JPH06319396A - Plant for production antiviral antibody and method for creating the same plant - Google Patents

Abstract

PURPOSE:To provide a plant for producing antiviral antibody and a method for creating the plant. CONSTITUTION:The plant produces antiviral monoclonal antibody derived from animals including human. The method for creating this plant contains a step for establishing a hybridoma producing monoclonal antibody to desired virus, a step for preparing cDNA from the hybridoma, a step for selecting cDNA coding H chain and L chain of the monoclonal antibody from the cDNA, a step for integrating the cDNA into a plant expression vector, a step for transforming a desired plant with the plant expression vector and a step for selecting the plant producing desired antibody from the plant after transforming step.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a plant producing an antiviral antibody and a method for producing the plant. The present invention is useful for industrial production of antibodies and production of virus resistant plants.

[0002]

2. Description of the Related Art Currently, antiviral monoclonal antibodies are produced by the hybridoma method. That is, an animal is immunized with a virus to form a fused cell hybrid (hybridoma) between an antibody-producing cell from this animal and a myeloma cell, and this is cloned. Then, a clone producing an antibody showing specificity for the virus is selected and cultured to obtain a monoclonal antibody against the virus.

However, the method for producing an antiviral antibody using this hybridoma method requires time and cost.

On the other hand, Andrew Hiatt et al., Nature, 342
(1988) 76-78 "Production of antibodies in transgen
ic plants "has 6D4 that binds to low molecular weight phosphoric acid ester (P3) and catalyzes the hydrolysis of carboxylic acid ester.
It has been described that a gene for the antibody has been introduced into tobacco. 6D4 antibody heavy chain and L
A total of four types of genes, each containing a leader sequence and lacking a leader sequence for each light chain gene, were introduced into tobacco using Agrobacterium. The proteins of both chains were bound by mating with a transformant producing H chain and L chain. A leader sequence was required for binding. As a result, 1.3% of total soluble protein in leaves
The corresponding antibody was produced in the transformant. The binding between the antibody produced in the transformant and the antigen P3 was as specific as the antibody derived from the hybridoma.

However, in this method, in order to obtain a transformant producing an antibody by mating,
It takes time and effort. Also, the antigen is not a virus.
When a high-molecular component such as a virus is used as an antigen, there is a problem in that the three-dimensional structure of the active site can be assembled in a plant cell like an animal.

Klaus During et al., Plant Molecular
Biology, 15 (1990) 281-293 "Synthesis and self-assem
bly of a functional monoclonal antibody in transge
nicNicotiana tabacum "describes a tobacco into which a gene for the B1-8 antibody has been introduced. The H1 and L chain genes of the B1-8 antibody were connected to the signal sequence of barley aleurone layer α-amylase, and both chain genes were linked. Were introduced into tobacco using Agrobacterium. Both chains were bound in the transformant to produce active B1-8 antibody. Electron microscopic observation revealed that not only endoplasmic reticulum but also leaves It was revealed that antibodies also exist in chloroplasts.

However, the amount of antibody produced is not reported in detail in this paper, and it is considered that the amount of antibody produced is lower than that in the above-mentioned mating method of Hiatt et al. Moreover, the antibody produced in the plant is not an antiviral antibody.

[0008]

As described above, the production of antiviral antibody by the hybridoma method requires time and cost. Further, heretofore, there is no example in which a plant produces an antiviral antibody. Therefore, an object of the present invention is to provide a plant that produces an anti-virus antibody and a method for producing the plant.

[0009]

[Means for Solving the Problems] As a result of earnest research, the inventors of the present invention produced a plant producing an antiviral antibody by transforming the plant with a vector containing cDNA of a hybridoma producing an antiviral antibody. And succeeded in completing the present invention.

That is, the present invention relates to animals (including humans)
Provided is a plant that produces an anti-viral monoclonal antibody of the origin. The present invention also provides a step of establishing a hybridoma producing a monoclonal antibody against a desired virus, a step of preparing cDNA from the hybridoma, and a cDNA encoding the H chain and L chain of the monoclonal antibody from the cDNA. Step of selecting and the cd
Including the step of incorporating NA into a plant expression vector, the step of transforming a desired plant with the plant expression vector, and the step of selecting a plant that produces the desired antibody from the plants after the transformation step. Provide a method for producing a plant.

The present invention will be described in detail below.

The plant of the present invention produces an animal-derived antiviral monoclonal antibody. Tobacco was used as a plant in the following examples, but the plant is not limited thereto. Further, the monoclonal antibody, which is derived from mouse in the following examples, human, bovine, porcine,
It may be derived from other mammals such as sheep, monkeys, dogs, cats, or birds such as chickens. Also,
Tobacco mosaic virus (TMV) was used as the virus in the following examples, but the virus is not limited to this, and any virus or plant whose antibody is useful as a drug, veterinary drug, diagnostic agent or the like is resistant to it. It may be any virus desired to have sex.

The plant of the present invention can be produced by the following method.

First, a hybridoma producing a monoclonal antibody against a desired virus is established. This can be carried out by a conventional hybridoma method, and the details of one example of its operation are described in the following examples. In the following examples, in order to confirm that the cDNA obtained in the later step encodes the monoclonal antibody, the monoclonal antibody was purified and its amino acid sequence was partially identified.

Next, cDNA is prepared from the hybridoma. cDNA can be prepared from hybridomas
RNA can be recovered by a conventional method, and using this as a template, a reverse transcriptase is allowed to act. cDNA can be prepared by a conventional method into a cDNA library using Escherichia coli as a host. Furthermore, in the following examples,
Total mRNA was subjected to sucrose density gradient centrifugation, and mRNA fraction of H chain gene (hereinafter sometimes referred to as H-mRNA)
And an mRNA fraction of the L chain gene (hereinafter sometimes referred to as L-mRNA) are obtained, and reverse transcription is performed using oligo primers each having a known constant region sequence.
DNA was made. These cDNAs were used as probes for selecting the cDNAs encoding the H chain and L chain from the above cDNA library in the next step.

Next, from the above cDNA library,
C encoding the H chain and L chain of the above monoclonal antibody
Select DNA. This is due to the above H-mRNA and L-
It can be carried out by colony hybridization using single-stranded cDNA prepared from mRNA as a probe. Details of this operation are described in the examples below. A plasmid is obtained from the selected colony by the rapid plasmid isolation method, etc., and the insert fragment is excised with an appropriate restriction enzyme such as Pst I, and its length is assayed by gel electrophoresis, etc. Colonies with fragments of a length that matches can be further selected. This insert fragment can be subjected to Southern hybridization using a constant region known in the literature as a probe to select a clone having an immunoglobulin cDNA. Further, with caution, the above insert fragment can be digested with various restriction enzymes, and the cleavage pattern thereof can be compared with that of the constant regions of the L chain and H chain described in the literature to identify an immunoglobulin cDNA clone. . Further, in the following examples, the nucleotide sequences of the H chain-encoding cDNA and the L chain-encoding cDNA selected in this way are determined by the Maxam & Gilbert method.
Method).

