JPH0638773A - Manifestation vector using drug-resistant structure protein gene as selector gene - Google Patents

Abstract

PURPOSE:To enable the expression of a large amount of useful protein by using an animal cell as a host. CONSTITUTION:The objective manifestation vector contains an exogenote coding a desired protein under the control of a strong promoter, has a terminator sequence and a control sequence for the expression of the exogenote at the downstream of the exogenote, contains a gene sequence coding a drug-resistant structure protein between a similar sequence and the terminator sequence arranged in tandem to form a unit and has an incomplete thymidine kinase gene sequence.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel plasmid vector useful for large-scale expression of a gene encoding a useful protein in animal cells.

[0002]

2. Description of the Related Art With the progress of gene recombination technology, the production technology of useful substances using gene recombination has been rapidly advanced in recent years. When a foreign gene is expressed using a gene recombination technique, an appropriate host cell and a vector having a promoter and a selectable marker for expressing the foreign gene corresponding thereto are used. Until now, microorganisms that are easy to handle, such as Escherichia coli and yeast, have been widely studied as host cells for expression, but it has been confirmed that expression of foreign genes is partially limited in such microorganisms. Also, regarding the expression of drug proteins to be administered to the human body, it is said that it is preferable to use animal cells rather than microorganisms, and in recent years, expression systems using animal cells such as higher animal culture cells have been actively studied. ing.

Many known expression systems using animal cells as host cells have been reported which use animal virus gene promoters and animal cell gene promoters. As examples of the former, adenovirus major late gene promoter, hepatitis B virus gene promoter and the like are used. Further, as the latter example, a metallothionein gene promoter, an interferon gene promoter, an immunoglobulin gene promoter and the like are used. Geneticin, methotrexate, hygromycin, etc. are mainly used as selectable markers. However, productivity is not sufficient with any expression system. Therefore, there is a demand for the development of a strong high expression vector having a more efficient selection gene.

[0004]

[Problems to be Solved by the Invention] A drug to be administered to a human body,
For example, interferon (IFN) is currently produced in large quantities using Escherichia coli, but there are problems such as denatured protein contamination and no sugar chain added. Therefore,
It is considered that such problems can be solved by constructing a system for expressing useful proteins in large amounts in animal cells.

[0005]

The inventors of the present invention have made diligent studies to develop a particularly effective expression vector for the purpose of high expression of foreign genes in animal cells. As a result, an extremely effective expression vector was found. developed.

That is, the gist of the present invention resides in an expression vector containing a drug resistance structural protein gene as a selection gene. The gene as used in the present invention includes complementary DNA (cDNA) synthesized based on messenger RNA produced based on the gene. More preferably, the expression vector has a foreign gene encoding the desired protein under the control of a strong promoter, and has a terminator sequence downstream thereof as a control sequence for expressing the foreign gene. A gene sequence encoding a drug resistance structural protein is contained between similar promoter and terminator sequences arranged in tandem in a unit, expression of this protein causes drug resistance, and further, incomplete thymidine kinase (TK) gene sequence. And the expression of this protein results in HAT
(Hypoxanthine, aminopterin, thymidine) An expression vector characterized by being selected in a medium.

The gene for the drug-resistant structural protein used in the present invention may be any gene for a protein having a drug which has no enzymatic activity and which inhibits the function of the protein. In particular, it is considered that genes of proteins such as actin and tubulin that are present in large amounts in cells are excellent and effective. In particular, mutant human β-actin (β'-
Actin) -derived genes are preferred. The drug is preferably cytochalasin B, and the strong promoter is preferably SV40 promoter. As a preferred embodiment of the present invention,
It has an incomplete thymidine kinase (TK) gene and a cytochalasin B-resistant mutant β'-actin cDNA, and the expression of both of them causes HAT medium and cytochalasin B to be expressed.
It is a plasmid vector effective for large-scale expression in animal cells, which utilizes the fact that a transformed cell that produces a large amount of the product of the target gene is selected by.

The present invention also uses the above expression vector,
It comprises a transformation method characterized in that human thymidine kinase-deficient cells (TK-cells) are transformed with a recombinant plasmid in which a foreign structural gene is inserted downstream of the promoter of this vector. Human TK-cells are specifically KB cells.

