JPH0644866B2 - Transformant for producing human epidermal growth factor - Google Patents

Description

TECHNICAL FIELD The present invention relates to recombinant DNA technology for producing human epidermal growth factor (abbreviated as hEGF). More specifically, it relates to a bacterial or animal cell transformed with a DNA containing a novel synthetic gene corresponding to hEGF.

Conventional technology hEGF is secreted mainly from the duodenum and the submandibular line 5
It is a polypeptide hormone consisting of 3 amino acids and has gastric acid secretion inhibitory action and epidermal cell growth promoting action. The gastric acid inhibitory action of hEGF shows its potential as a therapeutic drug for duodenal tumor. Furthermore, it is known that hEGF binds to the EGF receptor present on the cell membrane surface to induce multifaceted biological reactions [D. G
ospodarowicz, “Annual Review
Of Physiology (Ann. Rev. Physio
l. ) ”, 43 251 (1981)]. The response induced by EGF is the same as the response induced by the oncogene product of oncovirus, and elucidation of the role of EGF in vivo and the mechanism of cell growth regulation is also important in order to investigate the mechanism of carcinogenesis. It is considered to be interesting. However, since the amount of naturally occurring hEGF is extremely small, recombinant DN
Production using technology A has come to the fore. hEGF
Since it is extremely difficult to obtain a gene from human tissues due to various restrictions, the DNA sequence of hEGF has not been determined yet.

On the other hand, the previously determined amino acid sequence of hEGF [H. Gregory, “Nature
e) ”, 257 , 325 ('75)], a chemically synthesized structural gene is known to be expressed in a microorganism. However, EGF is a peptide having a relatively low molecular weight, and is expressed as a fusion peptide in consideration of the fact that it is recognized as a foreign substance in the bacterial cell and is easily enzymatically decomposed [J. Smith et al., Nucleic Acids Research.
h) ", 10 4467 ('82)]. Also, a method of removing an unnecessary portion from the fusion peptide has been proposed, but it is only extremely uncertain (Stephen James Brewer et al., JP-A-58-216697). hEG
An example of expressing F itself is known in the yeast system, but [M. S. Urdea et al., "Procedures of National Academy of Science (Pr
oc. Natl. Acad. sci. USA) ", 8
0 '7461 ('83)], the expression level is very low,
It is not suitable for mass production due to the slow growth rate of yeast.

Problems to be Solved by the Invention As described above, the DNA sequence of the hEGF gene has not yet been elucidated, and there have been attempts to express corresponding genes synthesized on the basis of the amino acid sequence of hEGF in various systems. In the method of expressing as a fusion peptide, there is complexity in its operation, difficulty in removing unnecessary portions, etc., and in the case of directly expressing the synthetic gene without using the fusion peptide, the production amount is extremely low, It wasn't practical.

Means for Solving the Problems As a result of intensive research conducted by the present inventors to provide a method for efficiently producing hEGF, hEG suitable for this purpose was obtained.
The present invention has been completed by finding the DNA sequence of F, establishing the method for producing the gene, the recombinant DNA containing the gene, and the host transformed with the DNA.

What has been conventionally used as a DNA sequence for hEGF consists of codons suitable for expression systems such as Escherichia coli and yeast, but the present inventors have now expressed expression that is considerably different from humans. Mouse EGF (mEGF) closer to humans, completely different from codons suitable for the system
The present invention has been completed by paying attention to the above gene.

hEGF is that of mouse [J. Scott et al., "Science", 221 236 ('8).
Compared with 3)], there is 70% homology in the amino acid sequence, and most of the differences in amino acids are also derived by the one point mutation of the codon. That is, the DNA sequence of the hEGF gene is presumed to be very similar to that of mouse. Generally, when a DNA sequence is derived from an amino acid sequence, a large number of DNA sequences are possible due to degeneracy of codons. Therefore, as a standard for determining the sequence of the synthetic gene, it is customary to adopt the most accepted codon in the cells of the expression system [Itakura et al., "Science", 198 , 1056 (197).
7)].

However, recent findings show that eukaryotic genes can be expressed in prokaryotes without any problems and in some cases are more efficient than genes adapted to the expression system [M. H. C
aruthers, "Nucleic Acids Research, Symposium Series (Nucleic Aci
ds Research, Symposium Ser
ies) " 11 , 197 ('82)]. There are many factors for enhancing gene expression,
The stability of the mRNA corresponding to the structural gene and the translation efficiency are also emphasized. In this case, the higher-order structure determined by the base sequence of mRNA is presumed to have an important meaning. Considering these points, the DNA sequence of the hEGF gene should be similar to the mouse EGF gene as long as the amino acid sequence is not changed. In fact, when the hEGF gene was designed based on this idea, it was possible to have a homology close to 90% with that of the mouse. However, in order to construct the target gene accurately, the presence of relatively long self-complementarity on the DNA strand or abnormal complementarity between double-stranded DNAs should be minimized. A computer was used to make some modifications to satisfy these conditions.
We have found a new DNA sequence that is most suitable for the production of GF.
FIG. 1 shows the amino acid sequence in addition to the DNA sequence.

The gene can be expressed as a fusion peptide, or can be directly expressed as hEGF without being a fusion peptide.

