sewing wear p a t i n (Genen tech) (vl) Data of this application (A) Application number/unspecified (B) Two filing dates (C) Classification. to be decided (vii) Priority claim application data (A) Application number: 07156893 6(B) Filing date: August 17, 1990 (vi) Patent attorney/agent information: (A) Name: Benson, Robert H (B) Registration number: 30,446 (C) Reference/Reference number: 6551) 1 (1x) Telephone contact information: (A) iJ talk number: 415/266-1489 (B) Fax number: 4 15/952-988 1(C) Telex number 9 to/37 1-7 168(2) Information on array number 1 (i) Characteristics of array (A) Length: 237 amino acids (B) type, amino acid (D) Topology linear (xi) Sequence, sequence number 1゜ Up to the top sp o Enter rq A! In Ala Input 5P Engineering 1e (2) Information on Sequence Number 2 (1) Array characteristics/ (A) Length: 211 amino acids (B) Type/amino acid (D) Topolon-1 linear Enter sn Lyj Glu Thr Phe Dinghx Cys Trp Terp ^xg Pro Gly Thr Asp a1yThr Leu Met 1 4is Glu Cys Pro enter sp Tyr zle Thr GλyG Yuy pro Asn50 55 GO 5@r Cys Hls Phe GLy Lya Gin Ding YL Ding hr 3 er　Met　af　λrg　Thr　YrPro　L4u　GUU　See u Ala Val Glu Val Lys Gin Pro Glu Asp Enter xg Lysllo 15 120 Pro Tyr Iau Dingrp Xis Lys Dingrp Sar Pro i’ro Ding hrL・u Il・Jup kuLys ふhr Gly Tr p Phs Thx Iau Iau Tyr Glu Eyu・λrg Ia U! , ys Pr.

Pro Ala Thr Phe Engineering 1eG Yun! l@Pro S@r A jp Phe Dinght Met λsn 5p (2) Information on SEQ ID NO. 3 (1) Characteristics of array (A) Length 4916 bases (B) type, nucleic acid (C) Number of strands, single strand (D) Topolon-linear (xl) Sequence, sequence number 3 G input λT? C entering C fu　τccλ　C　TC　TTGG entering 9800　to λλ8　 AC 8 to AC ding G entry ^AATC50TCATTGCTG) I GTTGT? λTTT MGC? TGCCCAAAAAAG entered AGA AGAGTCGAAT 1 o.

GAACTGTGTG CGCAGGTkGA AGCTT GGAG ATT ATCGTCA CTGCAATGCT 150TCGCAATATG GCG CAAAA Ding G ACCAACAGCG GT Ding GATTGA? CAGG Ding A GAGG 200GGGCGljGTA CGAGGT8xAG CCCGA TGCCA GCATTCC? GA CGACGA? ACG 250G GCT GC? GCGCGA Ding Ding ACGτ　G in to the entrance ＾G Ding Ding in Ding T(t^AGC 8 1jcGTcAGT to TC 300 people AAAG ding TAA te CT ding? TC entry A CA GCTGTCAT enter k AGT%TCACG GCCGAGA (J? 3 50 people entering G-cho CGCTT TG-cho τ-cho TT entering τT entering τ-cho τ entering G-cho Child τG λ in C λ G〒λCGCJAGT 400〒C CG τλ 88 in λG GG entering iC Ding AGAGG Ding Ding α entering GG’i’S entering iτττ＾TEG entering＾8443 QACJBaX~=DingAteA^^GλτACCICCC? GGAAGC? CC? CG? GC3210 (2) Information on sequence number 4 (1) Characteristics of array: (A) Length, 34 bases (B) type nucleic acid (C) Number of strands, single strand (D) Topology: linear (Xl) Sequence: Sequence number 4: AGCCACAGAG ATAACGCGTc TA? GTATCATTCA T34(2) Information on sequence number 5 (i) Array characteristics/ (A) Length, 31 bases (B) type nucleic acid (C) Number of strands, single strand (D) Topology: linear (Xi) Sequence Sequence number 5゜ G in? C? CAGGT 'ff'rccAGGλGG Ding ＾ Cte G Ding GCλ 3 1 (2) Information on array number 6 (1) Characteristics of array (A) Length: 33 bases (B) type nucleic acid (C) Number of strands, single strand (D) Topology, linear (Xl) Sequence Sequence number 6 ACAAGcT01'N NkCkTTCCTG CGCATCGTGCAG? 33(2) Information on array number 7 (1) Characteristics of the array, (A) Length: 18 amino acids (B) type amino acid (D) Topology: linear (xi) Sequence: Sequence number 7. Val　MW　Va 工Arg　Lys　Gin　kxq　Asn　Se r Gly Jun Tyx Gly Glul 5 10 15 (2) Information on sequence number 8 (i) Array characteristics/ (A) Length, 17 amino acids (B) type, amino acid (D) Topology bilinear (Xl) Sequence, SEQ ID NO: 8: ^xq Va engineering λrg 5@r enter xg Gin enter xq Ser Sir G lu Tays Tyx Gly Glu Phal 5 10 1s (2) Information on array number 9 (i) Characteristics of array (A) Length: 18 amino acids (B) type, amino acid (D) Topology, linear (xi) Sequence/Sequence number 9 the S@r GyuU 1 day (2) Information on array number 10 (1> Characteristics of array: (A) Length: 18 amino acids (B) Type/amino acid (D) Topology linear (xi) Sequence Sequence number 10 Val entering zg Val ^xq 5er entering xg Gin Arg Ser the Glu shiys’ryτ Sex Glul 5 10 15 (2) Information on array number 11 (1) Characteristics of array.