Next, cDNAs encoding the H chain and the L chain respectively are incorporated into a plant vector. For the introduction of the gene into plant cells, it is preferable to use a completed vector system, and the system using Ti plasmid is the best at present. In addition, the Ti plasmid-based vector is Agrobacterium tumefaciens (Agrobacterium tumefaciens
The vector having the left and right border regions in the Ti plasmid contained in ens) is a vector utilizing the fact that it has a strong plant transformation ability. In order to integrate into the Ti plasmid system, in the 5'upstream untranslated portion of the cDNA fragment, T upstream from ATG (eg 10 to 30 bps upstream).
It is preferable to add a restriction enzyme linker for incorporation into the i vector, while also adding the same restriction enzyme linker between the stop codon and the poly A part in the 3'downstream untranslated portion of the stop codon. In this way, with the restriction enzyme that cuts the restriction enzyme site introduced as a linker,
It is convenient because the prepared cDNA can be excised as one fragment and directly integrated into the Ti plasmid system. Such a cDNA fragment is preferably cloned in, for example, an E. coli vector, prepared in large quantities, and then incorporated into a plant vector. The restriction enzyme having a cleavage site in the restriction enzyme linker is one that has no cleavage site in the H-chain and L-chain cDNAs and has no cleavage site other than the cloning site in the vector used for cDNA preparation. You have to choose. If the desired restriction enzyme site is not present in the multiple cloning site of the cloning vector used, it can be introduced by a conventional method. In the examples below, E. coli vectors pUC18 and pUC18 are used as cloning vectors.
UC9 (commercially available from Pharmacia PL) was used, and Bgl II linker was used as a restriction enzyme linker (note that pUC1 was used).
8 and pUC19 contained Bgl in the multiple cloning site.
This was introduced because there is no II site).

Then, the cloned H chain and L chain c
The DNA fragment is incorporated into a plant vector as described above of the Ti plasmid system. This operation can be performed by cutting out the cDNA fragment with a restriction enzyme having a cleavage site in the restriction enzyme linker, cutting the plant vector with the same restriction enzyme, and incorporating the cDNA fragment into the plant vector. The H-chain cDNA and the L-chain cDNA may be contained in different vectors, but the latter is adopted in the following examples because the operation is simple if they are contained in the same vector. This can be carried out, for example, by first preparing a recombinant vector containing the H chain cDNA and a recombinant vector containing the L chain cDNA by the above method, and then recombining them.

When the Ti plasmid system is used as a plant vector, in order to transform a plant with this, the above recombinant vector is first introduced into Agrobacterium tumefaciens by a freezing method or the like, and this is transformed into a plant. This is done by infecting. Infection of a plant can be carried out by co-culturing a plant fragment (for example, a leaf piece) and the above recombinant Ti plasmid vector-containing Agrobacterium tumefaciens in a liquid medium. Then, the plant fragment is cultured in a foliage differentiation medium, and then in a rooting medium to obtain a transformed plant body.

Next, plants that produce the desired antibody are selected from the obtained plants. This can be performed by examining whether an antibody specifically reacting with the antigen virus is produced by an immunoassay such as ELISA. In order to improve the efficiency of selection, prior to this, for example, mRNA is extracted from plant cells, and plants producing antibody mRNA are selected by Northern analysis, which is a conventional method, and further, H chain and L chain are analyzed by Western analysis. It is preferable to confirm the expression of the chains. Furthermore, the association of both chains can be confirmed by Western analysis of the one obtained by affinity chromatography using a substance that specifically binds to the constant region of an antibody such as Protein A.

[0021]

EXAMPLES The present invention will be described more specifically below based on examples. However, the present invention is not limited to the following examples.

1. Preparation of Anti-TMV Monoclonal Antibody 1-1 Mice were immunized with TMV or TMV coat protein (CP). Immunization was carried out 2-3 times at a dose of 50 μg / dose. Three days after the final immunization, splenocytes were taken out from the mice. Mouse myeloma cells (P3-X63-Ag-U1 (P3-U1), P3-N
SI / 1-Ag4-1 (NS-1) and X63-Ag8-6.5.3 (Ag 8-6.5.3)) 2
10 × 10 ⁷ cells and spleen cells from immunized mice (1
˜3 × 10 ⁸ cells) were washed with RPMI1640 medium and mixed. 50
% PEG4000 solution (dissolved in RPMI1640 medium) was added dropwise over 1 minute, stirred for 1 minute, and then diluted gradually with 10 ml of RPMI1640 medium. After centrifugation HAT medium (RPMI1640 medium, FCS 10
%, Hypoxanthine 10 ⁻⁴ M, thymidine 1.6 × 10 ⁻⁵
M and aminopterin (4 × 10 ⁻⁷ M) were suspended, and 1 to 5 × 10 ⁵ cells (spleen cells) were dispensed into a 96-well plate and cultured.
The medium is exchanged every 2 to 4 days, and HT medium (RPM1640 medium hypoxanthine 10 ⁻⁴ M, thymidine 1.
6 × 10 ^-5 M). Wells where proliferation was observed
Screening was performed using TMV (or CP) as an antigen by RIA or ELISA. That is, 50 μl of PBS containing TMV or CP (10 μg / ml, 0.15 M NaCl, 10 mM phosphate buffer, pH 7.5) was placed in a microtiter plate to adsorb the antigen, and after blocking treatment, the culture supernatant was diluted appropriately. Reacted with. After washing, it was reacted with a peroxidase-conjugated anti-mouse IgG (HRP-anti-mouse IgG) solution to develop color using O-phenylenediamine and hydrogen peroxide as substrates, and
The absorbance at 92 nm was measured. The subclass of the obtained antibody was determined by ELISA and Ouchterlony.

1-2 By the above operation, 100 to 300 hybridomas can be obtained in one fusion, of which anti-TMV or anti-TMVC
10 producing P-specific monoclonal antibody
Was 30%. Of these, hybridoma P-7, which is a stable hybridoma in which the antibody-producing ability does not decrease even after subculture for 6 months or more, was used in the following procedure. Monoclonal antibody P- produced by hybridoma P-7
The subclass of 7 was IgG ₁ .

1-3 Purification of P-7 Monoclonal Antibody and Amino Acid Sequence P-7 monoclonal antibody was purified by the method shown in FIG. By this method, a P-7 monoclonal antibody in which bovine IgG derived from FCS was almost completely removed could be prepared.

Prepared for H and L chains of P-7 Mab
In order to identify the cDNA (H-cDNA, L-cDNA) at the protein level, the purified P-7 Mab was used to try to separate the H chain from the L chain and determine the N-terminal amino acid sequence.
The H chain and the L chain were separated by the method shown in FIG. The L chain could be subjected to amino acid sequencer by extraction from gel after SDS-PAGE and purification by HPLC. As a result, the 14th to the 14th N-terminal coincided with the deduced amino acid from the cDNA (Table 1).

