JPH0646872A - Hcv antifenically active polypeptide and production of the same polypeptide - Google Patents

Abstract

PURPOSE:To obtain a polypeptide having hepatitis C virus (HCV) antigenic activity in high yield and purity by fusing a structural protein gene of the HCV with a beta-galactosidase gene and then expressing the resultant fused gene in Escherichia coli. CONSTITUTION:A fragment of a hepatitis C virus structural protein gene containing a base sequence capable of coding an amino acid sequence of the formula is fused to a beta-galactosidase gene. Escherichia coli is then transformed with a recombinant vector containing the resultant fused gene to culture the transformed Escherichia coli (e.g. HB101 [pHCX01]). Thereby, the objective polypeptide containing the amino acid sequence of the formula having the HCV antigenic activity can simply be obtained in high yield.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to an antibody (hereinafter sometimes abbreviated as anti-HCV antibody) produced by infection with hepatitis C virus (hereinafter sometimes abbreviated as HCV) which is the etiology of hepatitis C. Escherichia coli transformed with a recombinant vector containing a nucleotide sequence encoding a reacting polypeptide (hereinafter, may be abbreviated as a polypeptide having HCV antigen activity), a polypeptide produced using the Escherichia coli, and the polypeptide The present invention relates to a method for producing a peptide.

The polypeptide according to the present invention is extremely useful in immunological diagnosis of hepatitis C.

[0003]

2. Description of the Related Art Hepatitis C is a hepatitis caused by infection with HCV, and most posttransfusion non-A non-B hepatitis is said to be this hepatitis. And most of them progress to liver cancer. A part of the HCV gene was reported in European Patent EP0318216 (published in 1989) and European Patent EP0388232 (published in 1990), and subsequent studies determined the entire nucleotide sequence of the HCV gene.
HCV is an RNA virus having a gene length of about 10 kb (about 10,000 nucleotides), which has a structural protein region on the 5'side and a non-structural protein region downstream thereof. European Patent EP0318216 reported that a part of the gene encoding the non-structural protein region (NS3 to NS4 region) was inserted into a yeast expression vector, and this gene was expressed to produce an antigen protein called C100. There is. Currently, this method for detecting an antibody against the C100 antigen (C100 antibody) is used for diagnosing hepatitis C. However, as clinical application progresses, C100 antibody becomes positive only after about 3 to 6 months from the onset of hepatitis C. When tested with normal human serum or hepatitis C patient serum, false positive or false It has become clear that there are cases where the result is negative [Th
e Lancet, Vol.335, pp.754-757, (1990). and Clinical Sciences, 25, No. 7, 827, 1990]. in this way,
Diagnosis of hepatitis C with C100 antibody detection diagnostics alone is not sufficient, and so-called second-generation HCV antibody detection diagnostics have been developed in order to diagnose hepatitis C earlier and more specifically. It is being appreciated. This diagnostic agent is characterized by using not only the antigen of the non-structural protein region but also the antigen of the structural protein region, particularly the core region (hereinafter sometimes abbreviated as core antigen). The core antigen has higher reactivity as an antigen and higher specificity than the antigen of the non-structural protein region,
It is also an antigen that enables early diagnosis.

The antigen used for the diagnostic reagent for detecting HCV antibody is a recombinant antigen produced from HCV cDNA by a genetic engineering technique. As a method for producing the core antigen, European Patent EP0450931 (published in 1991) reports a method using a yeast host vector system, and JP-A-4-45795 reports a method using an insect cell host vector system.

[0005]

Generally, when a recombinant polypeptide is industrially produced, a host vector system of Escherichia coli is preferable because it is easy to culture the recombinant and express the recombinant polypeptide in a large amount. It is used. However, in the case of certain genes derived from humans or their viruses, it is known that large-scale expression is difficult because the expressed polypeptide is toxic to the host.

[0006] In Japanese Patent Laid-Open No. 4-144686, a pET vector system for gene expression by T7 RNA polymerase is used,
The core antigen has been successfully expressed in E. coli. However, in this method, in order to efficiently carry out gene expression, the expression is induced in the early or middle stages of the logarithmic growth phase in the recombinant culture, and the yield of the finally obtained recombinant is low. There was a problem. Further, since the method for purifying the core antigen from the recombinant is complicated, it is not always satisfactory as the method for industrially producing the recombinant antigen. Therefore, it has been desired to develop a method for producing a polypeptide having an HCV antigen activity simply and in a high yield by further highly expressing the gene of the HCV structural protein gene region, particularly the core region gene in Escherichia coli.

[0007]

[Means for Solving the Problems]
Regarding the structural protein gene region of V, the gene expression by the host vector system of E. coli has been earnestly studied. As a result, by fusing the structural protein gene of HCV with the β-galactosidase gene and expressing this fused gene in E. coli, we succeeded in obtaining a polypeptide having HCV antigen activity in high yield and high purity, The present invention has been completed.

That is, the present invention fuses an HCV structural protein gene fragment containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 with a β-galactosidase gene, and then transforms Escherichia coli with a recombinant vector containing the fused gene. Then, the transformed Escherichia coli is cultured, and there is provided a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 having HCV antigen activity.

Furthermore, the present invention fuses the HCV structural protein gene fragment containing the nucleotide sequence of SEQ ID NO: 2 with the β-galactosidase gene, transforms E. coli with a recombinant vector containing the fused gene, and A method for producing a polypeptide comprising an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 2 having HCV antigen activity, which comprises culturing transformed Escherichia coli.