In the former case, a DNA coding for a protein other than hEGF starting from the start codon ATG is placed at the 5′-end side of the hEGF synthetic gene, and ends with a stop codon (eg, TAG) or starts with the start codon ATG. A DNA encoding a protein other than hEGF may be placed at the 3'end of the gene and terminated with a stop codon (eg, TAG).

To use the latter for direct expression, hE
In addition to the sequence encoding the polypeptide of GF, a start codon ATG and a stop codon such as TAG are added to the 5'side and 3'side, respectively.
Side, and the 5'-end side and the 3'-end side are Eco RI and Bam HI sticky ends respectively for insertion into the vector. A recognition site for BglII is provided in the latter half of the gene. Further, a Pst I recognition site can be provided downstream of the 3'end. With the above modifications, the mouse E
It has 80% homology to the GF (mEGF) gene.

In the synthesis of the hEGF gene used in the present invention, for example, as shown in FIG.
Although it was divided into individual fragments, care was taken here to avoid the appearance of self-complementary sequences at the 5'or 3'ends to avoid fragment self-association. Each DN is shown in FIG.
A fragment is shown. The method of division into fragments is not limited to the above and can be variously divided if care is taken to avoid the above self-association.

Each DNA fragment (# 1 to # 22) can be produced according to a known synthetic method. If necessary, each fragment was phosphorylated at the 5'end with a polynucleotide kinase,
It is divided into 3 groups and hybridized to form double-stranded DNA with DNA gauze. Further, complete hEGF gene was obtained by ligating each group again with DNA ligase (see FIG. 4).

This is ligated with a digestion product of pBR322 with EcoRI and BamHI to obtain a new plasmid pTB361, which is transformed into Escherichia coli DH1. The nucleotide sequence of the isolated plasmid is determined by the Sanger method using a part of the DNA fragment as a primer to confirm the presence of the target hEGF gene.

When expressing the synthetic gene of the present invention, it is preferably used as a recombinant DNA inserted into a vector such as a plasmid or bacteriophage.

The recombinant DNA preferably has a promoter upstream of the above-mentioned initiation codon ATG, and any promoter may be used as long as it is suitable for the host used for the structure of the transformant.

For example, Escherichia col
i; eg, 294, W3110, DH1, N4830, etc.), trp promoter, lac promoter, r
ec A promoter, λP promoter, lpp promoter, etc., such as Bacillus subtilis
ilis (eg, MI 114, etc.), yeast (Saccharomyces cerev) such as SP01 promoter, SP02 promoter, penP promoter, etc.
isiae; eg AH22), PH05 promoter, PGK promoter, GAP promoter, AD
Animal cells (eg, monkey cells COS-
7, Chinese hamster cells CHO, etc.) SV
40-derived promoter and mouse leukemia virus (Mu
Examples thereof include a promoter of the LTR region derived from LV). Especially when the host is E. coli, the promoter is tr
The promoter is preferably a p promoter or a λP _L promoter, and when the host is an animal cell, it preferably has an enhancer in addition to the above promoter.

An example of the expression of the hEGF synthetic gene will be described below (see FIG. 5).

The 172 base pair DNA cut out from pTB361 with EcoRI-PstI was used as an expression vector ptrp781.
Was incorporated into the EcoRI and PstI sites of E. coli to obtain the expression vector pTB370 under the control of Ptrp.

On the other hand, a 179 base pair DNA obtained by digesting pTB361 with EcoRI-BamHI was used as an expression vector p.
The EcoRI-BamHI site of TB281 built-in _{P L}
The expression vector pTB372 under control was used.

Escherichia coli DH1 was transformed with pTB370, and growing colonies were selected using ampicillin sensitivity as an index to obtain a strain containing the target hEGF gene.

In the case of pTB372, temperature sensitive E. coli N4830
Escherichia coli D was transformed with pTB372, which was transformed by using Escherichia coli and selected with tetracycline sensitivity as an index.
H1 was transformed to express a synthetic gene.

In addition, the EGF gene excised from pTB361 with EcoRI-BamHI was used as an animal cell expression vector pT.
Incorporated into B396, and further upstream of its SV-40 promoter, the mouse leukemia virus-derived LTR region (M
uLV LTR) -containing DNA fragment was ClaI-Hin
It is cut out with dIII and inserted, and it is used as an animal cell expression vector p
It was set to TB506.

Mouse LA9 cells were co-transformed with pTB506 and cloned into transformants mouse LA9-EGF-3.
Cells.

When these transformants were cultured and hEGF contained in the solution treated with 7M guanidine was quantified by a human fetal foreskin cell EGF receptor binding assay by a competitive reaction with [ ¹²⁵ I] -labeled mEGF, E. coli DH1
/ PTB370 showed a production amount of about 2 mg / l or more (see Table 1). This expression level is hE in E. coli.
Notable is the direct expression of GF.

Action In the present invention, the DNA sequence of the hEGF gene does not adopt the most accepted codon in the cells of the expression system, but rather a synthetic DNA having a high homology with the DNA sequence of the mEGF gene which is similar in amino acid sequence to hEGF. By adopting the sequence, the effects of the mRNA stability, the translation efficiency, and the higher-order structure determined by the base sequence of the mRNA are improved, and hEGF is efficiently produced. Further, in the synthetic gene for hEGF expression used in the present invention, by having a recognition site for Pst I near the BglII, 3 ′ end in the latter half of the structural gene, the success or failure of gene insertion and the confirmation of the insertion direction can be facilitated, Since it can be used in several types of vectors, it can exhibit its advantages in gene manipulation and diversity.

