JPH06327479A - Dna sequence of antithymine dimer antibody tem-2 variable region - Google Patents

Abstract

PURPOSE:To obtain a new DNA sequence useful for producing a recombinant antibody capable of stably measuring a cyclobutane type thymine dimer with good reproducibility and high accuracy. CONSTITUTION:The DNA sequence is capable of coding a variable region VH region of a specific antibody TDM-2 against a cyclobutane type thymine dimer and has, e.g. a sequence of the formula. This DNA sequence is obtained by isolating an RNA from the TDM-2 cell, synthesizing a cDNA and amplifying the cDNA by PCR.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to the DNA sequence of the variable region of the monoclonal antibody TDM-2 which recognizes a cyclobutane thymine dimer. Specifically, T
V _H chain region and _VL constituting variable region of DM-2 antibody
It relates to the DNA sequence of the chain region. The present invention also provides a recombinant DN.
The present invention relates to a recombinant antibody composed of a V _H chain region and a V _L chain region obtained by the A technique and specifically recognizing a cyclobutane type thymine dimer.

[0002]

BACKGROUND OF THE INVENTION It is known that DNA damage to cells caused by ultraviolet rays has a great influence on cell death, mutation and carcinogenesis. In particular, since the influence of ultraviolet rays on the human body due to the decrease in the ozone layer (skin cancer, etc.) has recently become a problem, research in this field is considered to be very important.

DNA damage caused by ultraviolet rays is due to specific base damage, and cyclobutane-type pyrimidine dimer, (6-4) photoproduct, or De caused by this damage is generated.
War type isomers and the like are considered to be involved in cell survival and induction of mutations. Of these, cyclobutane-type pyrimidine dimers are 1) most abundantly produced, 2) chemically stable and quantifiable, and 3) there are enzymes that act specifically on this damage. Due to its characteristics such as, etc., it has been noticed and researched early on. Even in humans, a genetic disease (xeroderma pigmentosum) in which the repair system for this damage is deficient has been found. On the other hand, (6-4)
Although photoproducts are produced in a small amount, they have been studied in recent years as having a serious influence on cell survival and induction of mutations. The Dewar-type isomer is a isomer converted from the (6-4) photoproduct by irradiation with long-wavelength ultraviolet light. Therefore, quantitatively measuring the UV damage of these cyclobutane-type pyrimidine dimers and (6-4) photoproducts is a particularly important issue in examining the biological effects of each damage. .

As a detection system for UV-induced DNA damage,
1) Method of separating and quantifying by chromatography after hydrolysis,
2) After inserting a DNA strand break that is suitable for damage near the damage (UV endonuclease, thermal alkaline treatment, etc.), D
Three systems have been mainly used: a method using NA low molecular weight as an index, 3) a method using an antibody that specifically recognizes damage. Among them, the method using the antibody of 3) has an extremely high sensitivity as compared with other methods and is excellent in that DNA damage can be detected even at the individual cell level. Since high-sensitivity detection is possible, it was not possible to detect when DNA damage was quantified by irradiating cells with a large dose of ultraviolet rays in order to compensate for the low sensitivity. It has become possible to detect DNA damage when irradiated with a very low dose of ultraviolet rays.

However, since the conventionally used antibody was an antiserum (polyclonal antibody), there was a drawback that the epitope recognized by the antibody could not be specified, and it was not suitable for tracing the intracellular fate of specific gene damage. Further, there is a drawback that the supply is limited as compared with a monoclonal antibody, and an antibody having the same antibody titer cannot always be obtained.

Under such circumstances, the inventors have succeeded in establishing a monoclonal antibody that specifically recognizes various kinds of ultraviolet damage (T. Mizuno et al., Mutation Re
s., 254 , 175-184 (1991); T. Mori et al., Photochem.Phot.
obiol., 54 , 225-232 (1991); T. Mori et al., Mutation Re
s., 194 , 263-270 (1988); T. Matsunaga et al., Photoche
m. Photobiol., 54 , 403-410 (1991)). This has made it possible to detect specific gene damage separately.

One of the monoclonal antibodies established by the inventors is TDM-2, which recognizes a cyclobutane-type pyrimidine dimer. This monoclonal antibody TD
M-2 was prepared by irradiating UV-irradiated (254 nm) calf thymus DNA with BA
Various antibody-producing cell lines were obtained from fused cells of spleen cells and mouse myeloma cells obtained by immunizing LB / c mice, and one of them is an antibody produced from the established cell line TDM-2 ( T. Mori et al., Mutation Res., 194 ,
263-270 (1988)). H of monoclonal antibody TDM-2
The chain class is IgG _2a , the L chain class is κ chain, and its recognition epitopes are thymine dimer and thymine-cytosine dimer (T. Mori et al., Mutation Res., 194 , 263-270 ( 19
88)).

At this time, the cDNAs of the V _H and V _L regions constituting the variable region of the monoclonal antibody TDM-2 were
It was cloned from the producer cell TDM-2, its sequence was clarified, and the amino acid sequence of the variable region was successfully deduced from it. This opens the way to express a large amount of the variable region as Fv of a heterodimer or as scFv (single-chain Fv) in which its H chain and L chain are linked by a linker.