(A) Length/18 amino acids (B) Type ° amino acid (D) Topology, linear (Xl) Sequence Sequence number 11 Val Gin Val Arg Cys Lys Pro Asp us G ly Tyx Trp Sex kla Ding S@r Pro l1m B (2) Information on array number 12 (i) Characteristics of array (A) Length: 18 amino acids (B) type amino acid (D) Topology linear (Xl) Sequence Sequence number 12: ;p (2) Information on sequence number 13 (1) Characteristics of array: (A) Length: 18 amino acids (B) type diamino acid (D) Topology, linear (Xl) Sequence: Sequence number 13: Val Gin τhr enter rg Cys Lys P: Ko Asp HLs Gly Tyx Dingrp Sat Arg 71m (2) Information on sequence number 14 (i) Array characteristics: (A) Length = 18 amino acids (B) type amino acid (D) Topology linear (xi) Sequence 2 Sequence number 14゜ (2) Information on sequence number 15 (1) Characteristics of array.

(A) Length, 27 bases (B) type, nucleic acid (C) Number of strands: single strand (D) Topology linear (xi) Sequence Sequence number 15゜ (2) Information on array number 16 (1) Characteristics of array (A) Length: 27 bases (B) type nucleic acid (C) Number of strands/single strand (D) Topology linear (xl) Sequence Sequence number 16゜ TCcIXMCMCGAGCC? CTGG Entering ＾ Entering Ding A Ding 27XGIA FIG, old 10' 10' 10' 10'' 1o゛3ZnC12 [M] FIG. 2 0 0.2 0.4 0.6 0.8 1 binding (μM) FIG.3 G5 [hP day Lbρ1 (M) FIG. 6 GλAττ0A enters: τ:τ::λτAkoτ τTGG enters τ enters AGG enters A τACAGλ enter τG enter λ enter A: 52 τCATTGCTGA Gτ ding G Fτ entered Tττ AAG τTGCCCAAAAAGAAGA AGAGτ0G entered Aτ 100GAACTGTGτG CGCAGGTAGA AGCτTTGG AG ATτ input τCGTCA CTGC A TGC τ 150TCGCAATA TG GCGCAAATG ACC Ayu CAGCG GTTGATTGAT C AGGTAGAG 200GGGCGCTGTA CGAGGTAAAG C CCGATGCCA GCATTCCTGA CGACGATACG 250G AGCTGCTGCGCGATTACGτ Enter GMGTTA TTGAAG CATCCTCGTC entry GTA 300 people AAGτ entry AT C’:’τTT CAACA GCTGTCATAA AGTTGTCACG GCCG-in GAC ’:τ 350ATAGTCGCττ 7 to 77τττATT TT’TTAA TGτA TTTGTAACTA GTACGCAAGT 400rxGTnX B (1/7) ACλGT’TAAAT τGCτGGCCACGGGTCAGGCACCGT GTATGAAA TCτ included ACAATG LL60CGCT:JsTCGT C-in TC’-TCGG: ACCC;? CAC: This τGGAT to C-cho Cτ A GG λτAGG: Uni 1CττF: a:sTT input TGCCGGTACTGC CGGG here': CTTG CGGG7%TkTCS τ: here ATT GA 1 26: rXGTntK, 11 (2/71 + AIJl+ 7’l gate-11-r%su1shi8-・Yaburi Tome’J+J(, -+Toru--AGkoS ni 3ko;ko　τAτA0koτ:Sτ　2■■■ C? Q″:CCC:CGCGTTGCGτCGCGGτGCAτG G input GC CGGGCCACC':'CGACCT L360G input ATGv input eight GCCGG GGCACCCτ0S τ input ACGG input TτCACC input CT CC input AGλ 8 to TG 24yu CGAGCCA entering TCA ATTCτTGCGG entering G entering AC To τ? GA ATGCGC entry ACCAACCCττGG 1460CAGAA CATAT CCATCGCGTCCGCCATCTCCAGCAGCCGCA CGCGGCGCAT 1510CTCGGGCAGCGτTGGGTCCT GGCCACGGG"!' GCGCATGATC"l"GcTccTGT 1560CGTTGAGGACCCGGCTAGGCTGGCGGGTT GCCτ ACTGG TTAGCAGMT 1610GAATCACCGA TACGCGAGCG AACGTG entry AGCGACTGCTGCT GC entry Input ACGTC1660ATCGCAGGAT GCTGCTGGCT ACCC TGTGGA ACACCTACAT CTGTATTMC1810G AGC GCTGG CAT’l”GACCCT GAGTGATT Ding Ding ‘I’CTC TGGTCCCGCCGCATCC1860ATACCGAG ττGTTT ACCCTCACAAC に τ CCAGTAACCG GGCATG τCA 1910ACAGGAAAAAA ACCGCCTTA ACATGGCCC G CTTTTATCAGA AGCCAGACAT 2060τ ACGCTT CT GGAGAAAACTC entered ACGAGCτGG ACGCGG entered GA A CAGGCAGAC2110TXCXn4 g (3/7) AT port τ5TGAAT CGC--CkCGA CCACGC-TG input TGA Gko77τACCGyrsG”-tsTc’+s +2EOGAAATTGTA A　ACGTTAATAT　TTTGTTAAAA　TTCGCGTTAA　A TTTTTGTTA 22LOAATCAGCTCA:”, -,”:”:’: AACCAATAGG::GA AATCGGCAAA ATCCCTTATA 2260CGTCTATCAG GGCTATGGCCCCACTACGTGA ACCATCACCCTAATCAAGT? 