The synthetic gene for hEGF expression used in the present invention has a novel DNA sequence and has a high homology with the DNA sequence of the mouse EGF gene, which is much closer to human than a microorganism, and has a high expression rate of hEGF. It is expected that hEGF can be efficiently expressed for the first time by bacteria or mammalian cells transformed with the DNA having the novel hEGF gene of the present invention, and direct expression in a system using Escherichia coli as a host becomes possible. It was Furthermore, hE of the present invention
By recombinant DNA technology using a synthetic gene corresponding to GF, hEGF can be produced more efficiently, production of hEGF as a therapeutic agent, elucidation of the role of hEGF in vivo and cell growth regulation mechanism, As a result, it is useful for elucidating the carcinogenic mechanism.

Examples and Effects Next, the present invention will be described by examples.

The transformant Escherichia coli (E
scherichia coli) DH1 / pTB37
0 and Escherichia
coli) DH1 / pTB372, pRK248cIt
s is the IFO of the Fermentation Research Institute (IFO)
-148.3 and IFO-14380, and from October 5, 1984 to the Institute of Microbial Technology (FRI), Ministry of International Trade and Industry, FERM BP-8.
43 and FERM BP-844. Mouse LA9-EGF-3 has been deposited at the Fermentation Research Institute Foundation as IFO-50055.

Reference example 1. Synthesis of DNA Fragments DNA fragments are synthesized by solid phase synthesis by the phosphorylester method [Ito, H. et al. Et al., Nucleic Acids
Research (Nucl. Acids Res.) ", 10 ,
1755 (1982)]. The dimer block used as a raw material is prepared by the method of Broka et al. [Br
oka, C.I. , "Nucleic Acids Research (Nucl. Acids Res.)", 8 , 5461.
(1980)] or a fully protected dimer of a commercially available product (Wako Pure Chemical Industries, Ltd.) with pyridine (P
y), triethylamine (TEA), water (3: 1: 1,
v / v) to dissolve the mixture and remove the cyanoethyl group,
The powder was used in a mixed solution of pentane and ether (1: 1, v / v). The procedure for synthesizing a DNA fragment is as follows.

25 mg with dimethoxytrityl nucleoside attached
1% polystyrene (Backchem) was sequentially treated with the following reagents.

(1) 3% (w / v) trichloroacetic acid (TCA) in dichloromethane [Tanaka, T., et al., "Nucleic Acids Research (Nucl. Acids Re
s. ) ”, 10 , 3249 (1982)”, 1 minute x 2 (2
(2) Dichloromethane x 4 (3) Pyridine x 3 (4) 0.3 ml of dry pyridine containing 20 mg of dinucleotide block or 30 mg of monomer block (5) Reduce pressure of the above solution Concentrated under (pyridine azeotrope) (6) 25 mg mesitylenesulfonyl nitrotriazolide (MSNT) and 5 mg nitrotriazole in 0.3 ml dry pyridine at 40 ° C. for 20 minutes (7) pyridine × 2 (8) 10 2 ml of pyridine containing% (v / v) acetic anhydride and 0.1 M dimethylaminopyridine (DMAP)
2 minutes (9) Pyridine x 2 (10) Dichloromethane x 3 Using an appropriate dinucleotide or mononucleotide block, this cycle of about 40 minutes was repeated to complete the desired oligonucleotide chain. After the synthesis is completed,
0.5 M 1,1,3,3-tetramethylguanidinium-pyridine-2-aldoxime [Reese, C .; B.
Et al., “Tetrahedron Letters (Tetrahedro
n Lett. ) ”, 2727 (1978)] 40
The product was treated at 14 ° C. for 14 hours, the desired product was taken out from the polymer carrier, and then treated with concentrated aqueous ammonia at 60 ° C. for 4 hours to remove all protecting groups other than the dimethoxytrityl group. This sample was subjected to reversed-phase C ₈ silica gel (Licroprep RP-
(8, Merck) column (φ3.0 × 2.0 cm), and the fraction eluted with 30% acetonitrile was treated with 80% acetic acid at room temperature for 15 minutes. After washing with ether, the product was further purified by ion exchange high performance liquid chromatography (Partilsil 10SAX, Whatman) [Gait, M.
J. Et al. C. S. , "Chemical Communications (Chem. Commun.)", 37 (198).
2)] was carried out to obtain a pure DNA fragment. The 22 kinds of DNA fragments thus synthesized are as shown in FIG.

Reference Example 2 Phosphorylation of oligo DNA 25 μl of phosphorylation reaction solution of each DNA fragment [oligo DNA 2.5 μg, 50 mM Tris-HC
1, pH 7.6, 10 mM MgCl ₂ , 10 mM 2
-Mercaptoethanol, 1 mM ATP, 2.5 units T4 polynucleotide kinase (Takara Shuzo)],
The reaction was carried out at 37 ° C for 1 hour to phosphorylate the 5'end. This reaction solution was frozen as it was, thawed and used for the next reaction.