Furthermore, the present invention provides that the transformed E. coli is HB101.
A method for producing a polypeptide having HCV antigen activity, which is [pHCX01]. The present invention also resides in Escherichia coli HB101 [pHCX01] containing a recombinant vector containing the β-galactosidase gene and a hepatitis C virus structural protein gene fragment containing the nucleotide sequence of SEQ ID NO: 2.

The present invention further resides in a polypeptide having HCV antigen activity, which comprises the amino acid sequence of SEQ ID NO: 1. The invention further resides in a fusion polypeptide having HCV antigenic activity, which comprises the amino acid sequence of SEQ ID NO: 3. The present invention will be described in detail below.

The HCV structural protein gene fragment referred to in the present invention is a gene fragment containing the core region of the structural protein gene of HCV, at least from the first N-terminal of HCV.
It is a DNA fragment having a nucleotide sequence encoding a polypeptide containing the 168th amino acid sequence. Specifically, it is a gene fragment containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1. For example, a gene fragment containing the nucleotide sequence of SEQ ID NO: 2 corresponds to this. In SEQ ID NO: 2, the nucleotide sequence of the gene is represented by DNA, but the HCV gene is originally RNA, and when decoding as a viral RNA gene, T (thymine) is replaced with U (uracil). Read it. The polypeptide encoded by the gene fragment containing the core region of the structural protein gene of HCV has excellent antigenic activity.

Such an HCV structural protein gene fragment can be obtained from a cDNA library prepared by separating viral genes from the serum of non-A non-B hepatitis patients after transfusion. For example, first, hepatitis C virus is isolated from patient serum by ultracentrifugation, and then the gene RN is isolated from the virus.
A was prepared and c was prepared using reverse transcriptase against the RNA.
After synthesizing DNA, the cDNA fragment is then inserted into a plasmid vector or a phage vector, and c
Prepare a DNA library. Then, the cDNA library is treated with serum (anti-HC
By carrying out immunoscreening using a serum containing V antibody), a target gene fragment can be obtained.
Also, the known nucleotide sequence of the HCV gene [Proc. Natl. Aca
d. Sci. USA, Vol.87, pp.9524-9528 (1990). and
Proc. Natl. Acad. Sci. USA, Vol.88, pp.2451 ~ 2455
(1991).], A DNA probe can be synthesized and the above cDNA library can be screened by DNA / DNA hybridization to obtain the target gene fragment.

The β-galactosidase gene referred to in the present invention is the β-galactosidase gene (lacZ) derived from Escherichia coli.
Is. The gene is a series of commercially available plasmid vectors, pUEX vector (Amersham product), pEX vector (Boehringer Mannheim product) or pMC1.
The gene contained in the 871 vector (Pharmacia product) or the like can be obtained by cutting out using an appropriate restriction enzyme site on the vector. Also, the nucleotide sequence of the β-galactosidase gene [EMBO J. Vol.2, pp.593-59
7, (1983)], a DNA probe can be synthesized and the gene can be obtained by screening a gene library of Escherichia coli prepared from DNA extracted from Escherichia coli by DNA / DNA hybridization. is there.

The fusion gene prepared by fusing the HCV structural protein gene fragment and the β-galactosidase gene can be prepared by ligating the two DNAs by a usual gene recombination technique. HC
The structural protein gene fragment of V utilizes a restriction enzyme site derived from a linker added at the time of preparing a cDNA library, a restriction enzyme site derived from a plasmid into which the gene fragment is inserted, and the β-galactosidase gene Both can be ligated by utilizing a restriction enzyme site derived from the plasmid into which is inserted, or a restriction enzyme site inside the gene. At this time, in order to correctly translate the amino acid sequences encoded by the nucleotide sequences of both genes,
Try to match the reading frame. The order of ligating both may be either, but it is more preferable to ligate the HCV structural protein gene fragment downstream of the β-galactosidase gene. Since the β-galactosidase gene is a gene derived from Escherichia coli, when the fusion gene is expressed in Escherichia coli, if the β-galactosidase gene is located upstream of the 5'side, the transcription and translation efficiency will be good and the expression level will be high. Because it will be.

When the HCV structural protein gene fragment is fused with the β-galactosidase gene to prepare a fused gene, a nucleotide sequence encoding an appropriate amino acid sequence may be inserted between both genes. For example, several chemical cleavage methods or enzymatic cleavage methods are known as specific cleavage methods for polypeptides. If a nucleotide sequence encoding an amino acid sequence to be cleaved by such a method is inserted, After the fusion gene is expressed in Escherichia coli to produce the fusion polypeptide, the fusion polypeptide is treated by the method to convert the HCV antigen-active polypeptide encoded by the HCV structural protein gene fragment into a β-galactosidase moiety. It can be obtained without inclusion.

A series of pUEX vectors, which are plasmid vectors having a β-galactosidase gene, and a series of pEX
When using a vector, since it has a multiple cloning site downstream of the β-galactosidase gene,
The fusion gene may be prepared by inserting the HCV structural protein gene fragment into an appropriate restriction enzyme site therein. If a fusion gene is produced by this method, a recombinant vector containing the fusion gene of the present invention can be produced at the same time, which is very suitable.