[0009]

That is, the present invention provides a variable region V _{H of} a specific antibody TDM-2 against cyclobutane-type thymine dimer.
It is intended to provide a DNA sequence encoding the region. Another object of the present invention is to provide a DNA sequence encoding the variable region _VL region of the specific antibody TDM-2 against cyclobutane type thymine dimer. Another object of the present invention is to provide a recombinant antibody that specifically recognizes a cyclobutane type thymine dimer.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION The DNA sequence encoding the variable region V _H region of the specific antibody TDM-2 against the cyclobutane thymine dimer of the present invention consists of the following 330 bases. 10 20 30 40 50 60 CTCGAGTCAG GACCTGGCCT GGTGGCGCCC TCACAGAGCC TGTCCATCAC ATGCACCGTC TCAGGGTTCT CATTAACTAG CTATGGTGTA CACTGGGTTC GCCAGCCTCC AGGAAAGGGT CTGGAGTGGC TGGTAGTGAT ATGGAGTGAT GGAAGCACAA CCTATAATTC AGCTCTCAAA TCCAGACTGA GCATCAGCAA GGACAACTCC AAGAGCCAAG TTTTCTTAAA AATGAACAGT CTCCAAACTG ATGACACAGC CATGTACTAC TGTGCCAGAG AGCCTCCCAC GACGTACGTT TGCTTACTGG GGCAAGGCAC CACTGTTACC

The DNA sequence encoding the variable region V _L region of the specific antibody TDM-2 against the cyclobutane type thymine dimer of the present invention consists of the following 316 bases. 10 20 30 40 50 60 GATCTGACCC AGTCTCCAGC AATAATGGCT GCCTCTCTGG GGCAGAAGGT CACCATGACC TGTAGTGCCA GCTCAAGTGT GAGTTCCAAT TACTTCCACT GGTACCAACA GAAGTCAGGC GCTTCTCCCA AACCCTTGAT TCATAGGACA TCCAACCTGG CTTCTGGAGT CCCAGCTCGC TTCAGTGGCC GTGGGTCTGG GACCTCTTAC TCTCTCACAA TCAGCAGCGT GGAGGCTGAA GATGATGCAA CTTATTACTG CCAGCAGTGG AGTGGTTACC CATTCACGTT CGGCTCGGGG ACCAAGCTGG AGATCC

Further, the recombinant antibody specifically recognizing the cyclobutane-type thymine dimer of the present invention is the specific antibody T
DM-2 variable regions V _H and V _H chain region defined region with a DNA sequence encoding, V is defined by the DNA sequence encoding the variable region V _L chain region of specific antibody TDM-2 _L
And a chain region.

The V _H chain region and the V _L chain region are produced by culturing a host cell transformed with a DNA encoding them under conditions capable of expressing the V _H chain region and the V _L chain region. It can be manufactured by collecting. The DNAs encoding the V _H chain region and the V _L chain region can be incorporated into a vector by adding an appropriate promoter, terminator, signal sequence, etc., and if necessary, an appropriate marker gene. The vector may be of any type, so long as it can function in cultured host cells. Construction of these expression vectors, intracellular expression, etc. can all be performed by conventional techniques (reference, Maniatis et al, "Molecular Clo
ning: A laboratory manual "Cold Spring Harbor Labo
ratory, Cold Spring Harbor, New York (1982)).

The V _H chain region and the V _L chain region are Fv of the heterodimer naturally associated by non-covalent bond,
Alternatively, a large amount can be expressed as scFv (single-chain Fv) in which the V _H chain region and the V _L chain region are linked by a linker. Either case is included in the recombinant antibody of the present invention.

[0015]

【Example】

[RNA isolation of TDM-2 cells] RNA was isolated from a mouse hybridoma cell line TDM-2 which produces a mouse anti-pyrimidine dimer monoclonal antibody TDM-2. This TDM-2 cell was established as a monoclonal antibody TDM-2-producing cell line from a fused cell of spleen cells and mouse myeloma cells obtained by immunizing BALB / c mice with UV-irradiated (254 nm) calf thymus DNA. (T.Mo
ri et al., Mutation Res., 194 , 263-270 (1988)), and has been deposited with the Institute of Microbial Science and Technology of the Agency of Industrial Science and Technology (accession number: Micromachine Research Institute of Microbiology 13295, FERM P -13
295). RNA isolation of TDM-2 cells, cDNA
For DNA synthesis, PCR amplification, cloning vector construction
The steps such as the preparation of NA fragment are shown in FIG.

RN from hybridoma cell TDM-2
The RNA isolation kit purchased from Stratagene was used for the isolation of A. To 5.3 × 10 ⁷ cells of hybridoma TDM-2 cells cryopreserved in pellet form, 5.5 mL of solution D (47% guanidine thiocyanate,
0.71% β-mercaptoethanol) was added and completely suspended at room temperature. 2M sodium acetate (pH 4.0) 55
After adding 0 μL, 5.5 mL of H ₂ O saturated phenol was added and stirred. Then chloroform-isoamyl alcohol 1.
After adding 1 mL and stirring, the mixture was left for 30 minutes under ice cooling. Transfer this to a sterilized tube that has been ice-cooled in advance and centrifuge (9000
Xg, 4 ° C, 20 minutes), transfer the aqueous layer to another sterile tube, add an equal amount of isopropanol to this, and after stirring-
It was left at 20 ° C. for 1 hour. This was centrifuged under the same conditions as above to remove the supernatant and obtain a precipitate. To this, 750 μL of solution D was added again to dissolve the precipitate, an equal amount of isopropanol was added, and after stirring, the mixture was allowed to stand at −20 ° C. for 1 hour. Centrifuge this (90
The supernatant was removed to obtain an RNA precipitate. The resulting RNA precipitate was washed once with 75% ethanol and air dried.