2410AGGGAAAGAAA GCGAAAGGAG CGGGCGCTAG GGCGCTGGCA AG TGTAGCGG 2560TCACGCTGCG CGTMCCACCACA CCCGCCG　CGCTTAATGCGCCGCTACAG　2610GGC GCGTCCG　CATCCTGCCCT　CGCGCGTTTCGGTGATG ACG GTGAAAACCT 2660CTGACACATG CAGCTC CCGG　AGACGGTCACAGCTTG’rCTG　TMGCGGGATG 2710CCGGGAGCAG ACAAGCCCGGT CAGGGCGCG T CAGCGGGTGT TGGCGGGTGT 2760CGGGGCGC AG　CCATGACCCA　GTCACGTAGCGATAGCGGAG　T GTATACTGG 2810CTTAACTATG CGGCATCAGA GCAGATTGTA CTGAGAGTGCACCATATGCG 2860 GTGTGAAATA CCGCACAGAT GCGTMGGAG AAAA τACCGCATCAGGCGCT 2910CTTCCGCTTCCTCGC TCACT　GACTCGCTGCGCTCGGTCGT　TCGGCTGCG G 2960rxC; a'RX 8 (4/)) λAτ: input λ::τ input λAST input: input τ input τ S input Gτλ input AC=τ GGτ τCλ こ入S::λ0こλλ:S2:已6C+:;IGcGGTATC AGCTC: ACτC input AAGGCGGτAAτ input 3Gτ: ACAG to Aτ ,, AT':': 20AGGGGATAACGCAGGAAAGA ACA TGTGAGCAAAAGGCC:AG CAAAAGGCCA 3060GG AACCGTAA AAAGGCCGCG TTGCτCGCCτ ττττ0 ;λτ entering G G+τCCGCCCC2::0CCTTCGGGAAGCGTG GCGCT 'rTcTcATAGcTCACGCTGTA GGTATCT CAG 3310TTCGGTGTAG GTCGTTCGCT CCAAGC TGGG CTGTGTGCACGAACCCCCCG 3360AAGCCA G? T’A　CCτTCGGAAA　AAAGAGTTGGT　AGCTCTTG AT CCGGCAAACA 3610AACCACCGCT GGTAGCG GTG GTTTTTTTGT TTGCAAGCAG CAGATTACGC 3660τACτ口τ″:00″: ττττCAATAT TATTGAAG λτττATCAGG, ll; ττAT"l': Tm drop m 4VE+'1 international search report 11 Pupils-1...Bite I□Sniff bw1m% snow pr Puha 1co1inζΩζ et al. International research report notice LIS 9105B56 Continuation of front page (51) Int, C1, S Identification symbol Internal office reference number Cl2N 15/12 ZNA C12P 21102 C8214-48GOIN 33/76 7055-2 J (72) Inventor Huiyu, Germain California 941, USA 16, 2610 39th Avenue, San Francisco (72) Inventor Rowman, Henry Bee California 94, USA 547, Bercules, 205 Falcon Way I (72) Inventor Matthews, Dipid Jay California, USA 1527 Noliniga Street, San Francisco, A94122 (72) Inventor: Wells, James Nee California 9, USA 1341 Columbus Avenue, Burlingame 4010

Claims (1)

[Claims] 1. The presence of metal ions in the metal ion binding site of mammalian hormone receptors mammals containing such metal ion binding sites that determine the hormone affinity of A method of modifying a polypeptide hormone-receptor complex, the method comprising: Keying metal ions to the mammalian polypeptide hormone-receptor complex histidine in mammalian polypeptide hormones or receptors that rate Substitution of glutamate, aspartate or cysteine amino acids with other amino acids Mutant hormones or hormones with reduced ability to chelate the metal ions by or receptor. 2. Metal ions include zinc, iron, nickel, copper, magnesium, manganese, and cobalt. 2. The method of claim 1, wherein the method is selected from the group consisting of , calcium, or selenium. 3. 3. A method according to claim 2, wherein the metal ion is zinc. 4. If the mammalian polypeptide hormone is growth hormone or placental lactogen 4. The method according to claim 3. 5. Hormone receptors are growth hormone receptors, prolactin receptors, The method according to claim 4, wherein the lactogen receptor is a placental lactogen receptor. 6. Mammals include primates, ungulates, cows, pigs, sheep, horses, cats, dogs, and 2. The method of claim 1, wherein the method is selected from the group consisting of Rodentia. 7. The mammal is human, the growth hormone is human growth hormone, and prolactone is 6. The method according to claim 5, wherein the tin receptor is a human prolactin receptor. 8. Human growth hormone is natural human growth hormone, and the amino acids substituted are human. according to claim 7, which is stidine 18, histidine 21 or glutamate 174. the method of. 9. Other substitutes for histidine 18, histidine 21 or glutamate 174 9. The method according to claim 8, wherein the amino acid is alanine. 