Reference Example 3 Ligation of DNA Fragment The series of steps in the double chain constitution of the hEGF gene is as shown in FIG. 4 (in the figure, the-mark indicates that the 5'-terminal hydroxyl group is phosphorylated). For example, block I was connected as follows. 12 species (DNA fragments 1 to 12
5 μl each of the phosphorylation reaction solution of the DNA fragment obtained by the operation of Reference Example 2 (corresponding to the above) was added to make 60 μl. To this, 1.4 units of T4 DNA ligase (Takara Shuzo) was added, incubated at 14 ° C for 25 hours, and then treated at 65 ° C for 10 minutes to stop the reaction. Here, in order to digest the dimer of Block I, which is the main product, with the restriction endonuclease EcoRI (Takara Shuzo), the following three components were added to this reaction solution: 50 mM NaCl, 0.01% bovine serum albumin (BSA). ), 7 mM MgCl ₂ and 120 units of Eco RI at 37 ° C.
After reacting for 1.5 hours, using a 6% acrylamide gel, a buffer solution (pH 8.3) [100 mM Tris-
HCl, 100 mM boric acid, 2 mM EDTA] in 2
It was electrophoresed at 5 mA for 1.5 hours. After migration, 0.6
The gel was stained with mg / l ethidium bromide (EtBr), and the gel piece containing the 101 bp DNA fragment was enclosed in a dialysis tube and immersed in a percussion solution for electrophoresis to electrically elute the DNA fragment from the gel [ (Journal of Molecular Biology (J. Mol. Bio
l. ) ”, 110 , 119 (1977)]. The solution in the dialysis tube was mixed with 0.01 M Tris-HCl, (pH
7.6), 0.1 M NaCl and 0.001 M ED
After extracting with phenol saturated with TA three times and further extracting with ether, NaCl was added so as to have a concentration of 0.2M. Subsequently, 2 volumes of cold ethanol was added to precipitate the DNA at -20 ° C. Block II (including # 13 to # 22) was further prepared by the same operation as above.

Example 1 Cloning of hEGF gene (FIG. 5) The Escherichia coli plasmid pBR3 was used as a cloning vector.
22 was used. pBR322 DNA was added to 20 μl of a reaction solution [10 mM Tris-HCl, pH 8.0, 7 mM.
MgCl ₂ , 100 mM NaCl, 2 mM 2-mercaptoethanol, 0.01% bovine serum albumin (BSA), 19 units EcoRI (Takara Shuzo), 5
In a unit of Bam HI (Takara Shuzo)], the mixture was reacted at 37 ° C. for 1 hour, then diluted 3 times with water and treated at 65 ° C. for 10 minutes to inactivate the enzyme. 0.5 μl of this reaction solution and about 2
5. Mix 0 equivalents of DNA fragment blocks I and II, and add 66 mM Tris-HCl (pH 7.5), 6.
6 mM MgCl ₂ , 10 mM dithiothreitol
(DDT) and 1 mM ATP, 10 μl of a reaction solution was allowed to act with T4 DNA ligase (New England Biolabs) for 2 hours at 14 ° C. to give hEGF.
The gene was ligated into a plasmid.

E. coli DH1 strain [Selson, M. et al. E. Et al., “Nature (Natur
e) ", 217 , 1110-1114 (1968)]. That is, 50 stored at -70 ° C
μl of competent cells [Hanahan, D .; , “Journal of Molecular Biology (JM
ol. Biol. ), 166 , 557 (1983)].
Was incubated at 0 ° C. for 15 minutes, and then 4 μl of the above reaction solution was added. After further incubating at 0 ° C. for 30 minutes, each was left at 42 ° C. for 1.5 minutes, and further left at 0 ° C. for 5 minutes. To this reaction solution, 200 μl of LB medium (containing 10 g of bactotryptone, 5 g of bacto yeast extract and 8 g of NaCl per liter) was added, and the mixture was incubated at 37 ° C. and 50 ° C.
Incubated for minutes. 35 μg / ml of this E. coli
It was spread on LB agar medium containing ampicillin and cultured at 37 ° C. overnight. 6 out of the resulting ampicillin resistant colonies
0 strain was selected and further inoculated on LB agar medium containing 7 μg / ml tetracycline, but 59 strain was not obtained. Next, 16 of these 59 strains were selected, and the plasmid DNA of this converted strain was subjected to the alkaline method [Maniatis, T. et al.
Et al., “Molecular Cloning”
Cloning (Cold Spring Harb
our)) ", 368-369 (1982)], digested with EcoRI and BamHI, and further digested with Eco.
It was digested with RI, BglII and PstI. From the migration patterns of these digests on a 2% agarose gel, 14
It was found that the strain was a transformant in which the hEGF gene was correctly inserted. The cloning vector thus obtained was named pTB361. This plasmid pTB
1 platinum loop of E. coli DH1 recombinant with 361
1.5 ml LB medium containing 5 μg / ml ampicillin
And cultured at 37 ° C. overnight with shaking. 0.3 ml of this culture solution was added to 25 ml of the same medium dispensed in a 200 ml flask, and the mixture was shake-cultured at 37 ° C. for 6.5 hours,
This medium was dispensed into a 500 ml flask with the same medium 12
The mixture was added to 5 ml and shake-cultured for another 45 minutes. Next, chloramphenicol was added at 170 μg / ml, and the culture was continued overnight to amplify the plasmid DNA. 150 ml of this culture solution is added to 6000 rp
m, 4 ° C, 9 minutes of centrifugation, the obtained bacterial cells were washed with physiological saline, and 4 ml of the reaction solution [25 mM Tris-H
Cl, pH 8.0, 50 mM glucose, 10 mM E
DTA, 1 mg / ml lysozyme] was added and suspended.
After 20 minutes in ice, 8ml of alkaline solution [1%
(W / v) SDS, 0.2N NaOH], and after 5 minutes in ice, 6 ml of 5M potassium acetate buffer (pH 4.8) was added, and the mixture was kept in ice for 10 minutes.
It was centrifuged at 00 rpm for 20 minutes at 4 ° C. To the obtained supernatant, twice the amount of ethanol was added, and after shaking, -20
Every 10 minutes at 4 ° C., centrifugation was performed at 10,000 rpm at 4 ° C. for 20 minutes. After air-drying the precipitate, 4 ml of buffer solution [1
mM Na ₂ EDTA (pH 8.0), 10 mM Tr
is-HCl (pH 8.0)], 3.9 g of cesium chloride (CsCl) and 3 mg of EtBr were added, and Be was added.
35,000 rpm, 1 with ckman 50Ti rotor
It was subjected to CsCl-EtBr equilibrium density gradient centrifugation at 5 ° C for 64 hours. The bands of plasmid DNA were collected and used in a double volume of buffer [1 mM Na ₂ EDTA, pH 8.0, 10].
mM Tris-HCl, pH 8.0] was added, an equal amount of chloroform-phenol (1: 1, v / v) was added, and the mixture was washed twice. After removing EtBr, ethanol precipitation was performed. The precipitate was added to 0.6 ml of buffer solution [1 mM E
DTA, 10 mM Tris-HCl, pH 8.0,
0.3M NaCl] and ethanol precipitation was performed again.