[0017]

[Purification of mRNA] For purification of mRNA, mRNA Purification Kit purchased from Pharmacia was used. After removing the storage buffer by elution from a span column filled with oligo (dT) -cellulose, 1.0 mL
High-salt buffer (10 mM Tris-HCl (pH 7.4), 1 mM E
The column was equilibrated by flowing DTA, 0.5M NaCl). To the RNA precipitate obtained above, Elution buffer (10 mM Tris-
1.0 mL of HCl (pH 7.4), 1 mM EDTA) was added and heated at 65 ° C. for 5 minutes to completely dissolve the precipitate. After ice cooling, sample buffer (10mM Tris-HCl (pH 7.4), 1mM EDTA, 3.0M NaC
l) of 0.2 mL was added and stirred, and then applied to a column that had been equilibrated in advance. After confirming that the sample solution had permeated completely, centrifugation was performed (350 × g, room temperature, 2 minutes). Then 0.25
High-salt buffer (mL) was applied, and the mixture was centrifuged under the same conditions. This operation was repeated again. Another 0.25 mL Lo
w-salt buffer (10 mM Tris-HCl (pH 7.4), 1 mM EDTA,
0.1M NaCl) was applied and the same operation was repeated 3 times.
Next, put the sterile microtube into the centrifuge tube, and set it so that the eluate enters this tube.
0.25 mL of Elution buffer heated to 65 ° C. was applied and centrifuged under the same conditions as above. This operation was repeated 3 times to obtain a total of 1.0 mL of eluate. To this, add 100 μL of sample buffer and 10 μL of glycogen solution (10 mg / ml), and after stirring, dispense 277.5 μL each into 4 1.5 mL sterile tubes, add 625 μL of ethanol to each, and after stirring −
Stored at 80 ° C. Approximately 1.0 μg mR from 5.3 × 10 ⁷ cells
NA was obtained.

[0018]

[Synthesis of cDNA] A cDNA cycle kit manufactured by Invitrogen was used for the synthesis of cDNA. About 0.25 μg of the mRNA stored above was centrifuged (12000 rpm, 0
(° C, 20 minutes) and collected as a precipitate. 8 μL of sterilized water was added to this to dissolve the precipitate, 2 μL of 100 mM MeHgOH was added, and the mixture was homogenized and left at room temperature for 5 minutes. Then 0.7 M
After adding 2.5 μL of β-mercaptoethanol and ice-cooling, 1 μL of oligo (dT) primer (0.2 μg / μL), 1 μL of RNase inhibitor, 4 μL of reverse transcription buffer (× 5), 25 mM dNTPs
1 μL and reverse transcriptase (10 units / μL) 0.5 μL were added to make a total of 20 μL, and the mixture was incubated at 42 ° C. for 60 minutes. This was heated at 95 ° C. for 3 minutes and then rapidly cooled in ice, 0.5 μL of reverse transcriptase was further added, and the mixture was again incubated at 42 ° C. for 60 minutes to complete the reverse transcription reaction. Next, heat at 95 ° C for 3 minutes, cool rapidly in ice, and then add 1 µL of 0.5M EDTA and phenol-
20 μL of chloroform was added and phenol-chloroform extraction was performed. Transfer the aqueous layer to another tube and add 4 μM ammonium acetate (22 μL) and ethanol (88 μL) to the tube.
After standing for 2 hours at ℃, it was centrifuged and the cDNA was recovered as a precipitate. 10 μL of TE solution (1 mM Tris-HCl (pH 8.
0), 0.1 mM EDTA).

[0019]

[Amplification by PCR] PCR (Polymerase Chain Reacti
The amplification of cDNA by on) was performed under the following conditions.
The template cDNA used was dissolved in the above TE solution.

The gene encoding the variable region of the antibody is composed of three segments of Vh gene, D gene and Jh gene from the 5'end in the H chain, and 2 segments of Vκ gene and Jκ gene in the κ chain. It consists of one segment. In both H chain and κ chain, the 5'end region of V gene (corresponding to N-terminal region of variable region) and J gene region (corresponding to C-terminal region of variable region) have sequences highly conserved among antibodies. It is known that (R.
Orladi et al., Proc.Natl.Acad.Sci.USA, 86 , 3833-3837
(1989)).

Therefore, as a primer for PCR amplification of the V _H region, a V _H BACK primer was selected from the 5 ′ end region of the V _h gene and a V _H FOR primer sequence was selected from the J _h gene region, and synthesized. As a primer for PCR amplification of the _VL region (that is, the Vκ region), a _VL BACK primer was selected from the 5 ′ end region of the Vκ gene and a sequence of the _VL FOR primer was selected from the Jκ gene region, and synthesized (FIG. 1).
reference). The sequences of each primer used are shown in Table 1. V
_As shown in Table 1, the _H BACK primer was a mixed primer in consideration of degeneracy of codon. The restriction enzyme cleavage site of each primer is also underlined with the name of the restriction enzyme.