In addition, the recombinant vector containing the fusion gene of the present invention can also be prepared by inserting the fusion gene into a plasmid vector by a conventional gene recombination technique. As the plasmid vector, any conventionally known vector can be used as long as it can replicate in Escherichia coli, but a vector having a promoter for expressing an inserted foreign gene is particularly preferably used. For example, a series of pUC vectors (Takara Shuzo), a series of pTV vectors (Takara Shuzo), a series of pTZ vectors (Toyobo), and a series of pET vectors (Methods in E).
nzymology, Vol.185) etc. can be used.
A recombinant vector containing the fusion gene of the present invention is prepared by inserting the fusion gene using an appropriate restriction enzyme site downstream of the promoter of such a vector.

Among the recombinant vectors thus produced, the recombinant vector produced by using the pUEX vector as the plasmid vector is particularly preferable. pUEX
The reason why the vector is preferably selected is (1) because the copy number per cell is low, the growth of the host Escherichia coli is not inhibited by the produced polypeptide and the plasmid is stably retained. The promoter for expression is the λPR promoter, and the fusion polypeptide can be easily produced only by raising the culture temperature. (3) The produced fusion polypeptide is an insoluble granule (inclusion body) in the host bacterium. , It is difficult for the protease of the host to work and stability in the host fungus is good, (4)
It can be mentioned that the fusion polypeptide forming insoluble granules is easy to purify. pHCX01 is a specific example of a recombinant vector containing a fusion gene of the HCV structural protein gene fragment and the β-galactosidase gene, which was prepared using the pUEX vector.

Escherichia coli used for transformation can be used without particular limitation, but it is preferable to use Escherichia coli K-12 strain which is commonly used in genetic engineering. For example, JM83, JM
109, JM109 (DE3), HB101, DH1, C600, MV1184, MV119
You can use 0, etc. In order to efficiently carry out gene expression, it may be necessary to use an appropriate host Escherichia coli in combination with a vector. For example, pUC vector,
The pTV vector, pTZ vector and the like are vector systems in which gene expression is regulated by the lac promoter-lac operator, and gene expression can be effectively controlled by using E. coli having the repressor lacIq as a host. The pET vector expresses the foreign gene inserted into the vector, so that T
Since 7 RNA polymerase is required, JM109 (DE3) having a T7 RNA polymerase gene on the chromosome is used as the host E. coli. λ like pEX vector
When a vector having a PR promoter or a λPL promoter is used, a host Escherichia coli having a λ phage temperature sensitive repressor (cI857 repressor) is used. The pUEX vector also uses the λ PR promoter to express foreign genes, but with cI on the vector.
Since it has the 857 repressor gene, a wide range of Escherichia coli can be used as a host.

As a transformation method, a usual transformation method such as the calcium chloride method may be applied. Recombinant Escherichia coli HB101 [pHCX01] obtained by transforming host Escherichia coli HB101 with the recombinant vector pHCX01 in this way is located at 1-3-1 Higashi Tsukuba City, Ibaraki Prefecture at the Ministry of International Trade and Industry, Institute of Industrial Technology, Institute of Microbial Technology. It has been deposited as Microorganism Research Institute No. 13056.

The transformed E. coli may be cultured in a commonly used nutrient-rich medium for E. coli (L medium, TY medium, etc.). The recombinant vector prepared as described above has a drug resistance gene, and when culturing transformed E. coli, the corresponding drug must be added to the medium to an appropriate concentration. Is desirable.
For example, when culturing recombinant Escherichia coli HB101 [pHCX01], ampicillin may be added to the medium at a concentration of 20 μg / ml to 200 μg / ml. When the fusion protein gene is expressed, its promoter may be activated by an appropriate method to induce the expression. For example, in the case of pUC vector, pTV vector, pTZ vector and pET vector, after culturing in an appropriate medium until a certain amount of cells is reached, IPTG (isopropylthiogalactoside) is added to start gene expression. Is taken. In order to efficiently carry out gene expression, it is desirable to add IPTG in the early or middle phase of the logarithmic growth phase.
In the case of a vector having a λP R promoter such as pUEX vector and pEX vector, the bacterial cells to some extent are at a temperature at which the temperature-sensitive repressor of λ phage (cI857 repressor) functions, specifically in the range of room temperature to 30 ° C. After culturing until the amount is reached, gene expression is started by raising the culture temperature. The temperature is the temperature at which the temperature sensitive repressor is inactivated, specifically in the range of 40 ° C to 42 ° C. The culture temperature may be raised at any time in the early or late stages of the logarithmic growth phase. Since the fusion polypeptide obtained by gene expression is obtained in almost proportion to the amount of cells, it is better to raise the temperature in the latter stage of the logarithmic growth phase when obtaining a large amount of the fusion polypeptide. .

After inducing the expression, the culture is further continued to accumulate the fusion polypeptide in the cells. For example, in the case of recombinant Escherichia coli HB101 [pHCX01], after culturing in L medium supplemented with ampicillin at 30 ° C. until OD540 reached 1.5-3.0, the culture temperature was raised to 42 ° C. and further 2-4.
By culturing for a long time, a large amount of cells can be obtained and the fusion polypeptide can be obtained in high yield.