Furthermore, the present invention is a method for expressing a foreign structural gene encoding a desired protein, which comprises culturing cells transformed using the above-mentioned transformation method, thereby producing a large amount of the desired protein. Is included.

The present invention will be described in more detail below. Interferon (IFN), a useful protein
Is currently produced in large quantities using Escherichia coli, but there is a problem that it is not glycosylated. Ideally, human IFN is produced in human cells. Since cells having an incomplete TK gene have a small amount of TK enzyme protein synthesis, it is expected that cells having a large number of incomplete TK genes are preferentially selected in the HAT medium. If so, insert another gene on the same DNA,
This gene should also be expressed commensurate with the increased number of genes.

Based on the above idea, the present inventor has shown that when a mutant human β'actin gene is inserted into an expression vector into which an incomplete thymidine kinase (TK) gene is inserted and transferred into human KB (TK-) cells. We saw a large amount of mutant human β'actin expression. Structural proteins such as actin are abundant in cells, and their way of working is stoichiometric rather than catalytic like enzymes. Therefore,
Expression of a large amount of the resistance protein is required for the drug resistance structural protein newly introduced into the cell to impart the drug resistance to the cell.

Therefore, among the transformed cells, only those having a large copy number of the drug resistance structural protein gene will be selected, and the method of using the gene of the drug resistance structural protein as the selection gene of the expression vector is as follows. It is considered to be more advantageous than the method in which the enzyme protein gene used in most expression vectors so far is used as the selection gene.

Therefore, the mouse IFNβ gene was further incorporated into an expression vector in which the incomplete TK gene and the mutant human β'actin gene were inserted, and human KB was prepared in the same manner as above.
(TK-) cells were transferred and selected with HAT medium and cytochalasin B. Incomplete T due to HAT medium
A cell having a large copy number of the K gene will be selected, and the cell expressing the mutant β′-actin will be resistant to cytochalasin B. As a result,
A transformed cell line capable of secreting and producing a large amount of mouse IFNβ in the culture medium could be obtained at high frequency.

Moreover, human KB cells are cells of the same origin as HeLa cells and have excellent proliferative ability. Therefore, human KB cells can be easily cultivated and proliferate rapidly, can be applied to various culture methods and cell culture media, and can produce desired proteins. There is an advantage that the expression level is necessarily increased. Hereinafter, the present invention will be described in detail and specifically with reference to Examples. It should be noted that the following examples illustrate the present invention and do not limit the present invention.

[0015]

【Example】

Example 1 Cell Culture A KB cell line was cultured at 37 ° C. at a constant rate using a MEM (minimum essential medium) medium containing 10% fetal bovine serum and 60 μg / ml kanamycin until it reached to 5 × 10 5 cells / ml. It was cultured in. The thymidine kinase-deficient strain was isolated by stepwise treatment with 5-bromodeoxyuridine.

Example 2: Isoelectric focusing on vertical gel Isoelectric focusing on 4.5% acrylamide gel
The method of yama et al. (1988. J. Cell Biol. 107: 1499-1504) was followed, except that the cathode solution was 20 mM NaOH and the anode solution was 10 mM H3P.
O4. Silver stain kit Wako (Wako
Pure Chemical Industries) and used a densitometer (Biomed Instruments, Inc.,) for lane scanning.
It was used. As a result, it was found that the mutant β'actin migrated to the acidic side with a difference of about 1 unit in isoelectric point compared with β-actin.

Example 3: Purification of actin The parent strain cultured under the above conditions and the Cyt1 mutant strain having a mutant β′-actin were collected at a low rotation speed and twice with PBS.
Further, it was washed twice with a solution of 0.1 M Hepes, 0.1 mM MgSO 4, and pH 7.5. 1 g of this cell was added to 2 ml of buffer G (3 mM imidazole,
0.1 mM CaCl2, 0.5 mM ATP, 0.4 mM dithiothreitol, pH
Suspend in 7.5) and crush with a homogenizer. Purification of actin was performed by chromatography using DEAE-cellulose by Gordon et al. (1976. J. Biol. Chem. 251: 477).
8-4786). The mutant β′-actin was purified by chromatography using hydroxyapatite by Segura and Lindberg (1984.J.Biol.Chem.259: 3.
949-3954).