[0022]

[Table 1] ─────────────────────────────────── V _H BACK Primer 5'GGGA GGT (GC) ( AC) A (AG) CT ( GT) CTCGAG TC (AT) GG 3 'XhoI V H FOR primer 5' GGGCTATTA GAATTC AACGGTAACAGTGGTGCCTTGGCCCCA 3 'EcoRI V L BACK primer 5' GACATT CAGCTG ACCCAGTCTCCA 3 'PvuII V L FOR primer 5' GTT AGATCT CCAGCTTGGTCCC 3 'BglII ────────────────────────────────────

Each primer was synthesized by a 394 DNA / RNA synthesizer (manufactured by Applied Biosystems). This was incubated at 55 ° C. for 4 hours to deprotect the base portion, and then crude purification was performed using a C-18 reverse phase open column. The crudely purified oligomer was incubated with 80% acetic acid for 20 minutes to deprotect the dimethoxytrityl group, and this was used as a primer.

[0024]

[PCR amplification of V _H region] V _H B for 2 μL of cDNA
2 μL of ACK primer (78.5 pmole / μL), V _H FOR
2 μL of primer (41 pmole / μL), PCR buffer (100 mM Tris-HCl (pH8.8), 15 mM MgCl ₂ , 500 mM KC)
l, 1% TritonX-100) 2 μL, 24 mM dNTPs 2 μL,
9 μL of sterilized water, Taq DNA polymerase (2.5 units /
1 μL) to make a total of 20 μL, and denature at 94 ° C.
30 seconds, annealing at 55 ° C for 1 minute, extension reaction at 72 ° C for 2 minutes
PCR was performed for 44 cycles under the condition of minutes. Note that V
_{The H} BACK primer mixes in consideration of codon degeneracy.
Since a primer is used, it was added in an amount twice that of the V _H FOR primer.

[0025]

[PCR amplification of V _L region] For 1.5 μL of cDNA,
_{1 L} BACK primer (160 pmole / μL), _VL FOR
0.7 μL of primer (228.6 pmole / μL), PCR buffer (100 mM Tris-HCl (pH8.8), 15 mM MgCl ₂ , 500 mM
KCl, 1% TritonX-100) 3 μL, 24 mM dNTPs 1 μL
, 22.5 μL of sterile water, Taq DNA polymerase (5 unit
s / μL) to 0.5 μL to make a total of 30 μL, and denature 94
30 seconds at ℃, 1 minute at 45 ℃ annealing, 72 ℃ extension reaction
PCR was performed for 44 cycles under the condition of 2 minutes.

[0026]

[Purification of PCR product] The desired PCR product was separated and purified on a 2.5% low melting point agarose gel. PCR above
The reaction solution was divided into 10 μL aliquots, and 7 μL of a loading solution (20% saccharose, 0.1% bromphenol blue) was added to each and homogenized and applied. Electrophoresis buffer contains 40 mM Tris-AcOH (pH 8.3), 5 mM AcONa, 1 mM EDTA.
Was used. After electrophoresis, the gel was stained with ethidium bromide to give the desired band ( _VH : about 350 bp, _VL : about 330 bp).
Was recovered from the gel. This gel fragment was put into a 1.5 mL sterile tube, and TE solution (1 mM Tris-HCl (pH8.0), 0.1
mM EDTA) at 200 μL and 4M NaCl at 15 μL, and add at 70 ° C.
It was heated for 10 minutes to dissolve the agarose. To this, TE-saturated phenol (500 μL) was added and stirred rapidly. After performing phenol extraction, back extraction, phenol-chloroform extraction, and chloroform extraction, freeze-dry to a total volume of 300 μm.
L, add 750 μL of ethanol, and stir at -80 ° C for 2
Left for hours. Centrifuge this (12000 rpm, 0 ° C, 20 minutes)
Then, the DNA was recovered as a precipitate.

[0027]

[Restriction enzyme treatment of DNA fragment] Since the restriction sites for subcloning are introduced into the primers used in PCR, the restriction sites are present near both ends of the _VH and _VL DNA fragments obtained above. Exists.
For the V _H, XhoI to V _H BACK, contains EcoRI in V _H FOR, respect to the V _L, PvuII to V _L BACK, the V _L FOR
Contains the BglII site. To introduce each DNA fragment into the cloning vector, it was treated with the corresponding restriction enzyme.

[0028]

[Treatment of V _H DNA fragment with restriction enzyme] V _H D
To 20 μL (about 0.5 μg) of NA fragment, Takara H-buffer (500 mM Tris-HCl (pH 7.5), 100 mM MgC)
l ₂ , 10 mM DTT) 5 μL, sterile water 21 μL, Xho I (8uni
ts / μl) 2 μL, EcoRI (12 units / μl) 2 μL,
The mixture was homogenized and incubated at 37 ° C for 10 hours. After the enzymatic reaction was completed, 5 μL of 4 M NaCl, 45 μL of sterilized water and 250 μL of ethanol were added, and after stirring, the mixture was allowed to stand at −80 ° C. for 2 hours and then centrifuged (12000 rpm, 0 ° C., 20 minutes) to precipitate the DNA. Recovered. This was dissolved in 20 μL and 20 μL of sterilized water. Thereafter, this DNA fragment was designated as V _H (XE) (FIGS. 1 and 2).
reference).