10. The placental lactogen hormone is human placental lactogen, and the hormone being replaced is Claims that the amino acid is histidine 18, histidine 21 or glutamate 174 The method described in Section 4. 11. Substitute histidine 18, histidine 21 or glutamate 174, etc. The method according to claim 10, wherein the amino acid is alanine. 12. Histidine 21 of natural human growth hormone is converted to glutamate and aspartate. or a human growth hormone variant substituted with an amino acid other than cysteine. 13. Human growth according to claim 12, wherein histidine 21 is replaced with alanine. Hormone variants. 14. Histidine 18 and glutamate 174 of natural human growth hormone Substitution with amino acids other than tidine, glutamate, aspartate or cysteine 14. The human growth hormone variant of claim 13, further comprising: 15. Histidine 18 and glutamate 174 are replaced with alanine. 15. The human growth hormone variant according to claim 14. 16. natural human placental lactogen histidine 18, histidine 21 or glu Tamate 174 is histidine, glutamate, aspartate or cysteine Human placental lactogen variants substituted with amino acids other than . 17. Histidine 18, histidine 21 and glutamate 174 are all 17. The human placental lactogen variant according to claim 16, wherein the human placental lactogen variant is substituted with nin. 18. Human Growth Hormone Amino Acids Histidine 18, Histidine 21 or Gluta Amino acids corresponding to mate 174 are histidine, glutamate, and aspartate. or non-human growth hormone substituted with an amino acid other than cysteine Animal growth hormone mutants. 19. A corresponding to histidine 18, histidine 21 or glutamate 174 19. The variant according to claim 18, wherein the amino acid replacing the amino acid is alanine. 20. Growth hormone stimulates growth in cows, pigs, sheep, horses, cats, dogs or rodents 20. The variant according to claim 19, selected from the group consisting of hormones. 21. (a) The amino acid sequence of mammalian growth hormone is the amino acid sequence of human growth hormone. Amino acids corresponding to the acids histidine 18, histidine 21 and glutamate 174 A therapeutically effective amount of such mammalian growth hormone containing acid is administered to the mammal. administered to an animal; and (b) necessary for binding of said mammalian growth hormone to prolactin receptors; Maintains physiological zinc ion concentration and induces lactation stimulating response; A method of stimulating a lactogenic response in a mammal. 22. A claim in which the total physiological zinc ion concentration is maintained at about 0.5 to 100.0 μmol. The method according to item 21. 23. A therapeutically effective amount of human growth hormone is administered to a human while the human growth hormone is Physiological zinc ion concentration required for Lumon to bind to prolactin receptors. Stimulating the lactogenic response in humans consists of maintaining and inducing the lactogenic response how to. 24. Ensure that the total physiological zinc ion concentration is maintained at about 0.50 to 100.0 μmol. The method according to claim 23. 