[0026]

[Table 1]

Considering that the C and J regions of the cDNA corresponded to the previously reported IgG ₁ , the prepared cDNA was P-7Mab.
It is considered to correspond to.

On the other hand, since the N chain of the H chain was blocked (pyroglutamic acid), the amino acid sequence could not be determined by the same method as that of the L chain. Therefore, the H chain was analyzed by the method described below. First, the H chains were separated according to the method shown in FIG.

The separated H chain was digested with BrCN, digested with trypsin and V-8, and the produced fragment was identified by FAB mass spectrometry. FAB
Considering the analysis ability of mass spectrometry, the molecular weight is 5
In some cases, it is impossible to completely identify the substance to which the sugar chain is bound, but some fragments are shown in Table 2. From this result, there is a possibility that the cDNA and the protein (P-7Mab) also correspond to each other in the H chain. More precisely, it is necessary to remove the Fc portion, adjust the molecular weight to about 2 to 25,000, and confirm by the method of FIG. 2 or analyze by another method.

[0030]

[Table 2] (1) The numerical value indicates the amino acid number from the N-terminus. (2) TP:
Trypsin, V-8: an enzyme produced by Staphylococcus aureus . (3) 1-10 and 82-89 have glutamine at the N-terminal, and it has been confirmed that this is not decomposed even by Edman degradation.

2 Cloning of anti-TMV mouse IgG / cDNA 2-1 Extraction of mRNA of anti-TMV mouse IgG The total RNA was extracted from 2 g wet pellet of anti-TMV mouse IgG-producing hybridoma P-7 by GTC method, and then oligo-
By passing through a dT cellulose column, poly ARNA (= m
RNA) was obtained at 300 μg. This was designated as total mRNA. Further, 109 μg of this portion was fractionated by a 5-20% sucrose density gradient centrifugation method, and each fraction was assayed by in-vitro translation.
Most of the total active mRNAs are in the fractions corresponding to the L chain and H chain mRNAs, and it is considered that a considerable portion of the mRNA produced by the hybridoma P-7 is IgG mRNA. 17
H chain mRNA (10 μg) was obtained from FR9-11 corresponding to S.
L chain mRNA (7 μg) was obtained from Fr13 to 15 corresponding to S.

2-2 Preparation of IgG / cDNA library A primer for DNA synthesis is hybridized with a template mRNA, and a reverse-transcriptase-complementary-chain cD complementary to the mRNA
NA was synthesized and then + strand cDNA complementary to-strand cDNA
NA was synthesized using DNA polymerase and template mRN
Double-stranded DNA complementary to A was synthesized. This operation is performed by the Gubler method (Gene, 25 volumes, page 2) as shown below.
63-269, 1983) according to the following three cases.

Total mRNA template: oligo-dT primer Using 5 μg of total mRNA as a template and oligo-dT (PdT12-18) as a primer, complementary to mRNA by AMV reverse transcriptase (RTase) in the presence of RNase inhibitor (RNasin). Na single chain cDN
A (sscDNA) was obtained in hybrid with mRNA. Then RN
Double-stranded DNA (dscDNA) was prepared using aseH, DNA polymerase I (Konberg), and E. coli DNA ligase. Since the obtained double-stranded DNA is a mixture of various lengths, 600 bp is passed through a Sepharose CL-6B column (commercially available from Pharmacia).
The cDNA below s was removed. In order to incorporate this dscDNA into pBR322, terminal deoxynucleotidyl transferas (terminal deoxynucleotidyl transferas
e) (TdTase), using dCTP, dC (10
-20) is added to the commercially available pBR322
Pstl site 3'end with dG (25) added (Pharmacia
(Commercially available from PL) is dC-dG annealed into a ring,
E. coli K12 RRI (recA +) was transformed. A cDNA library was obtained as a tetracycline-resistant colony (5 × 100,000 colonies / 1 μg cDNA).

L chain mRNA template: synthetic oligomer 15bs
Primer Using 5 μg of L chain mRNA fractionated by sucrose density gradient centrifugation as a template and synthetic oligomer [5'-CCTCCAGATGTTAAC: 15bs containing Hpal site on 5'side of L chain constant region] as a primer, the same procedure as above was performed. It was The efficiency of transformation was 5 × 100,000 colonies / 1 μg cDNA.

H chain mRNA template: synthetic oligomer 15bs
Primer Using 5 μg of H chain mRNA fractionated by sucrose density gradient centrifugation as a template and synthetic oligomer [5′-AGGGTCACCATGGAG: 15bs containing Nco I site on 5 ′ side of H chain constant region] as a primer, I did. The efficiency of transformation was 3 × 100,000 colonies / 1 μg cDNA.

2-3 Search and identification of IgG / cDNA clone 2-3-1 Search and identification of L chain cDNA clone 1) For colony hybridization, a probe was first prepared. Using 5 μg of L chain mRNA and oligo dT primer, a hybrid of sscDNA and mRNA was obtained by the same method as cDNA preparation,
Hydrolysis with NaOH gave sscDNA. At this time, α-
SscDNA was RI-labeled using the 32P-labeled bases of 32PdCTP and α-32PdATP.

2) Using the above probe, colony hybridization was carried out on the cDNA library and about 2000 colonies each. The number of selected colonies was 204 from the cDNA library prepared from all mRNA using oligo dT primer, L
Prepared from synthetic chain mRNA using synthetic oligomer
33 from the A library.

3) A plasmid was prepared from these selected colonies by the rapid plasmid isolation method, digested with PstI, and then the length of the fragment excised by 1.2% agarose gel electrophoresis was assayed.
A clone with a 200 bps fragment was selected. 30 from cDNA library, 1 from cDNA library
Six clones were selected.

4) Next, Southern hybridization of the fragment cut out with Pstl was carried out. As a probe
Mouse provided by Dr. Philip Leder emb RI Ck + Jk
(Cloning in Charon 4A vector) RI labeled by nick translation was used. From 18 clones having a fragment longer than the 30 clones selected above, Southern hybridization was carried out to obtain 1 clone that strongly hybridized. Similarly, 14 clones were selected from 16 clones, and Southern hybridization was performed to obtain 3 hybridizing clones.

5) For each of the obtained clones, a plasmid was prepared on a large scale, digested with various restriction enzymes, and its cleavage pattern (FIG. 3) was compared with that of the L chain constant region described in the literature to obtain the plasmid. Clone EL-39
Was identified as having the entire region of the IgG L chain cDNA.
Since the obtained clone does not have the entire region, the subsequent search was not performed.

2-3-2 Search and Identification of H Chain cDNA Clone 1) Like the case of L chain, possible clones were selected by colony hybridization. For the preparation of the probe, RI-labeled sscDNA was prepared using 5 μg of H chain mRNA and oligo dT primer by the same method as the preparation of cDNA and the preparation of the probe for the L chain.