[0029]

[Restriction enzyme treatment of _VL DNA fragment] _VL D
For 20 μL (about 0.7 μg) of NA fragment, Pvu II dedicated buffer (60 mM Tris-HCl (pH 7.
5), 60mM MgCl ₂ 60mM β-mercaptoethanol)
μL, sterilized water 23.5 μL, Pvu II (10 units / μL) 1.5 μ
L was added and homogenized and incubated at 37 ° C for 6 hours. 0.5 μL of 4M NaCl was added to this, and Bgl II (8 units /
1.5 μL was added, and the mixture was homogenized and incubated at 37 ° C. for 6 hours. After the enzymatic reaction was completed, 5 μL of 4 M NaCl, 43 μL of sterilized water, and 250 μL of ethanol were added, and after stirring, the mixture was stirred at -80 ° C for 2
Let stand for an hour, centrifuge (12000 rpm, 0 ° C, 20 minutes), and
NA was recovered as a precipitate. This was dissolved in 20 μL of sterilized water. Thereafter, this DNA fragment was designated as V _L (PB) (see FIGS. 1 and 3).

[0030]

[Restriction enzyme treatment of cloning plasmid vector]
Bluescript II is used as a cloning plasmid vector.
KS (+) (pBS II (+) in FIGS. 2 and 3) was used. V _H (X-
In order to incorporate E) and V _L (PB) into the vector using the multiple cloning site (MCS) in the vector, each plasmid was treated with the corresponding enzyme (see FIGS. 2 and 3). The pBS II (+) multi-cloning site has Xho I and EcoRI sites present in V _H (XE), but does not include the Pvu II site and Bgl II site of _VL (PB). Therefore, as shown in Fig. 4, for Pvu II, EcoRV that forms a similar blunt end at the cleavage site was used for Bgl II.
Was substituted with BamHI, which has the same sequence of sticky ends generated by the cleavage.

Bluescript II KS (+) 10μ for V _H (XE)
For L (about 5.0 μg), Takara H-buffer (500 m
5 μL of M Tris-HCl (pH7.5), 100 mM MgCl ₂ , 10 mM DTT)
, Sterile water 31 μL, Xho I (8 units / μl) 2 μL, EcoRI
(12 units / µl) (2 µL) was added to homogenize, and the mixture was incubated at 37 ° C for 10 hours. After the enzymatic reaction is completed, add 4M NaCl to 5μ
L, 45 μL of sterilized water, and 250 μL of ethanol were added, and after stirring, the mixture was allowed to stand at −80 ° C. for 2 hours and then centrifuged (12000 rpm, 0 ° C.,
20 minutes) and the DNA was recovered as a precipitate. 20 μL of this
Dissolved in sterile water. Next, in order to enhance the efficiency of ligation with V _H (XE), this was electrophoresed on a 1.0% low melting point agarose gel to separate the target DNA and short DNA fragments generated by the enzymatic reaction, and the target product Recovered more.
The method was carried out according to the method for purifying the PCR product described above. The recovered DNA was dissolved in 20 μL of sterilized water. Hereinafter, this was designated as pBS (X-E).

BluescriptII KS (+) 10μ for V _L (PB)
Takara K-buffer (200m) for L (about 5.0 μg)
M Tris-HCl (pH8.5), 100mM MgCl ₂ , 10mM DDT, 1000mM K
Cl) 5 μL, sterilized water 33.5 μL, BamHI (6 units / μl)
1.5 μL was added, and the mixture was homogenized and incubated at 30 ° C. for 6 hours. After the enzymatic reaction, 4M NaCl 5μL, sterilized water 45μL
, 250 μL of ethanol was added, and the mixture was stirred and allowed to stand at −80 ° C. for 2 hours, then centrifuged (12000 rpm, 0 ° C., 20 minutes) to collect DNA as a precipitate, which was dissolved in 43.5 μL of sterile water. Subsequently, Takara H-buffer (500 mM Tris
-HCl (pH7.5), 100mM MgCl ₂ , 10mM DTT) 5μL, EcoRV
(8 units / μl) Add 1.5 μL to homogenize and mix at 37 ° C for 6
Incubated for hours. After finishing the enzymatic reaction, pBS
The same operation as in (X-E) was performed to collect the DNA as a precipitate, which was dissolved in 20 μL of sterilized water. After that, call this pBS (E
-B).

[0033]

[Construction of cloning vector] V _H (XE) and pBS
The target cloning vector was constructed by ligating (X-E), V _L (PB) and pBS (E-B). Let each be pTDM2V _H and pTDM2V _L (see FIGS. 2 and 3).

PTDM2V _H was constructed as follows. For pBS (X-E) 4.4 μL (0.1 μg), V
_H (XE) 3.6 μL (0.05 μg), ligation buffer (0.
25M Tris-HCl (pH7.6), 50mM MgCl ₂ , 5mM ATP, 5mM DTT,
25% polyethylene glycol-8000) 4 μL, 0.2Mβ
-Mercaptoethanol 1.0 μL, sterile water 6.0 μL, T
₄ DNA ligase (350 units / μL) (1.0 μL) was added to homogenize, and the mixture was incubated at 16 ° C. for 20 hours. After the reaction was completed, 1.25 μL of 4 M NaCl, 3.75 μL of sterilized water, and ethanol
62.5μL and the mixture was left for two hours at -80 ° C. After stirring, centrifugation (12000 rpm, 0 ℃, 20 min) was collected as to precipitate the DNA, each dissolved in sterile water 20μL, pTDM2V _H
Got

PTDM2V _L was constructed as follows. For pBS (X-B) 4.0 μL (0.1 μg), V
_L (PB) 1.6 μL (0.05 μg), ligation buffer 4.0 μ
L, 0.2 M β-mercaptoethanol 1.0 μL, sterile water 8.
4 μL, T ₄ DNA ligase (350 units / μL) 1.0 μL
L was added to homogenize and incubated at 16 ° C for 20 hours.
After the reaction, treat the same as in the case of pTDM2V _H ,
It was obtained pTDM2V _L.