The nucleotide sequence of the hEGF gene incorporated in the plasmid pTB361 isolated here is the method of Wallace et al. [Wallace, R. et al. B. Et al., “Gen”
e) ”, 16 , 21-26 (1981)]. That is, pTB361 DNA was added to 10 μl of the reaction solution [7 mM
Tris-HCl, pH 7.5, 7 mM MgCl ₂ ,
The reaction was carried out in 50 mM NaCl, 4 units of PvuII (Takara Shuzo)] at 37 ° C. for 1 hour. An aqueous solution of DNA fragment # 7 (1.
0A260 / ml) (1 μl) was added, and the mixture was heated at 100 ° C. for 5 minutes and then rapidly cooled in an ice bath. Subsequent operations were carried out according to the general dideoxy method. Similarly, DNA is used as a primer
Using the fragments # 14 and # 18, it was confirmed that the base sequence of the hEGF gene was correct.

Example 2 Construction of plasmid for expression of hEGF and production of transformant (FIG. 5) i) 10 μg of pTB361 obtained in Example 1 above was added to a reaction solution [50 mM NaCl, 6 mM Tris-HC.
1 (pH 7.6), 6 mM MgCl ₂ , 6 mM 2-
Mercaptoethanol, 0.01% BSA, 50 units EcoRI, 10 units PstI (Takara Shuzo)],
After reacting at 37 ° C. for 1.5 hours, a 172 bp DNA fragment was purified by 2% agarose gel electrophoresis according to a conventional method (described above). On the other hand, ptrp7 is used as an expression vector.
81 [Kurokawa, T .; , "Nucleic Acids Research (Nucl. Acids Re
s. ) ”, 11 , 3077-3085 (1983)]. ptrp781 DNA as above,
After digestion with EcoRI and PstI, double the amount of water was added to the reaction solution, and the mixture was kept at 65 ° C. for 10 minutes to inactivate the enzyme.

172 bp DNA and plasmid D thus obtained
Each NA has a single chain cohesive end generated by EcoRI and PstI digestion at both ends.

Both of these are mixed, and 66 mM Tris-HCl, p is added.
H7.5, 6.6 mM MgCl ₂ , 10 mM DTT
And T4 in the presence of 1 mM ATP at 14 ° C for 5.5 hours
DNA ligase (NEB) was allowed to act to bind the DNA, and Escherichia coli DH1 strain was transformed by the same method as described above. Next, this Escherichia coli was spread on an LB agar medium containing 7 μg / ml of tetracycline and cultured at 37 ° C. for 1 day.
The resulting tetracycline resistant colonies were then plated with 35 μg
LB agar medium containing 1 / ml of ampicillin was inoculated, and a non-flying transformant was selected. Further, the plasmid DNA of the transformant was treated with EcoRI and Ps by the same method as described above.
A transformant in which the hEGF gene was correctly inserted was selected by digestion with tI and further digestion with BglII and HindIII. The expression plasmid thus obtained was designated as pTB3.
70 and also the transformant, Escherichia coli DH1
/ PTB370.

ii) An expression vector having the λP _L promoter gene was constructed as follows (FIG. 6). The plasmid ptrp601 [Y. Fujizawa et al.,
"Nucleic Acids Research (Nucleic
Acids Res. ) ”, 11 , 3581 (198)
3)] was digested with restriction enzymes EcoRI and ClaI, and the resulting cohesive end of the single chain was replaced with DNA polymerase I (Kl
It was filled with enow fragment), treated with phenol, and precipitated with ethanol. 1 of this linear DNA
T4 DNA ligase was allowed to act at 4 ° C. to form circular DNA, and Escherichia coli was transformed by the same method as described above. From this, a plasmid having EcoRI in the trp promoter downstream was isolated and named pTB56.