The method for collecting the fusion polypeptide from the bacterial cells obtained by culturing is to collect the bacterial cells, crush the bacterial cells by a method such as ultrasonic treatment, and then use the crushed bacterial cells to produce the fused polypeptide. Should be separated. When the fusion gene is efficiently expressed by the method as described above, the produced fusion polypeptide forms insoluble granules in the cells. The insoluble granules are obtained by suspending the cells in a buffer solution under physiological conditions such as physiological saline and then crushing the cells by a method such as ultrasonic treatment.
The disrupted cell product is collected as a precipitate by centrifugation. The recovered insoluble granules contain 20% or more pure fusion polypeptide. In addition, the insoluble granules are treated with low concentrations of urea or guanidine hydrochloride or Trit.
By washing with a buffer solution containing a detergent such as onX-100, a fusion polypeptide having a purity of 50% or more can be obtained. The fusion polypeptide forming insoluble granules is 8M
It can be solubilized by adding a buffer containing urea or 6M guanidine hydrochloride. The solubilized fusion polypeptide is used as an antigen for immunological diagnostics if the concentration of urea or guanidine hydrochloride is adjusted to an appropriate concentration or less by dialysis or dilution against a buffer solution such as physiological saline. it can. The solubilized fusion polypeptide is a known polypeptide purification method, for example, gel filtration,
It may be used as an antigen after further purification by applying a purification method by various column chromatography such as ion exchange.

The polypeptide having HCV antigen activity as used in the present invention means HC that is present in the body fluid of a hepatitis C patient.
It is a polypeptide that immunologically reacts with an antibody (anti-HCV antibody) generated by V infection, and can be used as an antigen for immunological diagnosis of hepatitis C. This HC
A polypeptide having V antigen activity is a cDNA of HCV
Is a recombinant polypeptide produced by a genetic engineering technique. Specifically, it is a polypeptide containing the amino acid sequence of SEQ ID NO: 1 and having HCV antigen activity, and may have an extra amino acid sequence added to its N-terminal or C-terminal. The polypeptide having HCV antigen activity as used in the present invention is produced by culturing Escherichia coli transformed with a recombinant vector having an HCV structural protein gene fragment containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1. It is a polypeptide. When a β-galactosidase gene is fused upstream of a structural protein gene fragment in the same reading frame when preparing a recombinant vector, the amino acid sequence of β-galactosidase should be added to the N-terminal side of the polypeptide. become. Also, since there is no stop codon on the 3'side of the HCV structural protein gene fragment containing the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, when the HCV structural protein gene fragment is inserted into the vector, the stop codon is Until it appears, transcription and translation of a gene encoding a random amino acid sequence continues, and as a result, the C of the polypeptide is
A polypeptide having a plurality of extra amino acids added to the ends is produced. However, such an amino acid sequence of β-galactosidase added to the N-terminal side, or C
The random amino acid sequence added to the end is irrelevant to the HCV antigen activity and does not affect the antigen activity of the polypeptide.

The HCV structural protein gene fragment and β-
If a nucleotide sequence encoding an amino acid sequence that is cleaved by a chemical cleavage method or an enzymatic cleavage method is inserted between the galactosidase genes, the fusion polypeptide produced can be treated by that method to obtain an HCV structure. An HCV antigen-active polypeptide containing the amino acid sequence of SEQ ID NO: 1 encoded by a protein gene fragment can be obtained without the β-galactosidase moiety. Even if a partial region of the amino acid sequence shown in SEQ ID NO: 1 is substituted, inserted, or deleted,
It is included in the present invention when the antigenic activity of the polypeptide is substantially equivalent to the polypeptide containing the present sequence.

The fusion polypeptide having an HCV antigen activity referred to in the present invention is a fusion polypeptide which immunologically reacts with an anti-HCV antibody and can be used as an antigen for immunological diagnosis of hepatitis C. . Specifically, it is a fusion polypeptide having the HCV antigen activity, which comprises the amino acid sequence of SEQ ID NO: 3, and may have an extra amino acid sequence added to its N-terminal or C-terminal. The fusion polypeptide having HCV antigenic activity of the present invention is produced by culturing E. coli transformed with a recombinant vector having a fusion gene containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3. Depending on the position of inserting the fusion gene into the plasmid vector when preparing the recombinant vector, the 5'side or 3'side base sequence of the fusion gene is transcribed and translated, and as a result, the N-terminal or C Polypeptides with extra amino acid sequences added to the ends may be produced. However,
Such a random amino acid sequence added to the N-terminus or C-terminus is irrelevant to the HCV antigen activity and does not affect the antigen activity of the fusion polypeptide.

Even if a partial region of the amino acid sequence shown in SEQ ID NO: 3 is substituted, inserted or deleted, the antigenic activity of the polypeptide is substantially the same as that of the fusion polypeptide containing this sequence. Are equivalent to each other,
Included in the present invention. The polypeptide or fusion polypeptide of the present invention can be used as an antigen for an immunological diagnostic agent for hepatitis C such as EIA, RIA or agglutination reagent. For example, in EIA or RIA, when a polypeptide is immobilized on an appropriate solid phase and a sample (serum or the like) is added to it, if an anti-HCV antibody (primary antibody) is present in the sample, it binds to the polypeptide. Then, by reacting a secondary antibody (anti-human immunoglobulin) that reacts with the anti-HCV antibody (primary antibody), the presence of the anti-HCV antibody (primary antibody) can be immunologically detected. As the detection method, a method of measuring the reaction of the enzyme using an enzyme-labeled secondary antibody (EIA),
There is a method (RIA) of detecting the radiation emitted from the radioactive compound using a secondary antibody labeled with a radioactive compound. A method using a fluorescently labeled secondary antibody can also be used. In the case of an agglutination reagent, a polypeptide is sensitized to a carrier and the carrier is allowed to react with a sample. At this time, when the anti-HCV antibody is present in the sample, the carrier aggregates, and the presence of the anti-HCV antibody in the sample can be immunologically detected.