2) With this probe, and
About 2000 colonies of each cDNA library were subjected to colony hybridization to select colonies. The number of selected colonies was 69 from the cDNA library prepared from all the mRNAs using the oligo dT primer, and 28 from the cDNA library prepared from the H chain mRNA using the synthetic oligomers.

3) A plasmid was prepared from these selected colonies by the rapid plasmid isolation method, and then PstI
The length of the fragment digested with 1.2% agarose gel electrophoresis was assayed, and a clone having a fragment of 300 to 1200 bps was selected. 28 from the cDNA library,
17 clones were selected.

4) Next, in carrying out Southern hybridization of the fragment cut out with Pstl, since the gene of the H chain already cloned for use as a probe was not available, it was used in the above-mentioned preparation of cDNA. A synthetic oligomer 5'-AGGGTCACCATGGAC (sequence near the 5'end of the H chain constant region) labeled with RI at the 5'end was used as a probe. ~ 900b out of 28 selected
Of the clones having a fragment of ps or more, 16 clones were selected from the more selected clones, and as a result, none of them hybridized.

5) However, for the 4 clones having a fragment of ˜900 bps or more, obtained up to the position of the probe used (near the 5 ′ end of the H chain constant region, upstream from the poly A site to a position of 1000 bsp). There is a possibility that cDNA synthesis has not been performed. For two of these clones, plasmids were prepared on a large scale, digested with various restriction enzymes, and compared with the restriction map of the constant region described in the literature. However, the restriction map of one of them, clone EH-16, coincided with that in the literature (Fig. 4).

As is apparent from FIG. 4, clone EH-16 encodes only -80% of the constant region from the 3'end of the H chain, and has a cDNA encoding the variable region on the 5'side. Was not obtained, the H chain cDNA clone was further searched.

2-3-3 Re-search and identification of H chain cDNA clone 1) Total mRNA: cDN prepared from oligo dT primer
Colony hybridization was performed again for ~ 10000 colonies from the A library. The synthetic oligomer 5'-AGGGTCACCATGGAG (constant region of the constant region was used to obtain a clone having a cDNA encoding the variable region.
As a result of using the sequence (near the 5 ′ end) as a probe, 5 strongly hybridizing colonies were selected.

2) A plasmid was obtained from these colonies by the rapid plasmid isolation method, digested with BamHl, Pstl and other restriction enzymes, and the length of the fragment excised by agarose electrophoresis was assayed.
For the stl fragment, Southern hybridization was carried out using the same probe as above.

Table 3 below shows the lengths of the fragments cut out with the restriction enzymes, and the fragments hybridized with the probe are underlined.

[0050]

[Table 3]

From Table 3, clones HII-1, -3 and -5 are the same, and the cloned cDNA seems to have a variable region in the middle of the constant region. On the other hand, in the clone HII-4, the direction of the cDNA inserted into the plasmid pBR322 is opposite to that of the former, and it seems that the variable region is hardly contained (Fig. 5). pHII3 was obtained, digested with various restriction enzymes, and its cleavage pattern (FIG. 3) was compared with that described in the literature. As a result, it was revealed that pH II3 contains almost the entire variable region and a part of the 5'side of the constant region, and the restriction enzyme map of the constant region coincided with that in the literature (Fig. 3).

As a result of the above, the following 3 clones were identified,
The entire region of the IgG cDNA was cloned here.・ L chain cDNA clone :: EL39 clone almost the entire region ・ H chain cDNA clone :: EH16 clone 80% of the 3'side of the EH16 constant region 5'side of the HII-3 constant region and 50% of the variable region The cDNA plasmids cloned into pBR322 that clone the entire region are abbreviated as pEL39, pEH16, and pHII3, respectively.

2-4 Restriction enzyme map and nucleotide sequence of anti-TMV mouse IgG cDNA 1) Preparation of restriction enzyme map for DNA nucleotide sequence determination. The constant region of IgG is the same class IgG (P-
In case of 7, pEH16, which encodes only the constant region, and pEL39, p, since the class is the same in γl and the light chain is κ)
Regarding the constant region of HII3, a restriction enzyme map was created by digestion with restriction enzymes and the sequences described in the literature. For the variable region, use the plasmid pEL39, pHII3 as is, or the cDNA excised from the plasmid, or c
A part of the DNA fragment was cleaved with various restriction enzymes, the length of the cleaved fragment was determined by agarose and polyacrylamide gel electrophoresis, and the fragments were arranged on the cDNA to estimate the positional relationship and create a map (Fig. 3). .

2) Determination of nucleotide sequence Referring to the restriction enzyme map, refer to the phosphate group at the 5'end of the appropriate site.
An RI-labeled DNA fragment was prepared and the nucleotide sequence was determined by the Maxam-Gilbert method. The direction and length of nucleotide sequence determination are shown in FIG. 3, the L chain is shown in FIGS. 6 and 7, and the nucleotide sequence of the H chain cDNA is shown in FIGS.

II-3 Ig for integration into plant vectors
Preparation of G / cDNA Introduction of a gene into a plant cell requires a completed vector system.
The system using the i plasmid is the best. The following points were assumed as conditions to be satisfied by the cDNA for incorporation into the Ti plasmid system. 1) At the 5'upstream untranslated portion of the start codon ATG, a restriction enzyme linker for incorporation into the Ti system is added between 10 and 30 bps upstream of ATG. On the other hand, the same restriction enzyme linker is added between the stop codon and the poly A site in the 3'downstream untranslated portion of the stop codon. That is, with the restriction enzyme introduced as a linker, the prepared cDNA is cut out as a single fragment and prepared so that it can be directly incorporated into the Ti plasmid system. 2) Those having a leader sequence for each of the L chain and the H chain, and c of only the mature sequence containing no leader sequence
Both of the DNAs are prepared so as to satisfy the condition 1).
[IgG is expressed with a leader sequence, but when secreted, the leader sequence is excised and secreted as mature IgG. ] The above-mentioned restriction enzyme linker was selected as Bgl II because it has no cleavage site in the L-chain and H-chain cDNA, and has no cleavage site other than the cloning site in the vector used for cDNA preparation. The vector has pUC18 which has MCS (multi cloning site) consisting of 13 restriction enzyme sites.
I chose. The construction of the vector was carried out with reference to the restriction enzyme map predicted from the nucleotide sequence. It should be constructed by incorporating IgG cDNA prepared under the above conditions.
The cDNA vector is abbreviated as follows. pUCLM-Incorporated into pUC18 cDNA encoding L chain and mature L chain. pUCLL-L chain, encoding L chain including leader sequence c
Incorporated DNA into pUC18. cDNA in which pUCHM-H chain and mature H chain-encoding cDNA are incorporated into pUC18. pUCHL-H chain, encoding H chain including leader sequence c
Incorporated DNA into pUC18.