25. Zinc binding required for human growth hormone to bind to prolactin receptors Administering to humans a therapeutically effective dose of a human growth hormone variant in which the binding site has been deleted. A method of stimulating somatoform reactions in humans, comprising: 26. The mutants contain natural human growth hormone histidine 18, histidine 21, and glutamate 174 is glutamate, aspartate, histidine or cis 26. The method according to claim 25, wherein the amino acid is substituted with an amino acid other than tein. 27. histidine 18, histidine 21 or glutamate 174 is alanine 27. The method of claim 26, wherein: 28. The presence of metal ions at metal ion binding sites influences hormone levels in mammals. Contains such metal ion binding sites that determine the hormone affinity of the receptor Screening for possible mammalian polypeptide hormone variants A method, (a) Mammalian polypeptide hormones presumed to contain metal ion binding sites (b) incubating a solution containing the Mon mutant and a chelating reagent; Contacting the incubated mammalian polypeptide hormone with a hormone receptor ;and (c) detecting the formation of a polypeptide hormone-receptor complex; A method consisting of. 29. Metal ions include zinc, iron, nickel, copper, magnesium, manganese, and cobal. 29. The method according to claim 28, wherein the compound is selected from the group consisting of carbon dioxide, calcium, or selenium. 30. Mutant mammalian polypeptide hormones can be used as growth hormone or placental lactogens. 29. The method according to claim 28, wherein the method is a mutant of . 31. Whether the mammal is a human, cow, pig, sheep, horse, cat, dog, or rodent 29. The method according to claim 28, wherein the method is selected from the group consisting of: 32. the mammal is a human, the mutant hormone is a human growth hormone mutant, 31. The method of claim 30, wherein the receptor is the human prolactin receptor. 33. The variant is such that the substituted amino acid is histidine 18, histidine 21 or The person according to claim 32, which is a human growth hormone variant that is glutamate 174. Law. 34. A substitute for histidine 18, histidine 21 or glutamate 174 34. The method of claim 33, wherein the amino acid is alanine. 35. If the mammal is a human and the mutant hormone is a human placental lactogen mutant, 31. The method according to claim 30, wherein the receptor is a human prolactin receptor. 36. The variant shows that the substituted amino acid is relative to the amino acid in natural human growth hormone. The corresponding histidine 18, histidine 21 or glutamate 174 36. The method of claim 35, wherein the lactogen is a discogenic lactogen mutant. 37. A substitute for histidine 18, histidine 21 or glutamate 174 37. The method of claim 36, wherein the amino acid is alanine. 38. Mammalian prolactin-binding protein consisting of soluble prolactin-binding protein protein mutants. 39. Soluble prolactin-binding protein is human prolactin-binding protein. 39. The variant of claim 38. 40. If histidine 188 is histidine, glutamate, aspartate or 40. The variant according to claim 39, wherein the variant is substituted with an amino acid other than stain. 41. The variant according to claim 40, wherein histidine 188 is replaced with alanine. . 42. 39. The variation of claim 38, comprising administering a therapeutic amount of the variant to a mammal. Method using a variant. 43. Claims further comprising administering the variant in the presence of a therapeutic amount of growth hormone The method according to item 42. 44. Administered in the presence of a total physiological zinc ion concentration of 0.5 to 100.0 μmol. 44. The method of claim 43, further comprising: 45. The mutant is human soluble prolactin-binding protein, and growth hormone 44. The method of claim 43, wherein the human growth hormone is human growth hormone. 46. A DNA sequence encoding a human growth hormone variant according to claim 12. . 47. The mutants contain histidine 18, histidine 21 and glutamate 174. 47. The DNA sequence according to claim 46, which instead contains alanine. 48. DNA sequence encoding soluble human prolactin receptor. 