[0036]

[Introduction of pTDM2V _H and pTDM2V _L into E. coli]
Using the pTDM2V _H and pTDM2V _L obtained above, E. coli (DH5
Transformed α). E. coli 100
Add μL to an electroporation cuvette and add 4 μL of pTDM2V _H solution or pTDM2V to it.
Add _L solution to make it uniform, capacitance 25 μFD, resistance 400 Ω, voltage 2.5 KV electroporation (BIO-RAD Pulse Controller)
I went. Immediately after electroporation, 1.0 mL of LB medium (1.0% Bacto tryptone, 0.5% yeast extract,
0.5% NaCl, pH 7.3) was added, and after stirring, the mixture was incubated at 37 ° C for 1 hour. Of this, 200 μL is LB-Amp-X.
gal agar medium (1.0% bacto tryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% Agar Noble (pH7.3), 100 μg / mL
Ampicillin, 60 μg / mL 5-Bromo-4-chloro-3-indolyl-
β-D-galactopyranoside (X-gal)) at 37 ℃
After culturing for 2 hours, colonies were subjected to blue-white selection by α-complementation of β-galactosidase.
Select a white colony expected to contain the desired plasmid from the agar medium, and select LB-Amp medium (1.0% Bacto tryptone, 0.5% yeast extract, 0.5% NaCl (pH 7.3), 100 μg /
5 mL (ampicillin) was subcultured and incubated at 37 ° C. for 6 hours. After centrifuging and collecting the bacteria, rapid-boiling
A plasmid was prepared by the method and treated with a restriction enzyme to confirm whether it was the desired plasmid.

[0037]

[Subcloning of pTDM2V _H and pTDM2V _L ] Escherichia coli harboring the target plasmid was planted in 5 ml of LB-Amp medium and incubated at 37 ° C. for 6 hours.
Transfer to LB-Amp 300ml, 37 ° C for 12 hours,
Mass culture was performed. After collecting this, using Qiagen Plasmid Kit Chip-500 (manufactured by QIAGEN),
A large amount of the target plasmids pTDM2V _H and pTDM2V _L was prepared. The plasmid was recovered as a precipitate, which was
0 μL TE solution (1 mM Tris-HCl (pH8.0), 0.1 mM EDTA
).

[0038]

[Nucleotide sequence determination of V _H (XE) and V _L (PB)] Using the obtained plasmids pTDM2V _H and pTDM2V _L , V _H (X-
The nucleotide sequences of E) and _VL (PB) were determined. Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical Corp)
oration company) was used. About 10.0 μg of plasmid, 14 μL of 5M NaOH, 1.4 μL of 0.05M EDTA (pH8.0),
An appropriate amount of sterilized water was added to make a total volume of 350 μL, and the mixture was incubated at 37 ° C. for 30 minutes to denature the DNA. To this, 35 μL of 3M sodium acetate (pH5.2) and 1.0 mL of ethanol were added, and after stirring, the mixture was allowed to stand at -80 ° C for 30 minutes and then centrifuged (12000 rpm, 0 ° C, 20 minutes).
Then, the DNA was recovered as a precipitate. This was dissolved in 14 μL of sterilized water and then divided into 7 μL aliquots, which were used as template DNAs for T3 primer for coding strand, SK primer for non-coding strand (for pTDM2V _H ) or T7 primer (for pTDM2V _L ). . Reaction buffer (200mM Tris-HCl
(pH7.5), 100 mM MgCl ₂ , 250 mM NaCl) 2 μL, T3 primer or T7 primer (1 pmole / μL) 1 μL
Add a total volume of 10.0 μL and incubate at 65 ℃ for 5 minutes.
Annealing was performed after gradually cooling to room temperature.

After ice-cooling for 5 minutes, 0.1 M dithiothreitol was added.
1.0 μL, labeling mix (1.5 μM dGTP, 1.5
μM dCTP, 1.5 μM dTTP) 2.0 μL, [α- ³⁵ S] d
0.5 μL of ATP and enzyme mix [enzyme dilution buffer (10 mM Tris-HC
l (pH7.5), 5 mM DTT, 0.5 mg / mL BSA) 6.5 μL, pyrophosphatase (5.0 units / mL) 0.5 μL, Sequenase version 2.0 T7 DNA polymerase (13 units /
mL) 1.0 μL mixture] was added to the mixture, and the mixture was incubated at room temperature for 5 minutes. This is 2.5 μL of ddA, d
Dispense 3.5 μL each into dG, ddT or ddC termination mix (Table 2) to homogenize and
The reaction was allowed for 0 minutes.