Purified actin (up to 10 mg) was used as 5 mM potassium acetate, pH 7.6, 0.5 mM DTT, 0.5 mM ATP, O.1 mM CaCl2.
Pass through a PD-10 column (Pharmasia) pre-equilibrated with the solution to obtain 5 mM potassium acetate, pH 7.6, 1 mM DTT, O.1 mM CaCl2.
Hydroxyapatite column (1 x
14 cm, Bio-Gel HTP; Bio-Rad Lab.). This column was loaded with 80 ml of 5 mM potassium acetate, pH 7.6, 0.5 mM DTT, O.1.
Elution is performed by applying a gradient from a mM CaCl2 solution to a 40 mM potassium acetate, pH 7.6, 1.5 M glycine, 0.5 mM DTT, 0.1 mM CaCl2 solution. Set the flow rate to 1.0 ml / 10 min and
It was set up to collect 1 ml in a tube containing 50 μl of 10 mM ATP. The fractions of the mutant β'actin and γ actin peaks were collected using Amicon YM-10 membrane (WRGr
Ace & Co.), concentrated and dialyzed against buffer G containing 0.02% sodium azide. Actin was stored on ice and used within 2 weeks. The purity of actin isoform was determined by electrophoresis on SDS-polyacrylamide gel.
It was over 95%. The mutant β′-actin was resistant to cytochalasin B due to the polymerization reaction in vitro.

Example 4: Cloning and nucleotide sequencing of mutant β'actin Complementary DNA (cDNA) was cloned from the messenger RNA directing the production of mutant β'actin shown in Example 3 and dideoxy was performed. The base sequence was determined by the method. The nucleotide sequence of the mutant β'actin cDNA is shown in the sequence listing.

Example 5: Examination of enhancer / promoter combination A comparative study was conducted on the relationship between the strength of enhancer / promoter activity and expression. When tested with various combinations of enhancers / promoters of different origins (SV40, cytomegalovirus, β-actin), the combination of SV40 enhancer / promoters works most efficiently for the expression of β'-actin cDNA in KB cells. Became clear.

Example 6: Gene expression vector having incomplete thymidine kinase and β'actin cDNA (pTKSV
Construction of β'-act1) For the basic construction of vector, see Maniatis et al.
982. Molecular Cloning. 545 pp). Based on the results of Example 3, the enhancer / promoter has
SV40's were used in combination. Expression vector pT
The elements that make up KSV β'-act1 are as follows. HS
Pvu II-Nco I fragment in the thymidine kinase gene of V (Herpes Simplex Virus) (Bcl I in pTKSV β'-act1)
-Cla I part). Pst I-BamH I fragment of pSV2neo (Cla I-BamH I part in pTKSV β'-act1). ; PS
BamHI-Bgl II fragment of V2hph (in pTKSV β'-act1
BamHI-Bgl II part). ; Β'-actin cDNA Mst I-E
coR I fragment (Bgl II-Hind III in pTKSV β'-act1
Part). Hind III-AccI fragment of pSV2neo (pTKSV β'-
Hind III- Mlu I part in act1). ; Ac of pSV2neo
c I-ApaLI fragment (Mlu I-ApaL in pTKSV β'-act1
Part I). The ApaLI-ApaLI fragment of pUC19 (pTKSV β'-
ApaLI-ApaLI part in act1). ; PSV2neo ApaL
I-EcoR I fragment (ApaLI-Bcl in pTKSV β'-act1
Part I).

For the construction of the incomplete thymidine kinase gene, a fragment flanked by two Mlu I recognition sites was used as Mlu
It is eliminated by treatment with I and its end is Klen.
It was performed by blunting with ow fragment and binding with T4 DNA ligase. This procedure did not remove the enhancer and promoter regions at all, but removed the entire 5'untranslated region of the wild type strain and the first 10 codons encoding the thymidine kinase polypeptide. The vector thus obtained is shown in FIG.