Next, this plasmid pTB56 was digested with PvuII to obtain a linear DNA, and then a synthetic oligonucleotide (EcoR
(I linker) and T4 DNA ligase reaction was performed. After digesting this reaction product with EcoRI, about 0.28 kbp DNA fragment containing the trp promoter gene was purified by 2% agarose gel electrophoresis according to a standard method.

On the other hand, pBR322 DNA was digested with EcoRI to form linear DNA, and the phosphate group at the 5'end was removed by alkaline phosphatase treatment to give 0.28 kbpD.
It was mixed with NAEcoRI fragment, reacted with T4 DNA ligase at 14 ° C., ligated with DNA, and transformed into Escherichia coli. From this, the trp promoter was Ec of pBR322.
isolation of the plasmid cloned into the oRI site,
It was named pTB57.

Next, a linear DNA obtained by partially digesting this plasmid pTB57 with EcoRI was treated in the same manner as described above to crush one EcoRI recognition site to form a circular DNA, which was then transformed into Escherichia coli. A plasmid was obtained from the selected colony, and tr was obtained from the pattern of restriction enzyme cleavage.
The plasmid lacking the EcoRI recognition site on the upstream side of the p promoter was designated as pTB91.

Furthermore, after digesting plasmid pTB91 with EcoRI, the cohesive end of the single chain was filled in with DNA polymerase I, mixed with synthetic oligonucleotide (BglII linker), ligated using T4 DNA ligase, and a BglII recognition site was introduced downstream of the trp promoter gene. And the plasmid pT
It was named B334.

Using pTB57 and pTB334 thus obtained, t
A plasmid having an Eco RI recognition site upstream of the rp promoter and a BglII recognition site downstream thereof was constructed. First, pTB344 was treated with restriction enzymes Hpa I and Ps.
After cutting with t I, about 0.78 kbp DNA fragment was eluted and purified by 2% agarose gel electrophoresis.

Also, pTB57 was cleaved with the same restriction enzyme, and then a 3.85 kbp DNA fragment was eluted and purified by 1% agarose gel electrophoresis. After mixing both of them and ligating them with T4 DNA ligase, Escherichia coli was transformed, a plasmid was obtained from the obtained colonies, and a transformant having the desired plasmid was selected based on the pattern of restriction enzyme cleavage. The plasmid isolated from this was named pTB340.

Next, a plasmid pAD329 having a λP _L promoter
[Adhya, S. , "Cell," 29 ,
939-944 (1982)], a DNA fragment of 0.35 kbp having a λP _L promoter gene was isolated. First, the plasmid pAD329 was digested with restriction enzymes BglII and HpaI and then subjected to 2% agarose gel electrophoresis to elute and purify a DNA fragment of about 0.45 kbp.
Next, this 0.45 kbp DNA fragment was partially digested with HinfI and then subjected to 2% agarose gel electrophoresis to elute and purify a DNA fragment of about 0.35 kbp. The 0.35 kbp DNA fragment thus obtained had B
It has sticky ends generated by glII and HinfI digestion.

On the other hand, the plasmid pTB340 was digested with restriction enzymes BglII and EcoRI and then subjected to 1% agarose gel electrophoresis to elute and purify about 4.35 kbp DNA. The DNA obtained here has cohesive ends generated by BglII digestion and EcoRI digestion at both ends. The thus obtained 0.35 kbp DNA fragment containing the λP promoter gene and about 4.35 kbp DNA were mixed, circular DNA was prepared with T4 DNA ligase, and E. coli was transformed with the λP promoter. A plasmid having a BglII recognition site on the upstream side and an EcoRI recognition site on the downstream side was isolated and named pTB281.

Using this, a plasmid for expressing hEGF was constructed (Fig. 5). First, the plasmid pTB described above in Example 1
361 10 μg was added to the reaction solution [100 mM NaCl, 1
0 mM Tris-HCl, pH 8.0, 7 mM Mg
Cl ₂ , 2 mM 2-mercaptoethanol, 0.01
% BSA, 50 units EcoRI, 20 units Ba
mHI (Takara Shuzo)] at 37 ° C. for 1.5 hours, and then a 179 bp DNA fragment containing the hEGF gene was eluted and purified by 2% agarose gel electrophoresis.
On the other hand, the plasmid pTB281 was also subjected to Ec in the same manner as above.
digested with oRI and BamHI and added 2 volumes of water to give 6
The enzyme was inactivated at 5 ° C. for 10 minutes. These both ends are mixed, and T4 DNA ligase is allowed to act at 14 ° C.
A was attached.