[0029]

INDUSTRIAL APPLICABILITY According to the present invention, a polypeptide having a useful antigenicity that specifically reacts with an anti-HCV antibody can be efficiently produced. Since the polypeptide having useful antigenicity obtained by the present invention specifically recognizes the anti-HCV antibody present in the body fluid of a patient with hepatitis C, it is agglutination method,
It can be used as an antigen for various immunological diagnostic agents such as the enzyme antibody method.

[0030]

EXAMPLES The present invention will be specifically described below with reference to examples. However, the technical scope of the present invention is not limited by these examples. Example 1 Production of Escherichia coli HB101 [pHCX01] and Production of Fusion Polypeptide Having HCV Antigen Activity Unless otherwise specified in this example, the method of gene manipulation experiment is the method of Sambrook et al. [Sambrook, J., Fritsch,
EF, Maniatis, T., Molecular Cloning, 2nd ed.,
Cold Spring Harbor Laboratory Press, New York (198
9).]. The restriction enzymes were all manufactured by Takara Shuzo +. (1-1) Preparation of recombinant plasmid pGC03 (Preparation of RNA) 3000 ml of non-A non-B hepatitis patient serum after transfusion
Ultracentrifugation at 19,000 rpm for 16 hours gave a precipitate. The precipitate was treated with GITC solution (4M guanidinium isothiocyanate (Fluka +), 25 mM sodium citrate, 0.5% sarcosyl,
0.1M mercaptoethanol) 100 ml
For 100 ml, 100 ml phenol-chloroform
(1: 1) was added and shaken at room temperature for 15 minutes, then 3000 rpm, 15
Centrifuge for minutes. The aqueous layer of the reaction solution was taken out, 100 ml of isopropyl alcohol was added, the mixture was allowed to stand at -20 ° C for 3 hours and then centrifuged at 3000 rpm for 15 minutes to obtain a precipitate. To the precipitate, 10 ml of GITC solution was added to obtain a solution.
10 ml of phenol-chloroform was added to the solution.
(1: 1) was added and shaken at room temperature for 10 minutes, then 3000 rpm, 15
Centrifuge for minutes. The aqueous layer of the reaction solution was taken out, 20 ml of chloroform was added, and the mixture was shaken for 5 minutes. After shaking, 5 at 3000 rpm
After centrifugation for 10 minutes, 10 ml of the aqueous layer was collected. To 10 ml of this aqueous layer, 0.4 ml of 5M NaCl solution was added.

Then, 30 ml of ice-cold ethanol was added,
It was left at -20 ° C for 12 hours. After standing, it was centrifuged at 3000 rpm for 15 minutes to obtain a precipitate. The precipitate was washed with 75% ethanol, dried and then dissolved in 200 μl of distilled water to obtain an RNA solution. (Construction of cDNA library) cDNA synthesis is performed by BRL
The synthesis kit of the company was used. The method is the cDNA synthesis manual [BRL / Instruction Manua, Cosmo Bio Inc.
l, Cat. No8267SA]. (RN of this embodiment
Preparation of A), 5 μl of single-stranded RNA solution prepared from non-A non-B patient serum was added to random primer solution (100 μM)
5 μl of [Takara Shuzo + Product, Product Catalog No. 3810] was added and a reverse transcriptase reaction was carried out to form RNA / DNA double strands. Then E. coli DNA polymerase I and E. coli R
NA degrading enzyme H was added to form a DNA / DNA double strand. Next, at both ends of the double-stranded DNA thus obtained,
An EcoRI linker was attached. Takara Shuzo enzyme was used for this treatment, and the reaction was carried out under the reaction conditions attached to the Takara Shuzo enzyme. First, using approximately 1 μg of double-stranded DNA,
I-methylase treatment was performed, and then EcoRI linker (dGGAATTCC) was ligated by T4 DNA ligase reaction. The reaction solution finally obtained was cleaved with EcoRI to recover an EcoRI fragment.