Example 7: Construction of plasmid vector pKAJO By inserting genes encoding various proteins,
We have created a plasmid vector pKAJO that can be applied to large-scale expression of any protein. This is designed to add a new multicloning site sandwiched between SV40 promoter / enhancer to the vector having the incomplete thymidine kinase gene prepared in Example 5. The vector thus obtained is shown in FIG.

Example 8: Transformation Supercoiled DNA used for transformation is described in Graham et al. (197).
3. Virology. 52: 456-467) and treated by the calcium chloride precipitation method. 10 μg DN in a 25 cm2 flask
After adding A and culturing for 16 hours, hepes buffer salt containing 15% glycerol (20 mM Hepes, 137 mM NaCl, 2.7 mM KCl, p
H7.5) for 3 minutes and cultured in MEM medium for 20 hours. After collecting the cells by trypsin-EDTA treatment and measuring the number of cells, approximately 2 x 10 5
6 cells were seeded again. The medium is replaced every 4 days and HA
On the 16th day, the medium was replaced with T medium and the medium was replaced with HT medium containing 2 μg / ml cytochalasin B. When more than 5 days have passed,
The medium was exchanged again with MEM medium containing 2 μg / ml cytochalasin B, and the culture was continued for further 5 days. Single colonies were cloned in cloning cylinders and then cultured in bulk. The proportion of cells transformed with the expression vector containing the incomplete TK gene prepared according to Example 5 is lower than the proportion of cells transformed with the complete TK gene, and cells with high gene copy number are preferentially selected. It became clear that it was done.

Example 9 Confirmation of Cytochalasin B Resistance The resistance of transformed cells to the growth inhibitory factor cytochalasin B was examined. 6-well multiwell plate (Falcon 3046) with various concentrations of drug containing 4 ml MEM medium
Was cultured for 12 days at 37 ° C. in a CO 2 incubator. Cells were stained with 50% ethanol containing 1% methylene blue. First, KB100TK- cells were transformed with pTKSV β'-act1 which is a mutant β'actin expression vector. When TK + transformants were selected in HAT medium and further cultured in a medium containing 2 μg / ml of cytochalasin B, about 35% of TK + transformants were alive. Of these, 8 single clones were cultured in large quantities,
In the presence of cytochalasin B under various concentration conditions, the viability was confirmed and the mutant β'actin was quantified. As a result, a mutant β'actin band of KB cells was detected from all clones by isoelectric focusing, but the intensity was different for each clone. Its production accounted for 0.2 to 1% of the total protein of the cell. In addition, there was a strong correlation between the resistance to cytochalasin B and the amount of mutant β'actin produced. That is,
The large expression of the mutant β'actin gene imparted cytochalasin B resistance to the transformants.

Example 10: Production of mouse IFNβ The mouse IFNβ gene was incorporated into the expression vector having the incomplete thymidine kinase gene and the mutant β-actin gene prepared in the above example, and large-scale production was attempted. The specific operation method was according to Example 7, but SV40
The mouse IFNβ gene was inserted at the site of the multiple cloning site sandwiched between the enhancer / promoter.
Human KB cells were transfected with 10 μg of pTKSV β'-act1 (pTYmIFN-β) by the calcium phosphate method and cultured to 4 × 106 cells / ml, and 115 cells were selected in HAT medium. Obtained. Furthermore, final concentration 2
When selected with μg / ml cytochalasin B, 61 cells were obtained. The activity of expressed IFN was measured by the activity of IFN-induced 2-5A synthase. As a result, a maximum of 2 × 10 7 u / ml activity was calculated in terms of antiviral activity, which was about 10 to 100 times more effective than when using other systems reported to date. Admitted.

[0027]

As described above, according to the present invention, a method for expressing a useful protein in a large amount using an animal cell as a host has been established.