3-1 Modification of vector pUC18 pUC was used as a vector for incorporating the prepared cDNA.
I chose 18 (commercially available from Pharmacia PL), but MCS of pUC18
Since there is no Bgl II cleavage site, which was selected as a linker, that should be a cloning site in (Multi-cloning site), the Bgl II site was first introduced into the MCS of pUC18. pUC18 MSC with SacI replaced by Bgl II [pU
C18BgSac] pUC18 MSC with SmaI replaced by Bgl II [pU
C18BgSma] The above two types of vectors were prepared. In addition pUC18 and MCS
The restriction enzyme sequences in pUC9 (Phar
(commercially available from macia PL). pUC9 MCS Bam HI replaced with Bgl II [pU
C9BgBam] FIG. 11 shows the sequences of the MCS portion of each vector and the restriction enzyme sites. These sequences were determined by sequencing the constructed cDNA vector described below.

3-2 Construction of cDNA vector 3-2-1 pUCLM (L chain mature cDNA) 1) Removal of the leader sequence on the 5 'side of L chain cDNA to matur
To add the start codon ATG to the 5'end of the e sequence, use the synthetic oligomer 19bs CATG -GATATTGTGATGACT (the underlined sequence is the 5'end of the mature sequence) that has the mature sequence 5'end l5bs next to CATG . Primer repair (primer r
epair) method to prepare 5'end ATG and digest with Pstl to 70bps
As a fragment of, the 5'-end portion of the mature cDNA was obtained. This 70 bps fragment was first cloned into the SmaI-PstI site of pUC18BgSac (pUCLPR70).

2) There is an AvaII site on the L chain cDNA 3'side, 6 bps downstream of the stop codon TAG, which is cleaved to make a blunt end with DNA polymerase 1 large fragment (Klenow type) (hereinafter abbreviated as klenow). , Bgl II linker was added. Then, it was cleaved with BglII-PstI to obtain the 3'side of the L chain cDNA as a 600 bps fragment.

3) 9 from pUCLPR70 by digestion with Eco RI-Pst I
A 0bps fragment was obtained and used as the 5'side of the mature cDNA. This and
At the same time, the 600bps 3'side fragment obtained in 2) was used for E.
It was cloned into the coRI-BglII site.

Regarding the obtained clone pUCLM, a restriction enzyme site (EcoRl, PstI, BglII) at the connection site, a newly formed NcoI site (at the ATG at the 5'end), and a regenerated AvaII when constructed. The site was confirmed by digestion with each restriction enzyme. In addition, there is no deletion at the 5'and 3'ends of the mature cDNA due to DNA sequencing at the 5'and 3'ends,
It was confirmed that it had a Bgl II site at a position that satisfied the first condition.

3-2-2 pUCLL (L chain leader cDNA) 1) Initiation codon of leader sequence Since there is no suitable restriction enzyme site within 30 bps upstream of ATG, Ban I site immediately after ATG is used for initiation. The codon ATG is regenerated by linking it with an Nco I linker,
The 5'end was prepared (Figure 12). At this time, the start codon ATG
The base next to is replaced by A → G, so the amino acid is also Arg
From Gly to ATG -A GG (Arg) → ATG -G GG (Gly).

2) NcoI-AvaI 380 bp thus obtained
The leader sequence cDNA was cloned by introducing the s fragment into the NcoI-AvaI site of pUCLM prepared in 3-2-1. [PUCLL] Therefore, the sequences in the 5'upstream and around 3'of the cDNA in pUCLL should be exactly the same as pUCLM. cDNA
The nucleotide sequence near the 5'end was confirmed by sequencing. Escherichia coli containing pUCLL has been deposited at the Institute of Biotechnology, Institute of Industrial Science and Technology, and the deposit number is FER.
It is MBP-4265.

3-2-2 pUCHM (H-chain matured cDNA) 1) Preparation of 3'end: pEH16 is used to downstream the stop codon TGA.
Using the AvaII site at 25bps, Bgl as described above
490bps after adding II linker and digesting with SmaI-Bgl II
We obtained the 3'-end as a fragment of the
It was cloned into the gl II-Sma I site. [PUCH6]

2) Preparation of H chain, full-length cDNA: From pHII3, MstI site on pBR322 adjacent to the 5'end of cDNA and cD
A 1000bps MstI-SmaI fragment between the SmaI sites of NA was excised and introduced into the SmaI site of pUCH6 obtained in 1). [PUCH
10] The obtained plasmid pUCH10 has a part of the sequence of pBR322 at the 5'end and Bgl I at the 3'end 25bps downstream of the stop codon.
The full-length cDNA with I site is cloned.

3) Recloning into pUC18: First, 330 bp HinfI fragment of pHII 3 containing the initiation codon ATG was added to pUC18.
It was cloned into the Hinc II site of 18BgSma. [PUCH1
2] Next, at the TthlllI-Hind III site of this pUCH12,
2) The tthlllI-HindIII fragment 1230b of pUCH10 obtained in 2)
Introduced ps. [PUCH16] pUCH16 has the entire length of the coding region excluding the untranslated portion of cDNA and has Bgl II sites upstream of the start codon ATG and downstream of the stop codon TGA, but the distance between ATG and Bgl II is 30 bps. Also, there is no restriction enzyme site at the 5'side of the vector and cDNA.

4) Preparation of 5'end: To remove the leader sequence on the 5'side of the cDNA and add the initiation codon ATG to the 5'end of the mature sequence, as in the case of the L chain, the synthetic oligomer 19
Using bs CATG -CAGGTTCAGCTCCAG (the underlined portion is the 5'end of the H chain cDNA matured sequence), the 5'end ATG was prepared by the primer repair method and cleaved with Tth111I to obtain a 5'end portion as a 130 bps fragment. Got This was introduced into the Xbal (blunt-ended with klenow) -Tth111I site of pUCH16 obtained in 3) to obtain an H chain cDNA encoding a mature sequence. [PUCHM]

3-2-4 pUCHL (H chain leader cDNA
) 1) Preparation of 5'end: MstI-SmaI fragment excised from pHII3 at MstI site on pBR322 and SmaI site on cDNA.
1000bps is cloned into the SmaI site of pUC18BgSac to obtain 5'side of cDNA. [PUCH11] To the BglII-Tth111I site of pUCH11, BglI was added to the HinfI 330bps fragment containing the start codon ATG near the 5'end of pHII3 cDNA.
A 190bps fragment obtained by digesting the I linker-added product with BglII-Th111I was introduced to remove the 5'untranslated portion and to have a BglII site at 10bps upstream of the start codon.
I got CH13. (The HinfI site regenerates between the vector and the cDNA 5'side junction.) [PUCH13]

2) Preparation of full-length cDNA: 3'side NcoI-Hind III940 bps and 3'from pUCH10 obtained in 2) of pUCHM.
PUCHL was obtained by cloning a full-length cDNA having Bgl II sites upstream of the start codon and downstream of the stop codon, excluding the untranslated portion. Escherichia coli containing pUCHL has been deposited at the Institute of Biotechnology, Institute of Biotechnology, and the deposit number is FERM BP-4266.