Finally, this EcoRI fragment was inserted into the EcoRI site of λgt11 to prepare a recombinant λgt11 phage. The kit GIGAPACKII GOLD from Stratagene was used for this method, and the method was attached to the kit [Protocol / Protocol / Ins
truction Manual Cat. # 200214, 200215, 200216, Dece
mber 6, 1989]. First, at the EcoRI site of λgt11, Ec
The oRI fragment was inserted and ligated with T4 DNA ligase. The obtained recombinant phage DNA solution is GIGAPA
The CKII GOLD In Vitro Packaging Kit was used to reconvert to phages. The titer at this time was titrated to 1.0 ×
It was 106. This titer value indicates the number of independent clones. (Immunoscreening) cDNA inserted in λgt11
When the frames match, β incorporated in λgt11
-The amino acid sequence encoded by the cDNA is expressed as a fusion protein with galactosidase. This fusion protein was screened with non-A non-B hepatitis patient serum absorbed by E. coli cells. E. coli Y1090 was used as the indicator bacterium. L-bottom plate with a diameter of 15 cm (Ba per liter of water
cto-tryptone 10g, NaCl 5g, Yeastextract 5g, Bacto-
Agar (15 g) was added, and the phage solution and Y1090, which were prepared by autoclave sterilization) so that the number of plaques per plate was about 40,000, were incubated at 37 ° C for 15 minutes. 2.5 ml of 0.7% L-top agarose that had been warmed to 45 ° C was mixed with it, spread on an L-bottom plate, and after solidification, it was incubated at 42 ° C for 3.5 hours. Meanwhile, use a nitrocellulose filter with 10 mM isopropylthio-β-D-galactoside (IP
After being soaked in the (TG) solution for several minutes, it was dried at room temperature. The filter was placed on the plate and incubated overnight at 37 ° C. After incubation, remove the filter and
NT buffer (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.
05% Tween20) and rinsed well. Again, it was soaked in fresh TNT buffer for 30 minutes. Further, the filter was incubated with a blocking buffer (TNT buffer containing 20% fetal bovine serum) for 30 minutes. Next, the filter was reacted with primary antibody solution diluted 150 times with blocking buffer (non-A non-B hepatitis patient pool serum absorbed with ultrasonic lysate of Y1090) at room temperature for 4 hours with gentle shaking. . Then, filter the TNT buffer containing 0.1% bovine serum albumin (BSA), 0.1% B
The TNT buffer containing SA + 0.1% NP-40 and the TNT buffer containing 0.1% BSA were washed in this order for 10 minutes each. Next, 10
15 μl of horseradish peroxidase-labeled anti-human IgG goat IgG (Kirkeguard & Perry Lab) 15
After soaking the filter in ml of blocking buffer and reacting for 2 hours at room temperature, 0.1% BSA-containing TNT buffer,
The cells were washed with TNT buffer containing 0.1% BSA + 0.1% NP-40 for 10 minutes each. Furthermore, the filter was set to 10 mM Tris-HCl (pH
7.5), after washing with 150 mM NaCl for 1 minute, the staining solution [60 mg 4-chloro-naphthol containing 20 ml of methanol immediately before use,
10 mM Tris-HCl (pH 7.5) containing 60 μl of 30% H2 O2,
After mixing with 100 ml of a 150 mM NaCl solution for 15 minutes at room temperature and washing twice with distilled water, positive plaques colored in purple were obtained.