[0028]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1128 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Nucleic acid type: cDNA Origin organism name: Homo sapiens sequence GAATTCGGCA CGAGCGCGTCTCCGCCCCGCGAGCACAGAGCC TCGCCTTTGC CGATCCGCCG 60 1 5 CCCGTCCACCCGCCGCCCCACCCGCCGCCCCA GCTCACC ATG GAT GAT GAT ATC GCC GCG CTC 111 Met Asp Asp Asp Ile Ala Ala Leu 10 15 20 GTC GTC GAC AAC GGC TCC GGC ATG TGC AAG GCC GGC TTC GCG GGC GAC 159 Val Val Asp Asn Gly Ser Gly Met Cys Lys Ala Gly Phe Ala Gly Asp 25 30 35 40 GAT GCC CCC CGG GCC GTC TTC CCC TCC ATC GTG GGG CGC CCC AGG CAC 207 Asp Ala Pro Arg Ala Val Phe Pro Ser Ile Val Gly Arg Pro Arg His 45 50 55 CAG GGC GTG ATG GTG GGC ATG GGT CAG AAG GAT TCC TAT GTG GGC GAC 255 Gln Gly Val Met Val Gly Met Gly Gln Lys Asp Ser Tyr Val Gly Asp 60 65 70 GAG GCC CAG AGC AAG AGA GGC ATC CTC ACC CTG AAG TAC CCC ATC GAG 303 Glu Ala Gln Ser Lys Arg Gly Ile Leu Thr Leu Lys Tyr Pro Ile Glu 75 80 85 CAC GGC ATC GTC ACC AAC TGG GAC GAC ATG GAG AAA ATC TGG CAC CAC 351 His Gly I le Val Thr Asn Trp Asp Asp Met Glu Lys Ile Trp His His 90 95 100 ACC TTC TAC AAT GAG CTG CGT GTG GCT CCC GAG GAG CAC CCC GTG CTG 399 Thr Phe Tyr Asn Glu Leu Arg Val Ala Pro Glu Glu His Pro Val Leu 105 110 115 120 CTG ACC GAG GCC CCC CTG AAC CCC AAG GCC AAC CGC GAG AAG ATG ACC 447 Leu Thr Glu Ala Pro Leu Asn Pro Lys Ala Asn Arg Glu Lys Met Thr 125 130 135 CAG ATC ATG TTT GAG ACC TTC AAC ACC CCA GCC ATG TAC GTT GCT ATC 495 Gln Ile Met Phe Glu Thr Phe Asn Thr Pro Ala Met Tyr Val Ala Ile 140 145 150 CAG GCT ATG CTA TCC CTG TAC GCC TCT GGC CGT ACC ACT GGC ATC GTG 543 Gln Ala Met Leu Ser Leu Tyr Ala Ser Gly Arg Thr Thr Gly Ile Val 155 160 165 ATG GAC TCC GGT GAC GGG GTC ACC CAC ACT GTG CCC ATC TAC GAG GGG 591 Met Asp Ser Gly Asp Gly Val Thr His Thr Val Pro Ile Tyr Glu Gly 170 175 180 TAT GCC CTC CCC CAT GCC ATC CTG CGT CTG GAC CTG GCT GGC CGG GAC 639 Tyr Ala Leu Pro His Ala Ile Leu Arg Leu Asp Leu Ala Gly Arg Asp 185 190 195 200 CTG ACT GAC TAC CTC ATG AAG ATC CTC ACC GAG CGC GGC TAC AGC TT C 687 Leu Thr Asp Tyr Leu Met Lys Ile Leu Thr Glu Arg Gly Tyr Ser Phe 205 210 215 ACC ACC ACG GCC GAG CGG GAA ATC GTG CGT GAC ATT AAG GAG AAG CTG 735 Thr Thr Thr Ala Glu Arg Glu Ile Val Arg Asp Ile Lys Glu Lys Leu 220 225 230 TGC TAC GTC GCC CTG GAC TTC GAG CAA GAG ATG GCC ACG GCT GCT TCC 783 Cys Tyr Val Ala Leu Asp Phe Glu Gln Glu Met Ala Thr Ala Ala Ser 235 240 245 AGC TCC TCC CTG GAG AAG AGC TAC GAG CTG CCT GAC GGC CAG GTC ATC 831 Ser Ser Ser Leu Glu Lys Ser Tyr Glu Leu Pro Asp Gly Gln Val Ile 250 255 260 ACC ATT GGC AAT GAG CGG TTC CGC TGC CCT GAG GCA CTC TTC CAG CCT 879 Thr Ile Gly Asn Glu Arg Phe Arg Cys Pro Glu Ala Leu Phe Gln Pro 265 270 275 280 TCC TTC CTG GGC ATG GAG TCC TGT GGC ATC CAC GAA ACT ACC TTC AAC 927 Ser Phe Leu Gly Met Glu Ser Cys Gly Ile His Glu Thr Thr Phe Asn 285 290 295 TCC ATC ATG AAG TGT GAC GTG GAC ATC CGC AAA GAC CTG TAC GAC AAC 975 Ser Ile Met Lys Cys Asp Val Asp Ile Arg Lys Asp Leu Tyr Asp Asn 300 305 310 ACA GTG CTG TCT GGC GGC ACC ACC ATG TAC CCT GGC AT T GCC GAC AGG 1023 Thr Val Leu Ser Gly Gly Thr Thr Met Tyr Pro Gly Ile Ala Asp Arg 315 320 325 ATG CAG AAG GAG ATC ACT GCC CTG GCA CCC AGC ACA ATG AAG ATC AAG 1071 Met Gln Lys Glu Ile Thr Ala Leu Ala Pro Ser Thr Met Lys Ile Lys 330 335 340 ATC ATT GCT CCT CCT GAG CGC AAG TAC TCC GTG TGG ATC GGC GGC TCC 1119 Ile Ile Ala Pro Pro Glu Arg Lys Tyr Ser Val Trp Ile Gly Gly Ser 345 350 355 360 ATC CTG GCC TCG CTG TCC ACC TTC CAG CAG ATG TGG ATC AGC AAG CAG 1167 Ile Leu Ala Ser Leu Ser Thr Phe Gln Gln Met Trp Ile Ser Lys Gln 365 370 375 GAG TAT GAC GAG TCC GGC CCC TCC ATC GTC CAC CGC AAA TGC TTC TAG 1215 Glu Tyr Asp Glu Ser Gly Pro Ser Ile Val His Arg Lys Cys Phe *** GCGGACTATG ACTTAGTTGC GTTACACCCT TTCTTGACAA AACCTAACTT GCGCA 1270