Transformation of E. coli was performed as follows. E. coli N483
LB medium was added to an overnight culture of strain 0 (commercially available from Pharmacia Japan) and diluted 100 times. After shaking culture at 37 ° C. for 2 hours, centrifugation was performed at 3,300 rpm, 4 ° C. for 8 minutes, and the obtained bacterial cells were washed with 10 mM NaCl.
To this, add 50 mM CaCl ₂ solution,
Every minute, it was centrifuged at 3,300 rpm at 4 ° C. for 4 minutes, and suspended again in 50 mM CaCl ₂ . This one
7 μl of the reaction solution obtained above was added to Escherichia coli N4830 suspended in 00 μl, and incubated at 0 ° C. for 45 minutes. Then, incubate at 37 ℃ for 2 minutes, 900μ
After the addition of 1 LB medium, the mixture was incubated at 30 ° C. for 1 hour. This Escherichia coli was spread on LB agar medium containing 35 μg / ml of ampicillin, and cultured at 30 ° C. overnight. Ampicillin-resistant colonies formed were all 7 μg / ml
It had lost its resistance to tetracycline. Next, plasmid DNA was taken from a part of this transformant and
digestion with coRI and BamHI, followed by BglII
A transformant having the correct insertion of the hEGF gene was selected by digestion. The plasmid thus obtained was designated pTB37
I named it 2.

The pTB372 obtained above was then treated with pRK248cIts (repressor) [Berna by the same procedure as described above.
rd, H.D. Et al., “Methods in Enzymology”,
68, used to transform E. coli DH1 strain containing 482-492 (1979)], the resulting transformant 35
The cells were spread on LB agar medium containing µg / ml ampicillin and 7 µg / ml tetracycline, and incubated overnight at 30 ° C. The plasmid DNA obtained from the resulting colony in the same manner as described above was digested with a restriction enzyme.
A transformant containing the EGF gene was selected, and this was transformed into Escherichia coli DH1 / pTB372, pRK248cI.
It was named ts.

Example 3 Method for producing hEGF i) Escherichia coli DH1 / pTB370 7 μ
37 ° C in LB medium containing g / ml tetracycline
It was shaken and cultured overnight. 7 μg / in 0.5 ml of this culture
10 ml of M9 medium containing 0.4 ml of tetracycline [containing 0.4% casamino acid and 1% glucose] was added, and the mixture was shake-cultured at 37 ° C. for 4 hours, and then 3β-indole acrylic acid (IAA) was added thereto to give 30 μg / ml. So that After continuing culturing for another 4 hours, 10.5 ml of this culture solution was added at 7,000 rpm, 4 ° C. and 10 ° C.
After centrifugation for minutes, the obtained bacterial cells were frozen at -70 ° C.
After dissolving this, 1 ml of reaction solution [7M guanidine hydrochloride, 2 mM phenylmethylsulfonyl fluoride (P
MSF), 0.1 M Tris-HCl, pH 7.0]
Incubated at 0 ° C. for 1 hour. 2 this reaction solution
Centrifugation was performed at 30,000 rpm for 30 minutes at 4 ° C., and the resulting supernatant was mixed with TEN [20 mM Tris-HCl, pH.
8.0, 1 mM EDTA, 0.2 M NaCl] 11
Dialyzed twice at 4 ° C against the precipitated insoluble matter for 20,0
It was removed by centrifugation at 00 rpm, 4 ° C. for 30 minutes. The solution thus obtained was stored at -20 ° C.

ii) Escherichia coli DH1 / pTB372, pR
K248cIts in M9 medium containing 35 μg / ml ampicillin and 7 μg / ml tetracycline,
The cells were cultured at 29 ° C with shaking overnight. 3 to 0.5 ml of this culture
10 ml of M9 medium containing 5 μg / ml of ampicillin was added, and the mixture was cultivated with shaking at 29 ° C. for 4 hours, and then at 42 ° C. for 2 hours.
After continuing shaking culture for a time, perform the same treatment as described above,
The resulting solution was stored at -20 ° C.

The products obtained in i) and ii) above were subjected to radioreceptor assay (RRA method) [Cohen, S. et al. , "Procedure of National Academy of Science (Proc. Natl. Acad. Sci. US
A) ", 72 , 1317-1321 (1975)].

EGF activity was expressed by weight of purified mouse EGF standard showing the same activity. First, human fetal foreskin cell Flow700
0 (flow Laboratories, Inc. commercially available) in a Dulbecco's Minimal Essential (DMEM) medium containing 10% fetal bovine serum to a diameter of 1.6.
cm cell culture dish (Linbro, Flow
Laboratories, Inc. Cultured (commercially available). After discarding this medium and washing the cells with DMEM medium containing 0.1% BSA, 0.2 ml of the medium and mouse EGF (Coll) labeled with ¹²⁵ I by the chloramine T method were used.
Aborative Research, Inc. (Commercially available) 5 ng, and an appropriate amount of each product obtained above, and added 3
It was cultured at 7 ° C for 1 hour.

Then washed with the same medium, and treated with 0.2 N NaOH, transferred to a tube, with γ rays counter was incorporated ¹²⁵
I was measured. By the same operation, the amount of human EGF in the product was calculated from the calibration curve obtained by the competitive reaction with mouse EGF of known weight. The results are shown in Table 1.

Further, the Escherichia coli DH1 / pTB370 strain was cultured, and after induction with IAA, the EGF activity in the lysate was measured together with the growth by the method already described. The results are shown in FIG. In the figure, the broken line shows the growth of the strain and the solid line shows the EG.
F activity is shown.