Phage DNA was prepared from this recombinant phage, treated with EcoRI, the cDNA fragment was recovered from an agarose electrophoresis gel, and the plasmid vector pUC18 was prepared.
Was inserted into the EcoRI site of The plasmid was named pGC03 and the nucleotide sequence was determined. This cDNA fragment contains HC
It was revealed that the core region of the structural protein gene of V was included. (1-2) Preparation of Escherichia coli HB101 [pHCX01] After digesting pGC03 with HinfI, DNA polymerase I Kleno
The ends were blunted with w fragment. This DNA and BamH
I linker (dCGGATCCG, manufactured by Takara Shuzo +) was ligated with T4 DNA ligase, further digested with BamHI, and a 0.56 kb fragment containing a core region was recovered from an agarose electrophoresis gel. This 0.56 kb fragment was used as the plasmid vector pUC19.
At the BamHI site of BspHI (Ne
w England Biolabs) and the ends were blunted with T4 DNA polymerase. This DNA is BamHI
Digestion was performed and the 0.51 kb core region DNA fragment from which the 5'-untranslated region was removed was recovered from an agarose electrophoresis gel. this
The 0.51 kb fragment was inserted into the plasmid vector pUEX2 (Amersham) at the SmaI to BamHI sites to obtain the recombinant vector pH.
I got CX01. The above plasmid construction process is shown in FIG. Next, the recombinant vector pHCX01 was transformed into host Escherichia coli HB101 to obtain recombinant Escherichia coli HB101 [pHCX01]. Recombinant E. coli HB101 [pHCX01] was added to LB + Amp medium [Bact
o tryptone 1.0%, Yeast extract 0.5%, NaCl 0.5%, ampicillin (Amp) 50 µg / ml] at 30 ℃ overnight, and add glycerin to a final concentration of 15% at -80 ℃.
It was frozen and stored in. (1-3) Production of fusion polypeptide 1 ml of cryopreserved bacterial cells of recombinant Escherichia coli HB101 [pHCX01] was
1 liter of LB + Amp medium was inoculated and cultured at 30 ° C. overnight. This culture is then treated with 20 liters of LB + Am
The cells were inoculated into p medium and cultured at 30 ° C. until the OD 540 reached 1.5, the culture temperature was raised to 42 ° C., and the culture was continued for 3 hours. After culturing, the cells were collected by centrifugation to obtain 57 g of wet cells. The cells were suspended in 2 liters of a TNE buffer solution (50 mM Tris.HCl (pH8.3), 100 mM NaCl, 1 mM EDTA) containing 0.6 M urea, and disrupted by ultrasonication. This crushed product
Insoluble granules containing the fusion polypeptide were recovered in the precipitated fraction by centrifugation at 10,000 g for 20 minutes. This precipitate
The insoluble granules were washed again by suspending them in 2 liters of TNE buffer containing 0.6 M urea, and the precipitates were collected by centrifugation. This precipitate was further treated with 2 liters of TN containing 3M urea.
The insoluble granules were sufficiently washed by suspending them in E buffer and stirring at room temperature for 30 minutes, and then the insoluble granules were collected in a precipitate fraction by centrifugation. To the precipitate of the insoluble granules, 200 ml of TNE buffer containing 8M urea was added to solubilize the precipitate. The supernatant was collected by centrifugation at 16,000 g for 20 minutes and dialyzed against TNE buffer to give a purified fusion polypeptide. From 20 liters of culture, 980 mg of purified fusion polypeptide was obtained. Comparative Example Preparation of Escherichia coli JM109 (DE3) [pHCV-03] and production of polypeptide having HCV antigen activity (1) E. coli JM109 (DE3)
Preparation of [pHCV-03] After digesting pGC03 prepared in Example 1 with HinfI, DNA was prepared.
The ends were blunted with polymerase I Klenow fragment. This DNA and BamHI linker (dCGGATCCG, Takara Shuzo +
Made by T4 DNA ligase, and then ligated.
After digestion with BamHI, a 0.56 kb fragment containing the core region was recovered from an agarose electrophoresis gel. This 0.56 kb fragment and BspH
After digestion with I, a 0.51 kb core region DNA fragment excluding the 5'untranslated region was recovered from an agarose electrophoresis gel. This 0.51 kb fragment was cloned into plasmid vector pET-3d from NcoI to BamH.
It was inserted into the I site to obtain the recombinant vector pHCV-03. This recombinant vector pHCV-03 was transformed into host Escherichia coli JM109 (DE3) [Promega product] to produce recombinant E. coli.
JM109 (DE3) [pHCV-03] was obtained. Recombinant E. coli JM109 (DE
3) [pHCV-03] was cultured in LB + Amp medium at 37 ° C for 12 hours, glycerin was added so that the final concentration was 15%, and the mixture was frozen and stored at -80 ° C. (2) Production of polypeptide A portion of the cryopreserved cells was inoculated into 10 ml of LB + Amp medium and cultured at 37 ° C overnight. This culture is then
l of LB + Amp medium was inoculated, and this was cultured at 37 ° C. overnight. This culture was further treated with 20 liters of T1.5 G + A.
mp medium (Bactotryptone 1.5%, Glucose 0.4%, NaCl
0.5%, ampicillin 200 μg / ml) and cultured at 37 ° C. When OD600 reached 0.7, IPTG was added to a final concentration of 0.4 mM, and further incubated at 37 ° C for 4 hours. And produced a polypeptide. After culturing, the cells were collected by centrifugation to obtain 10 g of wet cells. Next, the cells were placed on ice in 10 mM-PiGM buffer (10 mM phosphate buffer (pH 7.0), 6 M).
It was suspended in guanidine hydrochloride and 14 mM β-mercaptoethanol. After crushing this by ultrasonic treatment, 13,000
Centrifugation at rpm for 30 minutes gave a supernatant. This supernatant was left overnight at 4 ° C. and then centrifuged again to use the supernatant as an extract. Using an extract, Sephacryl S-300 (manufactured by Pharmacia), 20 mM-PiG buffer (20 mM phosphate buffer (pH 7.
0) and 2M guanidine hydrochloride) were used for gel filtration column chromatography for separation. Fractions containing the polypeptide of interest were identified and collected by SDS polyacrylamide gel electrophoresis (SDS-PADE).

Next, a phosphocellulose P11 (manufactured by Whatman) column was loaded with 10 mM-PiUM buffer (10 mM phosphate buffer (pH
7.0), 6 M urea, 14 mM-β mercaptoethanol) and equilibrated with the same buffer, and the gel filtration fraction was applied. After washing the column, elution was performed with a linear concentration gradient of NaCl from 0M to 0.5M. A fraction containing the target polypeptide identified by SDS-PAGE was recovered from the obtained fraction and used as a purified polypeptide. 34 mg of purified polypeptide was obtained from 20 liters of culture.

The productivity of the polypeptide of Example 1 and the comparative example are shown in Table 1 for comparison. The cell yield in the table is 1
The wet cell weight and the polypeptide content rate obtained per liter culture were calculated by performing SDS-PADE and densitometer measurement on the crushed cell product, and the target polypeptide content rate relative to the total cell protein content and the purified polypeptide content were calculated. Peptide indicates the protein amount of the target polypeptide purified and recovered from the bacterial cells per liter of culture.

Table 1 ─────────────────────────────────── Example 1 Comparative Example HB101 [pHCX01] JM109 (DE3) [pHCV-03] ─────────────────────────────────── Cell yield (1 liter Per culture) 2.9g 0.5g Polypeptide content 11% 5.8% Purified polypeptide 49mg (7.2mg) 1.7mg ────────────────────────── ────────── () indicates the amount of HCV core protein in the fusion polypeptide.

As a result, recombinant Escherichia coli HB101 [pHCX01]
It was revealed that, compared with recombinant Escherichia coli JM109 (DE3) [pHCV-03], the amount of cells obtained by culturing was large and the yield of the target polypeptide was also high. Example 2 Reactivity with anti-HCV antibody A fusion polypeptide produced by recombinant Escherichia coli HB101 [pHCX01] was transfused by Western blotting with non-A non-B hepatitis patient serum (serum containing anti-HCV antibody). The reactivity was investigated.