[Brief description of drawings]

FIG. 1 is a schematic diagram showing the constitution of a gene expression vector (pTKSV β′-act1).

FIG. 2 is a schematic diagram showing the constitution of the plasmid vector pKAJO.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location C12N 15/22 C12P 21/02 C 8214-4B // A61K 37/66 B 8314-4C (C12N 5 / 10 C12R 1:91) (C12P 21/02 C12R 1:91)

Claims (9)

[Claims] 1. An expression vector containing a gene encoding a drug resistance structural protein as a selection gene. 2. The expression vector according to claim 1, wherein
A foreign gene encoding a desired protein is placed under the control of a strong promoter, and has a terminator sequence downstream thereof as a control sequence for expressing the foreign gene, which is similar to that of a tandem unit in a unit. An expression vector comprising a gene sequence encoding a drug resistance structural protein between a promoter and a terminator sequence and having an incomplete thymidine kinase gene sequence. 3. The expression vector according to claim 1 or 2, wherein the gene encoding the drug resistance structural protein is a gene derived from the drug resistance actin gene. 4. A mutant human β having a drug-resistant actin gene.
-The expression vector according to claim 3, which is a gene derived from actin (β'-actin). 5. The drug according to claim 2, which is cytochalasin B.
The described expression vector. 6. The expression vector according to claim 2, wherein the strong promoter is the SV40 promoter. 7. Use of the expression vector according to any one of claims 1 to 6 with a recombinant plasmid in which a foreign structural gene is incorporated downstream of the promoter of the expression vector,
A transformation method comprising transforming a human thymidine kinase-deficient cell. 8. The human thymidine kinase-deficient cell is KB
The transformation method according to claim 7, which is a cell. 9. A method for expressing a foreign structural gene encoding a desired protein, which comprises culturing cells transformed by using the transformation method according to claim 7 or 8, wherein the desired protein is expressed in large quantities. .