[0040]

[Table 2] ────────────────────────────────── ddA: 80 μMdGTP, 80 μMdATP, 80 μMdCTP, 80 μMdTTP, 8 μMddATP, 50mMNaCl ddG: 80μMdGTP, 80μMdATP, 80μMdCTP, 80μMdTTP, 8μMddGTP, 50mMNaCl ddT: 80μMdGTP, 80μMdATP, 80μMdCTP, 80μMdTTP, 8μMddTTP, 50mMNaCl ddC: 80μMdGTP, 80μMdATP, 80μMdCTP, 80μMdTTP, 8μMddCTP, 50mMNaCl ────────── ────────────────────────

To this, 4.0 μL of stop solution (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% Xylene Cyanol FF) was added to stop the reaction, and the mixture was heated at 95 ° C. for 3 minutes and then rapidly cooled in ice. After that, 7 M urea polyacrylamide gel electrophoresis (gel concentration: 9%) was performed. After the electrophoresis, DN by radio autogram
The sequence of A was determined. The DNA sequence of the V _H (XE) region is shown in FIGS. The DNA sequence of the V _L (PB) region is shown in FIG.
8 shows.

Amino acid sequences deduced from the DNA sequences shown in FIGS. 5, 6, 7 and 8 are shown by amino acid abbreviations below the DNA sequences in each figure. Each abbreviation represents each amino acid shown in Table 3.

[0043]

[Table 3] Abbreviations of amino acids ───────────────────────────── A: Ala E: Glu L: Leu S: Ser R: Arg Q: Gln K: Lys T: Thr N: Asn G: Gly M: Met W: Trp D: Asp H: His F: Phe Y: Tyr C: Cys I: Ile P: Pro V: Val ──── ─────────────────────────

In the DNA sequence of the V _H (XE) region shown in FIGS. 5 and 6, nucleotides 1 to 12 correspond to the V _H BACK primer used. Also, nucleotides 308 to 332 corresponded to the V _H FOR primer.

Of the three amino acid sequences predicted from the determined DNA sequence, in the lower two amino acid sequences of FIGS. 5 and 6, DN which defines the nonsense stop codon (* in the figure) is determined.
Since it is the A sequence, it is presumed that the uppermost amino acid sequence in the figure is the actual amino acid sequence of the V _H region. Also, in the amino acid sequence at the top, the region surrounded by a frame,
SYGVH (Se corresponding to nucleotide numbers 79 to 93
r Tyr Gly Val His), nucleotide numbers 136-18
VIWSDGSTTYNSALKS (Val corresponding to 1
Ile Trp Ser Asp Gly Ser Thr Thr Tyr Asn Ser Ala Le
u Lys Ser), and nucleotide numbers 283 to 306.
Compatible with PPTTYVCL (Pro Pro Thr Thr Tyr Va
l Cys Leu) is an amino acid sequence that is considered to be exposed on the surface of the molecule by forming a loop, and CDR (complementarity determining site: complementarity determining site) that determines antibody specificity.
It is a region considered to be a determining region).

In the DNA sequence of the V _L (PB) region shown in FIGS. 7 and 8, nucleotides Nos. 1 to 18 were used for the V _L B.
Corresponds to the ACK primer. Also, nucleotide number 29
8 to 316 corresponded to the V _L FOR primer.

Of the three amino acid sequences predicted from the DNA sequence of the V _L (PB) region, the lower two amino acid sequences of FIGS. 7 and 8 are DNAs that define the nonsense stop codon (* in the figure). Since it becomes a sequence, the amino acid sequence at the top of the figure is presumed to be the actual amino acid sequence of the V _L region. Further, in the amino acid sequence in the uppermost row, a region surrounded by a frame, S corresponding to nucleotide numbers 64 to 99
ASSSSVSSNYFH (Ser Ala Ser Ser Ser Val Se
r Ser Asn Tyr Phe His), nucleotide number 145-
165 compatible RTSNLAS (Arg Thr Ser Asn Le
u Ala Ser), and nucleotide numbers 283 to 306.
Corresponding to QQWSGYPFT (Gln Gln Trp Ser Gly
Tyr Pro Phe Thr) is an amino acid sequence that is considered to be exposed on the surface of the molecule by forming a loop. CDR (complementarity determining site: complement determining site: complement determining site)
arity determining region).

[0048]

INDUSTRIAL APPLICABILITY As described above, TDM-2 which is a monoclonal antibody that recognizes cyclobutane-type thymine dimer
The DNA sequence of the variable region was revealed. Obtained D
The NA sequence makes it possible to construct the V _H chain region and the V _L chain region that form the variable region of the TDM-2 antibody, and to produce a recombinant antibody that specifically recognizes a cyclobutane thymine dimer. it can. Since the recombinant antibody of the present invention can be constituted only by the minimum necessary site (variable region) for epitope recognition, the measured value is stable as a specific antibody for detecting cyclobutane thymine dimer, and the reproducibility and accuracy are high. You can expect measurement.

[Brief description of drawings]

FIG. 1. cDNA from RNA isolation of TDM-2 cells.
For DNA synthesis, PCR amplification, cloning vector construction
It is a process conceptual diagram until preparation of NA fragment.

FIG. 2 is an explanatory diagram showing the construction of a cloning vector pTDM2V _H that encodes a V _H (XE) region.

FIG. 3 is an explanatory diagram showing the construction of a cloning vector pTDM2V _L V _H encoding a V _L (PB) region.