First, SDS-PADE was carried out on 2.5 μl of the disrupted cell of Example 1. The proteins separated by SDS-PADE were electrically transferred to Immobilon PVDF transfer membrane (manufactured by Millipore) using a transfer device (Transblot SD semi-dry transfer cell) manufactured by Bio-Rad. The method is the method of Andersen et al. [J. Biochem. Biophys. Metho
d, Vol.10, p203 (1984).]. Then, after immobilon PVDF transfer membrane to which the protein was transferred was blocked, normal human serum or post-transfusion non-A non-B hepatitis patient serum was reacted as a primary antibody.
Next, biotinylated anti-human IgG antibody (Vect
or a product of company). Next, Vector VecstainABC
Using the kit, avidin and biotinylated peroxidase were reacted, and a color reaction with hydrogen peroxide and 3,3′-diaminobenzidine was performed to detect anti-HCV antibody (primary antibody) in serum. Also, this experiment is the method of Tobin et al. [Proc.Natl.Acad.Sci.USA, Vol.76, p4350 (1979).]
Went according to.

The results are shown in FIG. When blood serum of a non-A non-B hepatitis patient was used after transfusion, a specific positive band was detected at a position corresponding to about 140,000 kd. In addition, in the case of Western blotting performed using normal human serum in the same manner, these bands were not detected. From this, the recombinant E. coli HB101 [pH of the present invention
The fusion polypeptide produced by CX01] is anti-HCV
It has been found that hepatitis C patients can be specifically determined by reacting specifically with the antibody.

[0040]

[Sequence list]

1. SEQ ID NO: 1 (1) Sequence length: 168 (2) Sequence type: amino acid (3) Topology: Linear (4) Sequence type: Protein (5) Origin Biological name: HCV (hepatitis C virus) 2. SEQ ID NO: 2 (1) Sequence length: 504 (2) Sequence type: nucleic acid (3) Number of strands: double-stranded (4) Topology: linear (5) Sequence type: cDNA to genomic RNA ( 6) Origin Organism name: HCV (hepatitis C virus) (7) Sequence features: Symbol representing the feature: peptide Location: 1-504 Method by which the features were determined: E (8) Sequence ATGAGCACAAATCCTAAACCTCAAAGAAAA 30 ACCAAACGTAACACCAACCGCCGCCCACAG 60 GACGTTAAGTTCCCGGGTCACGTGCAGAGT 90GT 120 GGCCCCAGGTTGGGTGTGCGCGCGACAAGG 150 AAGACTTCCGAGCGATCCCAGCCGCGTGGA 180 AGACGCCAGCCCATCCCGAAAGATAGGCGC 210 TCCACCGGCAAGTCCTGGGGAAAGCCAGGA 240 TATCCTTGGCCTCTGTATGGAAACGAGGGT 270 TGCGGCTGGGCAGGTTGGCTCCTGTCCCCC 300 CGCGGATCTCGTCCTACTTGGGGCCCCACT 330 GACCCCCGGCACAGATCGCGCAATTTGGGC 360 AAAGTCATCGACACCATTACGTGTGGTTTT 390 GCCGACCTCATGGGGTACATCCCTGTCGTT 420 GGCGCCCCGGTCGGAGGCGTCGCCAGAGCT 450 CTGGCACACGGTGTTAGGGTCCTGGAAGAT 480 GGGGTAAATTATGCAACAGGGAAT 504 3. SEQ ID NO: 3 (1) Sequence length: 1217 (2) Sequence type: amino acid (3) Topology: linear (4) Sequence type: protein (5) Origin Biological name: Escherichia coli and HCV (hepatitis C) virus)

[Brief description of drawings]

FIG. 1 is a construction diagram of a recombinant vector pHCX01.

FIG. 2 shows the fusion polypeptide produced by recombinant Escherichia coli HB101 [pHCX01] after transfusion by Western blotting with non-A non-B hepatitis patient serum (lane 2).
FIG. 3 is an electrophoretogram for examining the reactivity with normal human serum (lane 3). In Lane 1, after SDS-PADE,
The gel is Coomassie stained. M is a molecular weight marker, and the molecular weight (Dalton) is shown on the left side of the lane.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location C12N 15/62 G01N 33/576 Z 9015-2J (C12P 21/02 C12R 1:19) (C12N 1 / 21 C12R 1:19)

Claims (6)

[Claims] 1. A hepatitis C virus structural protein gene fragment containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 is fused with a β-galactosidase gene, and then E. coli is transformed with a recombinant vector containing the fusion gene. And then culturing the transformed Escherichia coli. A method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 having HCV antigen activity, which comprises culturing the transformed Escherichia coli. 2. A hepatitis C virus structural protein gene fragment containing the nucleotide sequence of SEQ ID NO: 2 is fused with a β-galactosidase gene, and E. coli is transformed with a recombinant vector containing the fused gene. A method for producing a polypeptide comprising an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 2 having HCV antigen activity, which comprises culturing transformed Escherichia coli. 3. The method for producing the polypeptide according to claim 1, wherein the transformed Escherichia coli is HB101 [pHCX01]. 4. Escherichia coli HB101 [pH containing a recombinant vector containing a β-galactosidase gene and a hepatitis C virus structural protein gene fragment containing the nucleotide sequence of SEQ ID NO: 2]
CX01]. 5. HCV comprising the amino acid sequence of SEQ ID NO: 1
A polypeptide having antigenic activity. 6. HCV comprising the amino acid sequence of SEQ ID NO: 3
A fusion polypeptide having antigenic activity.