49. The encoded human prolactin receptor binds to histidine 188. 49. A DNA sequence according to claim 48, comprising amino acid substitutions. 50. 49. The amino acid substitution at position 188 of histidine is alanine. DNA sequence. 51. Asparagine 218 is histidine, glutamic acid, aspartic acid and Human Growth Hormone Binding Protein Substituted with Amino Acids Selected from Cysteine A DNA sequence that encodes a protein. 52. 52. A DNA sequence according to claim 51, wherein the selected amino acid is histidine. 53. Amino acid corresponding to asparagine 218 in human growth hormone binding protein Mammalian growth hormone-binding proteins in which other amino acids have been inserted in place of amino acids Good quality. 54. The amino acids inserted are alanine, histidine, glutamate, and asparte. 54. The mammalian growth hormone compound of claim 53 selected from lactate and cysteine. Synthetic protein. 55. 55. The mammalian growth protein of claim 54, wherein the selected amino acid is histidine. Lumon binding protein. 56. 56. The protein according to claim 55, wherein the protein is a human growth hormone binding protein. Mammalian growth hormone binding protein. 57. amino acids with histidine, glutamate, aspartate or cysteine mammalian growth hormone binding protein containing amino acid substitutions, mammalian growth hormone Pharmaceutical preparations containing zinc and zinc. 58. Mammalian Growth Hormone is Human Growth Hormone, Mammalian Growth Hormone Human growth hormone in which the binding protein has asparagine 218 replaced with histidine 58. The pharmaceutical formulation according to claim 57, which is a protein binding protein. 59. Mammalian polypeptide hormone-receptor free of metal ion binding sites - A method for modifying a complex to contain a metal ion binding site, the method comprising: ( a) Polypeptide hormones or polypeptide hormones that do not contain metal ion binding sites. The amino acid sequence of the lumon receptor, which is a polypeptide with a metal ion binding site. Determine the amino acid sequence containing the region homologous to the putidohormone or receptor; do (b) a mammalian polypeptide hormone or hormone that does not contain a metal ion binding site; The amino acid sequence of the monoreceptor was converted into a polypeptide molecule containing the metal ion binding site. containing one or more amino acids similar to hormone or hormone receptors. Modify sea urchin; A method consisting of things. 60. 60. The method of claim 59, wherein the metal ion is zinc. 61. Polypeptide hormones are growth hormones and polypeptide hormone receptors. 61. The method of claim 60, wherein the protein is a growth hormone binding protein. 62. (a) Histidine 21 of human growth hormone is glutame F, asparte encodes a growth hormone variant in which amino acids other than cysteine or cysteine are substituted. DNA sequence encoding the soluble human prolactin receptor array; (b) Histidine 188 other than glutamate, aspartate or cysteine encodes a soluble human prolactin receptor containing amino acid substitutions of DNA sequence; (c) Soluble human prolactin protein in which histidine 188 is replaced with alanine a DNA sequence encoding the receptor; and (d) asparagine 218 is His. DN encoding human growth hormone binding protein substituted with tidine A array; An expression host transformed with a DNA sequence selected from the group consisting of. 63. Contains arginine 84 and aspartate 171 substituted with alanine A human growth hormone mutant that 64. Contains lysine 188 and glutamate 174 substituted with alanine Human growth hormone mutants. 65. Contains lysine 172 and glutamate 174 substituted with alanine Human growth hormone mutants.