3-3 Confirmation of nucleotide sequence of constructed vector Four types of constructed vectors pUCLM, pUCLL, pUCHM, pUCHL
The nucleotide sequences of the 5'- and 3'-side binding portions containing the BglII site of pUC18 and cDNA in E. coli were determined by the Maxam-Gilbert method. In each case, the presence of the planned nucleotide sequence was confirmed (Fig. 13). Here, the preparation of a cDNA satisfying the conditions for incorporation into a plant vector was completed.

TMV antibody gene 4 kinds (LL: L
Chain, with leader sequence, LM: L chain, without leader sequence,
The antibody gene (HL: H chain, with leader sequence, HM: H chain, without leader sequence) was isolated with the restriction enzyme Bgl II.

Introduction of TMV antibody gene into plant expression vector pGA643 was used as a plant expression vector. This vector is a binary expression vector having a kanamycin resistance gene, a cauliflower mosaic virus 35S promoter, a multicloning site, and left and right borders of T-DNA. After incorporating the above-mentioned 4 genes (LL, LM, HL, HM) into the Bgl II site of pGA643 (Fig. 14), using the prepared pGA643 having the H chain gene and pGA643 having the L chain gene, L chain gene and H
The chain gene was introduced into the same vector. H
After cutting the chain gene vector with restriction enzymes EcoRI and Asu II to obtain a DNA fragment containing the 35S promoter and H chain gene, the Asu II site was blunted with E. coli DNA polymerase Klenow fragment, and EcoRI linker was added. They were connected and integrated into the EcoRI site of the L chain gene vector (Fig. 15). H chain obtained by the above construction,
A vector in which both genes of the L chain are ligated to each other by a freezing method. Agrobacterium tumefaciens strain LBA4404
(Hockman et al., Nature 303: 179-180, 1983).

Plant Material and Transformation As the tobacco variety into which the antibody gene is introduced, TMV susceptible variety BY4 and hypersensitive type F104 were used. After sterilizing tobacco leaves collected from a greenhouse with ethyl alcohol and sodium hypochlorite, the diameter of the leaves was about 6
mm leaf discs were prepared. Agrobacterium tumefaciens LBA4404 into which the leaf fragment and a vector to which both H chain and L chain genes were ligated were introduced, and about 10 ⁸ cells were prepared from a liquid consisting of Linsmaier and Skoog's inorganic salts and 30 g / l sucrose. Co-culture was performed for 48 hours in the medium. After that, the leaf pieces were washed with sterile water to remove bacteria, and then Lins
Inorganic acetic acid salt of maier and Skoog, indoleacetic acid 0.3 mg /
l, 6- (γ, γ-dimethylallylamino) purine 10 mg /
l, kanamycin 200mg / l, cefotaxime 250mg / l and 0.9% agar were placed on the foliage differentiation medium, and about 1 month later, the foliage showing kanamycin resistance was treated with Linsmaier and Sko.
og inorganic salts, 30 g / l sucrose and cefotaxime 25
It was placed in a rooting medium containing 0 mg / l and 0.9% agar. After about 1 month of culturing, the rooted plants were cultivated in a closed greenhouse.

MRN of TMV antibody gene by Northern analysis
Confirmation of A transcription Total RNA was extracted from leaves of the transformant, denatured with glyoxal and DMSO, and then separated by agarose gel electrophoresis. Next, transfer RNA to nylon membrane and
Northern analysis was carried out using a probe labeled with ³² P for each of the gene 1.4 kb and the LM gene 0.7 Kb by the random prime method. When the LM gene was used as a probe, transcription of 1.0 kb mRNA was observed in all the transformants, which was in agreement with the predicted size of mRNA transcribed from the L chain gene. No such transcription of mRNA was observed in the tobacco used as a control. On the other hand, when the HM gene was used as a probe, transcription of 1.7 kb mRNA was observed in all the transformants, which was in agreement with the predicted size of mRNA transcribed from the H chain gene. In addition, no such transcription of mRNA was observed in the tobacco used as a control. From the above results, it was revealed that mRNA of both chain genes was transcribed in all transformants regardless of the presence or absence of the leader sequence.

Confirmation of H-chain and L-chain protein association by Western analysis Western analysis was performed on individuals whose mRNA transcription was confirmed by Northern analysis. Total protein was extracted from the leaves of the redifferentiated plant, denatured by boiling in 4M urea, 1% SDS, and 2mM DTT solution, and then SDS-PAGE.
Separated by. Next, the protein was transferred to a nitrocellulose membrane by semi-dry blotting and analyzed using alkaline phosphatase-labeled goat anti-mouse IgG. As a result, in the transformant having the leader sequence, H chain and L chain bands were observed as in the control mouse IgG, and it was revealed that both chain proteins were produced. On the other hand, such a band was not observed in the transformants lacking the leader sequence, and it was considered that the proteins of both chains were not produced in these individuals. In addition, the production of such protein was not observed in the tobacco used as a control. In the subsequent experiments, transformants containing a leader sequence were tested.

Purification of TMV antibody by Protein A and confirmation of H chain and L chain association by Western analysis Protein A binds specifically to the H chain and Fc sites of immunoglobulin G (IgG) and is used for purification of various monoclonal antibodies. It's being used. Utilizing this specific binding property, Protein A
The protein was purified by the method described above, and it was examined whether the H chain and the L chain were associated as an antibody molecule in the plant. First, the protein was purified with Protein A, then the purified protein was denatured and subjected to Western analysis using the method described above. It is considered that, if they are associated with each other as an antibody molecule, bands of both chains are detected in Western analysis, but if they are not associated, bands of only H chain are detected. Although a difference in the expression level was observed in all the tested transformants of the present generation, H chain and L chain bands similar to those of the control mouse IgG were detected.
As a result, it was revealed that both chains produced by the transformant were associated as an antibody molecule. Next, the expression level of the produced antibody was investigated. As a result of measurement with a densitometer, it was confirmed that 0.8% of the total soluble protein in the leaves was high in the individuals with high expression level and 0.2% in the low expression individuals with this antibody.

Investigation of binding between TMV antibody produced in plant and TMV which is antigen by ELISA method The binding of antibody and antigen was investigated by ELISA method. This technique is an application of the solid phase antibody binding assay (SABA) method used for screening monoclonal antibodies. TMV or TMV coat protein was adsorbed on a microplate, PBST containing 3% BSA was added to perform a block treatment, and then the crude extract of the transformant was reacted. Three
After washing with PBST containing% BSA, the mixture was reacted with alkaline phosphatase-labeled mouse IgG, a substrate was added, and color development and absorbance values were investigated. If the antibody molecule and the antigen are bound to each other, the antigen, the antibody and the labeled antibody bind to each other and color development is observed. Coloring will not be recognized. The TMV coat protein was isolated and purified and used as an antigen together with TMV particles. The adsorbed antigen was reacted with the crude extract of the BY4 strain of the first generation of transformant and the F104 strain of the transformant, and alkaline phosphatase-labeled mouse IgG was added. All of the above experiments were conducted in a cold room. The results are shown in Table 4, together with the results of the Western analysis of the first generation of selfing.
5 shows. Color development was observed in all the transformants tested, regardless of whether TMV particles or coat protein was used as the antigen, and BY4 and F10 were used as controls.
Since no color development was observed in 4, it was revealed that the antibody produced in the transformant binds to the antigen. In addition, the difference in the individual absorbance values of the transformants almost corresponded to the high and low expression levels by Western analysis.

[0077]

[Table 4] ++: High, ++: Moderate, +: Low, −: Expression, no color development *: The measured value shows absorption of OD ₄₀₅ .

[0078]

[Table 5] ++: High, ++: Moderate, +: Low,-: Expression, no luminescence *: The measured value shows absorption of OD ₄₀₅ .

[0079]

INDUSTRIAL APPLICABILITY According to the present invention, a plant which produces a monoclonal antibody derived from an animal having a virus as an antigen, which has high practical value, was provided for the first time. According to the present invention, if molecular agriculture (biofarm) is performed, it is considered that a large amount of antiviral antibodies for pharmaceuticals, veterinary medicines, diagnostic agents, etc. can be obtained at a low production cost. Further, according to the present invention,
It is also possible to obtain virus-resistant plants.

[Sequence list]

SEQ ID NO: 1 Sequence length: 961 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to mRNA sequence ACTACTCAAG ACTTTTTGTA TCAAGTTCTC AGA ATG AGG TGC CTA GCT GAG TTC 54 Met Arg Cys Leu Ala Glu Phe -20- 15 CTG GGG CTG CTT GTG CTC TGG ATC CTT GGA GCC ATT GGG GAT ATT GTG 102 Leu Gly Leu Leu Val Leu Trp Ile Leu Gly Ala Ile Gly Asp Ile Val -10 -5 -1 1 ATG ACT CAG GCT GCA CCC TCT ATA CCT GTC ACT CTT GGA GAG TCA GTA 150 Met Thr Gln Ala Ala Pro Ser Ile Pro Val Thr Leu Gly Glu Ser Val 5 10 15 TCC ATC TCC TGC AGG TCT AGT AAG AGT CTC CTG CAT AGT AAT GGC AAC 198 Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser Asn Gly Asn 20 25 30 35 GCT TTC TTG TAT TGG TTC CTA CAG AGG CTA GGC CAG TCT CCT CAG CTC 246 Ala Phe Leu Tyr Trp Phe Leu Gln Arg Leu Gly Gln Ser Pro Gln Leu 40 45 50 CTG ATA TAT CGG ATA TCC AAC CCT GCC TCA GGT AGT CCA GAC AGG TTC 294 Leu Ile Tyr Arg Ile Ser Asn Pro Ala Ser Gly Ser Pro Asp Arg Phe 55 60 65 AGT GGC AGT GGG TCA GGA ACT GCT TTC ACA CTG AGA ATC AGT AGA GTG 342 Ser Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg Ile Ser Arg Val 70 75 80 GAG GCT GAG GAT GTG GGT GTT TAT TAC TGT ATG CAA CAT CTA GAA TAT 390 Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln His Leu Glu Tyr 85 90 95 CCT TTC ACG TTC GAC TCG GGG ACA AAG TTG GAA ATA AAA CGG GCT GAT 438 Pro Phe Thr Phe Asp Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp 100 105 110 115 GCT GCA CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG CAG TTA ACA 486 Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr 120 125 130 TCT GGA GGT GCC TCA GTC GTG TGC TTC TTG AAC AAC TTC TAC CCC AAA 534 Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys 135 140 145 GAC ATC AAT GTC AAG TGG AAG ATT GAT GGC AGT GAA CGA CAA AAT GGC 582 Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly 150 155 160 GTC CTG AAC AGT TGG ACT GAT CAG GAC AGC AAA GAC AGC ACC TAC AGC 630 Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser 165 170 175 ATG AGC AGC ACC CTC ACG TTG ACC AAG GAC GAG T AT GAA CGA CAT AAC 678 Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn 180 185 190 195 AGC TAT ACC TGT GAG GCC ACT CAC AAG ACA TCA ACT TCA CCC ATT GTC 726 Ser Tyr Thr Cys Glu Ala Thr Thr His Lys Thr Ser Thr Ser Pro Ile Val 200 205 210 AAG AGC TTC AAC AGG AAT GAG TGT TAGAGACAAA GGTCCTGAGA CGCCACCACC 780 Lys Ser Phe Asn Arg Asn Glu Cys 215 AGCTCCCCAG CCTCTCTCTCTCTCTCTCTCCCTCCACTCCCCTCCACAACCCTCTCA CAACCAGCTAC CATCCCTTCCA CACAAGGTAC AAATATTCAA TAAAGTGAGT CTTTGCACTT 960 G 961 SEQ ID NO: 2 Sequence length: 1553 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to mRNA sequence GGACCGCATA TGATCAGTAA CCTCTTCACA GTCACTGAAA ACACTGACTC TAATC ATG 58 Met GAA TGT CTT TACT TTT ATT CTG TCA GTA ACT TCA GGT GTC 106 Glu Cys Asn Trp Ile Leu Pro Phe Ile Leu Ser Val Thr Ser Gly Val -15 -10 -5 TAC TCA CAG GTT CAG CTC CAG CAG TCT GGG GCT GAG CTG GCA AGA CCT 154 Tyr Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro -1 1 5 10 GGG GCT TCA GTG AAG TTG TCC TGC AAG GCT TCT GGC TAC ACC TTT ACT 202 Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 15 20 25 30 AGC TAC TGG ATG CAG TGG GTA AAA CAG AGG CCT GGA CAG GGT CTG GAA 250 Ser Tyr Trp Met Gln Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu 35 40 45 TGG ATT GGG GCT ATT TAT CCT GGA AAT GGT GAT ACT AGG TAC ACT CAG 298 Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Arg Tyr Thr Gln 50 55 60 AAG TTC AAG GGC AAG GCC ACA TTG ACT GCA GAT AAA TCC TCC AGC ACA 346 Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr 65 70 75 GCC TAC ATG CAA CTC AGC GCC TTG GCA TCT GAG GAC TCT GCG GTC TAT 394 Ala Tyr Met Gln Leu Ser Ala Leu Ala Ser Glu Asp Ser Ala Val Tyr 80 85 90 TAC TGT GCA AGA GAG GGG GGT TAC TCC TGG TCC GAC TAT GCT ATG GAC 442 Tyr Cys Ala Arg Glu Gly Gly Tyr Ser Trp Ser Asp Tyr Ala Met Asp 95 100 105 110 TAC TGG GGT CAA GGA ACC TCA GTC ACC GTC TCC TCA GCC AAA ACG ACA 490 Tyr Trp Gly Gl n Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr 115 120 125 CCC CCA TCT GTC TAT CCA CTG GCC CCT GGA TCT GCT GCC CAA ACT AAC 538 Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn 130 135 140 TCC ATG GTG ACC CTG GGA TGC CTG GTC AAG GGC TAT TTC CCT GAG CCA 586 Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro 145 150 155 GTG ACA GTG ACC TGG AAC TCT GGA TCC CTG TCC AGC GGT GTG CAC ACC 634 Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr 160 165 170 TTC CCA GCT GTC CTG CAG TCT GAC CTC TAC ACT CTG AGC AGC TCA GTG 682 Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val 175 180 185 190 ACT GTC CCC TCC AGC CCT CGG CCC AGC GAG ACC GTC ACC TGC AAC GTT 730 Thr Val Pro Ser Ser Pro Arg Pro Ser Glu Thr Val Thr Cys Asn Val 195 200 205 GCC CAC CCG GCC AGC AGC ACC AAG GTG GAC AAG AAA ATT GTG CCC AGG 778 Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg 210 215 220 GAT TGT GGT TGT AAG CCT TGC ATA TGT ACA GTC CCA GAA GTA TCA TCT 826 As p Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser 225 230 235 GTC TTC ATC TTC CCC CCA AAG CCC AAG GAT GTG CTC ACC ATT ACT CTG 874 Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu 240 245 250 ACT CCT AAG GTC ACG TGT GTT GTG GTA GAC ATC AGC AAG GAT GAT CCC 922 Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro 255 260 265 270 GAG GTC CAG TTC AGC TGG TTT GTA GAT GAT GTG GAG GTG CAC ACA GCT 970 Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala 275 280 285 CAG ACG CAA CCC CGG GAG GAG CAG TTC AAC AGC ACT TTC CGC TCA GTC 1018 Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val 290 295 300 AGT GAA CTT CCC ATC ATG CAC CAG GAC TGG CTC AAT GGC AAG GAG TTC 1066 Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe 305 310 315 AAA TGC AGG GTC AAC AGT GCA GCT TTC CCT GCC CCC ATC GAG AAA ACC 1114 Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr 320 325 330 ATC TCC AAA ACC AAA GGC AGA CCG AAG GCT CCA CAG GTG TAC ACC ATT 1162 Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile 335 340 345 350 CCA CCT CCC AAG GAG CAG ATG GCC AAG GAT AAA GTC AGT CTG ACC TGC 1210 Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys 355 360 365 ATG ATA ACA GAC TTC TTC CCT GAA GAC ATT ACT GTG GAG TGG CAG TGG 1258 Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp 370 375 380 AAT GGG CAG CCA GCG GAG AAC TAC AAG AAC ACT CAG CCC ATC ATG AAC 1306 Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asn 385 390 395 ACG AAT GGC TCT TAC TTC GTC TAC AGC AAG CTC AAT GTG CAG AAG AGC 1354 Thr Asn Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser 400 405 410 AAC TGG GAG GCA GGA AAT ACT TTC ACC TGC TCT GTG TTA CAT GAG GGC 1402 Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly 415 420 425 430 CTG CAC AAC CAC CAT ACT GAG AAG AGC CTC TCC CAC TCT CCT GGT AAA 1450 Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys 435 440 445 TGATCCCAGT GTCCTTGGAG CCCTCTGGTC CTACAGGACT CTGACACCTA CCTCCACCCC 1510 TCCCTGTATA AATAAAGCAC CCAGCACTGC CTTGGGACCC TGC 1553

[Brief description of drawings]

FIG. 1 is a diagram showing a method for purifying a P-7 monoclonal antibody.

FIG. 2 is a diagram showing a method for separating an L chain and an H chain of a P-7 monoclonal antibody.

FIG. 3 is a restriction enzyme map of L chain cDNA clones and H chain cDNA clones prepared in Examples.

FIG. 4 shows a restriction map of the H chain cDNA clone prepared in Example and a restriction map of the H chain cDNA shown in the literature.

FIG. 5 is a restriction enzyme map of the H chain cDNA clone prepared in Example.

FIG. 6 shows the nucleotide sequence of L chain cDNA obtained in the example and the amino acid sequence encoded thereby.

FIG. 7 is a diagram showing a continuation of the array shown in FIG. 6;

FIG. 8 shows the nucleotide sequence of H chain cDNA obtained in the example and the amino acid sequence encoded thereby.

9 is a diagram showing a continuation of the arrangement shown in FIG.

FIG. 10 is a view showing a sequel to the arrangement shown in FIG. 9;

FIG. 11 is a diagram showing restriction enzyme sites in the multi-cloning portion of each vector used in Examples.

FIG. 12: L chain leader sequence-containing c prepared in Example
It is a figure which shows the manufacturing method of DNA.

FIG. 13 is a view showing a partial base sequence of each recombinant vector prepared in the example.

FIG. 14 is a gene map of a recombinant vector in which L chain cDNA or H chain cDNA is incorporated into Ti plasmid vector pGA643.

FIG. 15 is a diagram showing a method for constructing a vector in which an L chain gene and an H chain gene are linked.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 21, 1993

[Procedure Amendment 2]

[Document name to be amended] Statement

[Name of item to be amended] Title of invention

[Correction method] Change

[Correction content]

Title: Plant producing antiviral antibody and method for producing the same

Front Page Continuation (72) Inventor Takashi Kamishiro 700 Tobara, Toyota-cho, Iwata-gun, Shizuoka Japan Tobacco Inc. Breeding Research Institute (72) Inventor Yoshiaki Murafuji 1-12-39 Umeda, Kita-ku, Osaka-shi, Osaka Within the company Kuraray (72) Inventor Masaaki Takami 1-12-39 Umeda, Kita-ku, Osaka City, Osaka Prefecture Kuraray Within (72) Inventor Masayasu Fumino 1-12-39 Umeda, Kita-ku, Osaka City, Osaka Prefecture Kuraray

Claims (8)

[Claims] 1. A plant producing an animal-derived antiviral monoclonal antibody. 2. The plant according to claim 1, wherein the virus is tobacco mosaic virus. 3. The plant according to claim 1, which is tobacco. 4. A step of establishing a hybridoma producing a monoclonal antibody against a desired virus, a step of preparing cDNA from the hybridoma, and the cDNA.
Selecting a cDNA encoding the H chain and L chain of the monoclonal antibody from A, incorporating the cDNA into a plant expression vector, transforming a desired plant with the plant expression vector, and transforming Including the step of selecting a plant that produces the desired antibody from the plant after the step,
The method for producing a plant according to claim 1. 5. The method of claim 4, wherein the virus is tobacco mosaic virus. 6. The plant according to claim 4, wherein the plant is tobacco.
The method described. 7. The plant expression vector is a Ti plasmid type vector, and in the transforming step, the Ti plasmid type recombinant vector is incorporated into Agrobacterium tumefaciens, and then the plant is infected with the Agrobacterium tumefaciens. The method according to any one of claims 4 to 6, which is performed by 8. A cDNA encoding the H chain and L chain
Have respective leader sequences.
The method according to any one of 1.