Example 4 Production of hEGF in animal cells (i) Construction of plasmid pTB506 p with SV40 promoter and IL-2 gene
TB106 [Example 1 of Japanese Unexamined Patent Publication No. 61-63282]
(I)] as a raw material, the PstI cleavage site present at the 5'end of the IL-2 gene region is converted into an EcoRI cleavage site, and BamH present at the 3'end of the gene region is converted.
Plasmid pTB396 was constructed in which a BglII cleavage site was inserted immediately before the I cleavage site.

This pTB396 was digested with EcoRI and BglII to prepare a plasmid DNA excluding the IL-2 gene region. On the other hand, pTB361 was replaced with EcoRI and BamH.
PTB4 obtained by excising the EGF gene by cutting with I and ligating it with the above plasmid DNA by T4 DNA ligase.
13 were built.

Next, from pTB314 [JP-A 61-63282, Example 1 (iii)], Abelson murine leukemia virus (A-MuLV) was digested with ClaI and HindIII.
[Goff, S. P. Et al., “Cell”, 22 :
777-785 (1980)] containing the LTR region
The A fragment was cut out and inserted into the ClaI and HindIII digested pTB413 at the ClaI and HindIII cleavage sites to construct pTB506 (FIG. 8).

(Ii) Transformation of animal cells A Falcon Petri dish (6 cm in diameter) was filled with Dulbecco's modified Eagle's MEM medium containing 10% fetal bovine serum, and mouse HPRT (hypoxanthine phosph) was added.
oribosyl transferase-deficient L cells (LA9 cells) [Littlefield. J. W.,
"Experimental Cell Research (Exp. Ce
ll Res. 41 : 190-196 (1966)]
Were cultured overnight at 37 ° C. After culturing, the cells (7 x 10
⁵ cells / dishes), p4aA8 plasmid (a plasmid containing human HPRT cDNA) [Jolly.
D, J. Et al., "Procedure of National Academy of Science (Proc. Natl. A.
cad. Sci. USA) ", 80 : 477-481.
(1983)] 0.5 μg and 10 μg of pTB506D
NA and Graham's method ["Virology (Viro
, 52 : 456-467 (1973)], mixed and inoculated, and cotransformed. 4 hours 37
After culturing at ℃, change to a new medium and cultivate overnight.
HAT medium containing 15% fetal bovine serum (15 μg / ml hypoxanthine, 1 μg / ml aminopterin, 5 μg / ml
The culture was continued at 37 ° C. with the replacement of Dulbecco's modified Eagle MEM medium containing thymidine).

When the culture solution is exchanged once every 3 to 4 days,
After about 2 to 3 weeks, the cells that became HPRT proliferated and formed colonies.

(iii) Cloning of transformants and quantification of EGF The cloning of the transformed cells obtained in (ii) above was carried out according to the limited dilution method. After the completion of cloning, the clone cells were cultured in Eagle modified MEM medium containing 10% fetal bovine serum. The separated cloned cells were spread on a Falcon dish (diameter 6 cm), and when the cells became confluent, the cells were peeled off using a rubber policeman and collected by centrifugation (2000 rpm × 5 minutes). Then add 200 μl NET to the collected cells,
Sonicate (5 seconds x 2) to destroy the cells and centrifuge (2
0000 rpm, 4 ° C., 30 minutes), and the EGF activity in the obtained supernatant was measured according to the method of Example 6.
Mouse LA9-EGF-3 among transformed cell clones
It was found that the cells produced 1.4 ng / 10 ⁷ cells of EGF. The results are shown in Table 2.

[Brief description of drawings]

FIG. 1 is a diagram showing the DNA sequence and amino acid sequence of the synthetic gene used in the present invention corresponding to hEGF, and FIG. 2 is a division into DNA fragments in the hEGF gene synthesis used in the present invention. FIG. 3 is a diagram showing an example, FIG. 3 is a diagram showing an example of a DNA fragment for producing a synthetic gene corresponding to hEGF used in the present invention, and FIG. 4 is a diagram showing the DNA fragments of FIG. hEG
It is a schematic diagram which manufactures F synthetic gene. FIG. 5 is a construction diagram of an expression plasmid incorporating the synthetic gene corresponding to hEGF of the present invention, and FIG. 6 is a plasmid p.
It is a construction drawing of TB281. FIG. 7 shows the growth of cells and EGF when EGF was produced using the transformed bacterium of the present invention.
It is a graph which shows activity. FIG. 8 shows a construction diagram of the animal cell transformation plasmid pTB506 in Example 7 (i).

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location // C12P 21/02 H 8214-4B (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91) (56) References Proc. Natl. Acad. Sc i. USA. 1983 [80] P. 7461-7465 Nucleic Acids Research, 1982 [10] P. 4467-4482 Nature, 1983 [303] P. 722-725

Claims (1)

[Claims] 1. DNA sequence AACAGTGATTCAGAATGTCCTCTCT
CACACAGTGGATACTGCCTCCATGA
CGGCGTGTGTATGTATATTGAAGCA
CTAGACAAAATACGCATGCAACTGTG
TAGTTGGCTATATTTGGTGAACGATG
CCAGTACCGAGATCTGAAATGGTGGG
A bacterial or mammalian cell transformed with a DNA having a synthetic gene for expression of human epidermal growth factor designated GAACTGCGA.