FIG. 4 Pvu II site and Bg of V _L (PB) fragment
l II site and cloning plasmid vector Blue
FIG. 4 is a diagram showing a correspondence relationship between scriptIIKS (+) (pBSII (+) in FIGS. 2 and 3) and EcoRV site and BamHI.

FIG. 5 is a diagram showing the first half of the DNA sequence of the V _H (XE) region and the deduced amino acid sequence predicted therefrom.

FIG. 6 is a diagram showing the second half of the DNA sequence of the V _H (XE) region and the predicted amino acid sequence predicted therefrom.

FIG. 7 is a diagram showing the first half of the DNA sequence of the V _L (PB) region and the deduced amino acid sequence predicted therefrom.

FIG. 8 is a diagram showing the second half of the DNA sequence of the V _L (PB) region and the deduced amino acid sequence predicted therefrom.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location // C12N 5/20 (C12P 21/08 C12R 1:91)

Claims (7)

[Claims] 1. D encoding a variable region V _H region of a specific antibody TDM-2 against a cyclobutane type thymine dimer.
NA array. 2. The DN coding for the V _H region according to claim 1, wherein the DNA sequence is the following sequence:
A sequence: 10 20 30 40 50 60 CTCGAGTCAG GACCTGGCCT GGTGGCGCCC TCACAGAGCC TGTCCATCAC ATGCACCGTC TCAGGGTTCT CATTAACTAG CTATGGTGTA CACTGGGTTC GCCAGCCTCC AGGAAAGGGT CTGGAGTGGC TGGTAGTGAT ATGGAGTGAT GGAAGCACAA CCTATAATTC AGCTCTCAAA TCCAGACTGA GCATCAGCAA GGACAACTCC AAGAGCCAAG TTTTCTTAAA AATGAACAGT CTCCAAACTG ATGACACAGC CATGTACTAC TGTGCCAGAG AGCCTCCCAC GACGTACGTT TGCTTACTGG GGCAAGGCAC CACTGTTACC 3. D encoding the variable region V _L region of the specific antibody TDM-2 for cyclobutane thymine dimer
NA array. 4. The DN encoding the V _L region according to claim 3, wherein the DNA sequence is the following sequence:
A sequence: 10 20 30 40 50 60 GATCTGACCC AGTCTCCAGC AATAATGGCT GCCTCTCTGG GGCAGAAGGT CACCATGACC TGTAGTGCCA GCTCAAGTGT GAGTTCCAAT TACTTCCACT GGTACCAACA GAAGTCAGGC GCTTCTCCCA AACCCTTGAT TCATAGGACA TCCAACCTGG CTTCTGGAGT CCCAGCTCGC TTCAGTGGCC GTGGGTCTGG GACCTCTTAC TCTCTCACAA TCAGCAGCGT GGAGGCTGAA GATGATGCAA CTTATTACTG CCAGCAGTGG AGTGGTTACC CATTCACGTT CGGCTCGGGG ACCAAGCTGG AGATCC 5. A V _H chain region defined by a DNA sequence encoding the variable region V _H region of specific antibody TDM-2 and a DN encoding the variable region V _L region of specific antibody TDM-2.
A recombinant antibody comprising a V _L region defined by the A sequence and specifically recognizing a cyclobutane-type thymine dimer. Wherein said recombinant antibody according to claim 5, wherein the V _H region DNA sequence encoding the DNA sequence and the V _L regions encoding is characterized in that it is a sequence of respectively: a V _H chain region DNA sequences encoding; 10 20 30 40 50 60 CTCGAGTCAG GACCTGGCCT GGTGGCGCCC TCACAGAGCC TGTCCATCAC ATGCACCGTC TCAGGGTTCT CATTAACTAG CTATGGTGTA CACTGGGTTC GCCAGCCTCC AGGAAAGGGT CTGGAGTGGC TGGTAGTGAT ATGGAGTGAT GGAAGCACAA CCTATAATTC AGCTCTCAAA TCCAGACTGA GCATCAGCAA GGACAACTCC AAGAGCCAAG TTTTCTTAAA AATGAACAGT CTCCAAACTG ATGACACAGC CATGTACTAC TGTGCCAGAG AGCCTCCCAC GACGTACGTT TGCTTACTGG GGCAAGGCAC CACTGTTACC encoding V _L chain region DNA sequence to be analyzed; CTTATTACTG CCAGCAGTGG AGTGGTTACC CATTCACGTT CGGCTCGGGG ACCAAGCTGG AGATCC 7. The V _H region and V _L region defined by the DNA sequence coding for the V _H region and the DNA sequence coding for the V _L region, respectively, are the following amino acid sequences: Item 6. Recombinant antibody: V _H chain region; Leu Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Ser Tyr Gly Val His Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu Val Val Ile Trp Ser Asp Gly Ser Thr Thr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Ser Ile Ser Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Met Tyr Tyr Cys Ala Arg Glu Pro Pro Thr Thr Tyr Val Cys Leu Leu Gly Gln Gly Thr Thr Val Thr V _L chain region; Asp Leu Thr Gln Ser Pro Ala Ile Met Ala Ala Ser Leu Gly Gln Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Ser Asn Tyr Phe His Trp Tyr Gln Gln Lys Ser Gly Ala Ser Pro Lys Pro Leu Ile His Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Ar g Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Val Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Gly Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile