JPH0627104A - Method and apparatus for detecting double-stranded nucleic acid - Google Patents

Abstract

PURPOSE:To provide an easy and efficient method for detecting double-stranded nucleic acid regarding amplification and production and an easy and efficient method for detecting varied nucleic acid and to obtain a detecting apparatus used for these methods. CONSTITUTION:A method for detecting double-stranded nuclei acid selectively produced by reaction comprises steps of adding marker reagent for exciting a specific reaction on a part where the double-stranded nucleic acid is formed to reactant solution in a reaction vessel where reaction occurs, sensing excitation of the specific reaction and detecting a production state of the double-stranded nucleic acid in the reactant solution. A fluorescent detector used for the method for detecting a nucleic acid sample senses relatively low temperature dissociation of pairing of a DNA chain having gene variation and a DNA chain having an inherent sequence using marker reagent.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a novel nucleic acid detection method and fluorescence detection device.

[0002]

[Prior art]

(1) In recent years, the polymerase chain reaction method (polymerase chai
n reaction: PCR method) has been developed one after another to facilitate the analysis of genes and cloning of specific genes, and such methods make a great contribution to the industry. .

By the way, for example, in order to amplify or generate a specific gene by the PCR method and detect the specific gene, a part of the DNA solution in the reaction vessel is sampled and subjected to electrophoresis in agarose gel or acrylamide gel. Perform molecular weight separation to read the separation pattern and ethidium bromide staining colorimetric assay (Molecular Cloning, A
Laboratory Manual, vol.2 E.5 to E.7) is usually used.

However, all of these methods use D
After the completion of the NA amplification or production reaction, it is necessary to take out a sample separately from the reaction vessel to detect the target DNA for amplification or production, and it often takes time for the checking work. If the target gene is not amplified or produced, not only the check time but also the reaction time for amplification or production is wasted, which causes a reduction in overall work efficiency.

(2) Apart from this, recent advances in genetic engineering have revealed that mutations of specific genes cause specific diseases one after another. Therefore, by detecting the mutation of such a gene, it is possible to prevent or diagnose the above-mentioned diseases, but the present situation is that the technology for detecting the mutation of the gene does not always correspond to biological discovery.

[0006]

SUMMARY OF THE INVENTION The problems to be solved by the present invention are therefore a simple and efficient method for detecting double-stranded nucleic acids involved in amplification or production, and a simple and reliable method for detecting mutated nucleic acids. Is in the establishment of.

[0007]

Means for Solving the Problems As a result of extensive studies on the above-mentioned problems, the present inventor has used a labeling reagent that excites a specific reaction at the formation portion of a double-stranded nucleic acid, and Double-stranded nucleic acid can be detected in the process of proliferation or generation, and the double-stranded nucleic acid of the labeling reagent has a condition of extinguishing the reaction, which includes a completely complementary double-stranded nucleic acid and a non-complementary portion. It has been found that the above problem can be solved by utilizing the property that the double-stranded nucleic acid is different.

That is, the first aspect of the present invention is a method for detecting a double-stranded nucleic acid selectively produced by a reaction, which comprises forming a double-stranded nucleic acid in a reaction solution in a reaction vessel for carrying out the reaction. A double-stranded nucleic acid characterized by adding a labeling reagent that excites a specific reaction at a part, detecting the excitation of the specific reaction, and detecting the production state of the double-stranded nucleic acid in the reaction solution. The second is a double-stranded nucleic acid obtained by pairing a single-stranded nucleic acid as a sample and a single-stranded nucleic acid probe complementary to the base sequence originally possessed by the single-stranded nucleic acid. To
Labeling with a labeling reagent that excites a specific reaction at the formation portion of the double-stranded nucleic acid, the double-stranded nucleic acid labeled body is dissociated by an increase in temperature, and the dissociation temperature is detected by the disappearance of the specific reaction. And a method for detecting a nucleic acid sample, which comprises comparing with a dissociation temperature of a double-stranded nucleic acid in which the complementary DNA strand is paired with the nucleic acid probe, and the third is a method for performing the two detection methods. It is a fluorescence detection device. A. First, the method for detecting the growth / production state of a double-stranded nucleic acid, which is the first invention of the present application, will be described in detail.

(1) The method is carried out in a method for detecting double-stranded nucleic acid selectively produced by the reaction. The detection method is not particularly limited as long as it is a detection method performed in vitro (in vitro), and for example, a polymerase chain reaction method (PCR) is used.
Method) (Science, vol.239, p487-491, 1988), Sequencing method (Molecular Cloning, A Laboratory Manual, 13
・ 3 ～ 13 ・ 102, second edition), Hybridization method
(Molecular Cloning, A Laboratory Manual, 11 ・ 3〜1
1 ・ 58, second edition) etc., but DN with two kinds of primers sandwiching a specific DNA region
The PCR method, which is a method of specifically amplifying the specific DNA region by repeating the A synthesis reaction, can be mentioned as a particularly preferable detection method.

(2) In addition, the method involves adding a labeling reagent that excites a specific reaction at the formation portion of the double-stranded nucleic acid, to the reaction solution in the reaction vessel in which the above reaction is carried out. It is necessary to detect the excitation of the reaction and detect the production state of the double-stranded nucleic acid in the reaction solution. The labeling reagent used in the method for exciting a specific reaction in the double-stranded nucleic acid forming portion is not particularly limited as long as it is a labeling reagent having the property. Here, the excitation of a specific reaction includes the occurrence of a specific reaction in the forming portion of the double-stranded nucleic acid, the increase of the reaction intensity, as well as the disappearance of the reaction or the decrease of the reaction intensity.

As a typical example of the labeled drug, fluorescence emitted from a double-stranded nucleic acid such as ethidium bromide, thiazole orange and ethidium homodimer which is labeled is different from fluorescence emitted from a single-stranded nucleic acid which is labeled. A dye can be mentioned. Further, in consideration of detection of a pure amount of double-stranded nucleic acid, ethidium bromide or thiazole orange can be exemplified as a preferable one among the above dyes.

Next, it is necessary to add the labeling reagent to the reaction solution in the reaction container. The content of the reaction solution is appropriately determined according to the type of reaction for producing or producing double-stranded nucleic acid. For example, in the case of PCR method, single-stranded DN as a template is used.
A buffer solution containing A, a DNA synthesis substrate, a PCR primer, and a synthetic enzyme. The timing of adding the labeling dye is not particularly limited as long as it is directly added to the reaction vessel. That is, the timing of addition may be before or after the completion of the production or proliferation reaction, but when the production or proliferation process of a specific double-stranded DNA is to be detected over time from the initial stage of the reaction, It is necessary to add it before the end. Further, the addition before the completion of the reaction is preferably performed in the initial stage of the double-stranded nucleic acid generation or growth reaction, that is, before the addition of the reaction solution to the reaction vessel, at the same time as the addition of the reaction solution, or immediately after the addition of the reaction solution. .

The shape, structure, etc. of the reaction vessel are not particularly limited as long as the excitation of the specific reaction can be detected, but a fluorescence detection device dedicated to the detection of the specific reaction described below is preferably used. Considering this, the reaction container used in the detection device is preferable.
The means for detecting the specific reaction can also be selected according to the type of the specific reaction. For example, in the case where the labeling reagent is a fluorescent dye that emits fluorescence differently when the double-stranded nucleic acid is labeled and fluorescence emitted when the single-stranded nucleic acid is labeled, the fluorescent dye has a property of emitting fluorescence upon irradiation. It is possible to adopt a method in which the reaction sample in the reaction container is irradiated with light, the fluorescence obtained from the sample is detected, and the increase or decrease in the amount of fluorescence due to double-stranded nucleic acid generation or proliferation is measured. For example, when the fluorescent dye is ethidium bromide, it is 260-500 nm.
For example, ethidium homodimer is irradiated with 260 nm UV and then 620 nm is irradiated with fluorescence, and thiazole orange is irradiated with 488 nm argon laser. The fluorescence having a peak around 530 nm can be detected.

FIG. 1 shows an example of the above-described method of the present invention. Double-stranded DNA is synthesized by using single-stranded DNA1 as a template and a substrate (A ...
(Adenine, C ... cytosine, G ... guanine, T ... thymine)
2, a short single-stranded DNA primer 3 as a starting point of synthesis, and a thermostable synthase 4 are mixed in an appropriate buffer solution. To this, a labeling dye 5 whose emission intensity upon irradiation with excitation light increases when it enters the double-stranded DNA, and the temperature is adjusted to perform a synthetic reaction. A labeling dye is incorporated into the synthesized double-stranded DNA to form a double-stranded synthetic DNA.
And a dye complex 6 is formed. The DNA solution in which the reaction has been completed is irradiated with, for example, ultraviolet rays to give double-stranded DNA.
By measuring the increase in the fluorescence intensity emitted by the labeling dye incorporated into the, the formation state of the double strand can be confirmed.
B. Next, the method for detecting a gene mutation, which is the second invention of the present application, will be described in detail.

According to the method, the denaturation temperature of a double-stranded nucleic acid having a completely complementary bond and the double-stranded nucleic acid having a non-complementary portion partially differ in denaturation temperature to a single-stranded nucleic acid by heating. Focusing on this, it is a method capable of easily detecting a mutation of a gene by utilizing the property of the labeling reagent used in the first invention of the present application A above. (1) In this, a single-stranded nucleic acid as a sample, which is labeled with a labeling reagent that excites a specific reaction in the formation portion of the double-stranded nucleic acid, and is complementary to the base sequence originally possessed by the single-stranded nucleic acid It is premised on the existence of a double-stranded nucleic acid obtained by pairing with a certain single-stranded nucleic acid probe.

The labeling reagent that excites a specific reaction at the double-stranded nucleic acid forming portion is the same as that used in the above invention. The single-stranded nucleic acid used as a sample can be prepared by a generally known method. That is, depending on the type of gene mutation to be detected, it is extracted from, for example, white blood cells collected from human blood, and this is extracted by a generally known method such as heat denaturation method or alkali denaturation method. Degenerate into.

On the other hand, a single-stranded nucleic acid probe which is complementary to the base sequence originally possessed by the single-stranded nucleic acid as a sample can be prepared according to the type of gene mutation to be detected. That is, it can be prepared by chemically synthesizing a DNA primer based on a known DNA sequence and amplifying a specific gene by the above-mentioned PCR method, or by direct chemical synthesis. The length of such a nucleic acid probe is 12 mer or longer, preferably 100 mer or longer, which is continuous.

Then, the double-stranded DNA composed of the sample DNA and the nucleic acid probe is labeled with the labeling reagent to prepare a double-stranded nucleic acid labeled product. In addition to this, as a control, it is necessary to prepare a labeled product in which a double-stranded nucleic acid in which the nucleic acid probe and a complementary DNA strand are paired is labeled with the labeling substance.

(2) Next, the temperature of the reaction solution containing the double-stranded nucleic acid complex obtained in (1) above is raised, and denaturation of double-stranded DNA into single-stranded DNA due to the temperature rise is carried out. It can be detected by detecting the disappearance of the specific reaction of the labeling reagent. This temperature rise is performed from room temperature to about 95 ° C. with a temperature rise gradient of about 40 ° C./1 hr, preferably about 40 ° C./3 hrs. The disappearance of the specific reaction of the labeling reagent can be performed in the same manner as in the method shown in A above.

FIG. 2 shows an embodiment of the invention B described above. A single-stranded DNA 7 as a sample and a DNA primer 8 corresponding to a specific site of human DNA are paired,
To this, a labeling dye 5 whose luminescence intensity upon irradiation with excitation light increases when it enters the double-stranded DNA is added to form a double-stranded portion 9
D enhances the light emission of the labeling dye 5 at
At a certain temperature when the temperature of NA is raised,
As shown in (c), when the sample is normal and perfectly matched, the double-stranded state is maintained and the luminescence intensity does not change, whereas the sample contains an abnormal gene part. As shown in (d), the primer that is incompletely paired with the primer 8 is dissociated and the emission intensity of the labeling dye 5 is reduced. Then, by examining the change in luminescence intensity and the temperature at the time of change in luminescence intensity, it is possible to distinguish between normal and abnormal genes.

The inventor of the present invention has also created a fluorescence detecting device for the purpose of efficiently carrying out the above-mentioned method of the present invention. The fluorescence detection device is composed of a reaction container, an excitation light source for exciting the fluorescent dye, and a thermostatic chamber provided with a photodetector for detecting the fluorescence emitted by the fluorescent dye, and the fluorescence emitted by the fluorescent dye. Is detected from an angle different from the incident direction of the excitation light emitted from the excitation light source.

[0022]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited thereto.

[0023]

First Embodiment Fluorescence Detection Device of the Present Invention Hereinafter, the fluorescence detection device of the present invention will be described with reference to the drawings. FIG. 3 is a schematic view of the fluorescence detection device of the present invention. In FIG. 3, the excitation light 14 emitted from the excitation light source 13
Is incident on the reaction sample in the reaction container 11 for reaction that has been left standing in the constant temperature bath 12 through the excitation light insertion window 15 and the excitation light 14
Fluorescence generated from the reaction sample excited by the incidence of
Is emitted from a fluorescence emission window (not shown). The imaging lens 18 collects the fluorescence 17 generated from the reaction sample, and a photodetector.
It has a role to make 19 reach fluorescence. Signal processor 20
Processes the signal obtained by converting the fluorescence output from the photodetector 19, and the signal is output by the data output device 21.

The excitation light source 13 is appropriately selected according to the type of labeling dye used. For example, when ethidium bromide is selected as the labeling dye, a UV lamp (for transilluminator use) is preferably used, and when thiazole orange is selected, an 488 nm argon laser is preferably used. The thermostat 12 is not particularly limited as long as it can appropriately control the temperature in the reaction vessel 11 for reaction left inside, and examples thereof include a thermal cycler (manufactured by Perkin Elmer Cetus).

The detailed structure of the reaction container 11 for reaction is shown in FIG. The material of the reaction container 11 is not particularly limited,
It is preferable to concentrate light through the separately provided excitation light insertion window 15 and fluorescence emission window 16 in order to improve the reaction detection sensitivity, and a material having a light shielding property, for example, a metal such as aluminum or copper; It is preferable to use a light-shielding plastic such as vinyl chloride. Further, it is also possible to apply a material having a light-shielding property to a material such as glass or plastic which originally has a property of transmitting light and use it as the reaction container 11. Excitation light 14 passes through excitation light insertion window 15,
The labeling dye in the reaction sample in the reaction solution 23 is excited, and the resulting fluorescence is emitted from the fluorescence emission window 16. Materials of the excitation light insertion window 15 and the fluorescence emission window 16 are not particularly limited as long as they have good light transmittance,
Quartz, borosilicate glass, acrylic resin, or vinyl chloride resin is preferable in that it has particularly good permeability. The shape of the reaction vessel 11 is not particularly limited as long as it can achieve the intended purpose, and examples thereof include a round test tube shape and a square test tube shape. Further, it is possible to mount a ready-made test tube on a test tube holder having a window made of a light-shielding material. In addition, it is essential that the excitation light insertion window 15 and the fluorescence emission window 16 be provided in one or more locations. The excitation light insertion window 15 may be provided at one or more places. When a plurality of reaction vessels 11 are allowed to stand in the thermostat 12, it is necessary to provide at least two excitation light insertion windows 15 at symmetrical positions. The fluorescence emission window 16 can be provided depending on the number of places where fluorescence is detected, but normally one place is provided at an angle different from the entrance window of the excitation light. Here, different angles are not only on the same plane as the incident or outgoing direction of the excitation light, but also on different planes,
For example, although it can be provided in the lower part of the reaction container 11 for reaction, in consideration of a mode in which the photodetector 19 described later is movable, the excitation light insertion window 15 is on the same plane as the incidence or emission direction of the excitation light. It is preferable to provide the fluorescence emission window 16 in a direction substantially at right angles to. The material and shape of the imaging lens 18 are not particularly limited as long as they can collect the fluorescence emitted from the reaction sample. The photodetector 19 is not particularly limited as long as it can convert the fluorescence emitted from the reaction sample and collected by the imaging lens 18 into a signal that can be processed by the signal processing device 20, and for example, a two-dimensional camera. Etc. can be adopted. It is also possible to move the photodetector 19 in the direction indicated by the arrow 22, for example, and detect fluorescence from a plurality of reaction samples. In such a case, as shown in FIG. 3, the reaction vessels 11 for reaction are juxtaposed in a straight line in the thermostat 12, and the photodetector 19 is installed along the fluorescence emission window 16 provided in each reaction vessel 11 for reaction. It is preferable to move it. At this time, it is also possible to provide the imaging lens 18 for each of the reaction vessels 11 for reaction, and it is installed integrally with the photodetector 19, and the photodetector 19 and the imaging lens 18 are moved simultaneously. It is also possible to detect the fluorescence from the sample in each reaction reaction container 11. Further, it is possible to collect the light emitted from all reaction reaction vessels 11 and simultaneously detect each reaction reaction vessel 11 on the photodetector 19 composed of one multi-element. Further, the excitation light is simultaneously made incident from the side surface or the lower surface of each reaction vessel in a direction orthogonal to the emission direction of the excitation light shown in FIG. Fluorescence may be detected from the side. The type of the signal processing device 20 is not particularly limited as long as it can process the signal from the photodetector 19 as described above. The type of the output device 21 is not particularly limited as long as it can output the signal processed by the signal processing device 20 in a data processable form.

[0026]

Example 2 Identification of PCR Products Over Time Using the sample DNA and oligonucleotides below, P
The increase in CR product over time was investigated. Sample DNA; Human leukocyte DNA 1 μg Oligonucleotide: Primer A having the nucleotide sequence of SEQ ID NO: 1 Primer B having the nucleotide sequence of SEQ ID NO: 2 (1) Preparation of human leukocyte extracted DNA Human leukocyte extracted DNA is obtained from blood of a healthy person. It was prepared by a conventional method. That is, a large amount of heparin blood of a healthy person was collected, distilled water was added to this to destroy blood cells, and then 30
It was centrifuged at about 00 rpm for 5 minutes. After repeating this operation two more times, the lower layer containing white blood cells was separated, and SDS (Sodi
um Dodecyl Sulfate) in the presence of protease, and further purified by phenol-chloroform extraction and ethanol precipitation to prepare human leukocyte extracted DNA.

(2) Preparation of oligonucleotide The above-mentioned primer A and primer B were synthesized by a DNA synthesizer (ABI) and purified by HPLC. (3) Amplification of sample DNA The above human leukocyte extracted DNA and PCR primers A and B
20 pmol each, each dNTP 250 μM each, MgCl ₂
2.5mM, Tris-HCl (pH8.5) 10mM, KCl 50mM, gelatin 0.001% (w / v), ethidium bromide (Nippon Gene) 0.01-0.05% (w / v) The total volume was 100 μl. 5 units of heat-resistant DNA polymerase (manufactured by Perkin Elmer Cetus) was added to this PCR primer mixture, and mineral oil for evaporation prevention was overlaid, and the temperature was 94 ° C for 30 seconds, 50 ° C for 90 seconds, and 72 ° C for 90 seconds. The heat cycle was repeated 30 times to perform PCR amplification. Then, for each such thermal cycle, the amount of fluorescence emitted by ethidium bromide at the portion where the double-stranded DNA was formed was measured with time with the fluorescence detection apparatus shown in Example 1. In addition, as the excitation light source 14 in the fluorescence detection apparatus of Example 1, 488
nm argon laser, the excitation light insertion window 16 of the reaction container 12 for reaction, and the fluorescence emission window 17 as the material, Pyrex glass, as the photodetector 20, photomultiplier, as the signal processing device 21, HITACHI workstation 2050 / 32E and output device 22 are GRAPHTEC
XY PLOTTER was used. In addition, as the incident direction of the excitation light and the detection direction of the fluorescence, a direction substantially perpendicular to the same plane was adopted.

The results are shown in FIG. 5 (a). As a result, the fluorescence intensity draws a typical 2 ⁿ curve (n is the number of cycles),
It was revealed that the amount of fluorescence emitted by ethidium bromide increased with time at each thermal cycle. In addition, when the amplified gene was subjected to electrophoresis after the 30th thermal cycle and examined for the amplified gene, the amplification amount of the target gene and the gene amount converted from the increase in the fluorescence amount were in agreement and the method of the present invention was used in the PCR method. It has been found to be extremely useful as a method for monitoring gene amplification.

[0029]

Example 3 Assay for Gene Mutation E. coli K12 strain was inoculated into 10 ml of LB medium using a platinum loop, and this was precultured at 37 ° C., and when the logarithmic growth phase was reached, the culture was performed. 20 ml of liquid was added to nitrosoguanidine (M
NNG) (0.5 g / ml) was added. Same medium as above 100
The cells were added to the cells, and main culture was performed again at 37 ° C. overnight. afterwards,
When the cells have reached the logarithmic growth phase again, the culture solution
10 ml was again cultivated in 100 ml of the above medium containing no MNNG, and when the mutation was established in the cells, MN similar to the above was used.
NG treatment was performed. After that, the MNNG process is performed 2-3
Repeated times, to grow the surviving bacteria, collect the mutant strain, by a commonly known method such as ethanol precipitation,
DNA of the mutant strain was extracted by 100 μg.

On the other hand, the DNA of the original E. coli K12 strain was extracted by 1000 μg by a generally known method as described above. Next, each DNA was heated to 95 ° C.
After denaturation to A, 1 μg each of the E. coli K12 strain single-stranded DNA solution and the mutant single-stranded DNA solution were allowed to stand at room temperature in the presence of ethidium bromide 0.01% (w / v). Hybridization was performed. On the other hand, due to the thermal denaturation of the culture amount used for the above-mentioned hybridization reaction.
0.01% (w / v) of ethidium bromide was added to a single-stranded DNA solution of E. coli K12 strain, and the mixture was allowed to stand at room temperature for hybridization reaction.

Furthermore, using the fluorescence detection apparatus used in Example 2, the detection of the amount of fluorescence emitted by ethidium bromide upon heat treatment of the ethidium bromide-labeled double-stranded DNA obtained above was specified. . The result is shown in FIG. In the reaction system of mutated DNA,
The fluorescence intensity started to decrease at a relatively low temperature of about 60 ° C, then gradually decreased, and the end of the dissociation reaction was recognized at around 95 ° C. On the other hand, in a normal DNA reaction system, a decrease in fluorescence intensity started at around 75 ° C., a sharp decrease curve was drawn, and the end of the dissociation reaction was recognized at around 95 ° C.

From these results, it was found that normal DNA and mutated DNA can be distinguished and judged, that is, this method is useful as a gene diagnostic method.

[0033]

INDUSTRIAL APPLICABILITY The present invention enables simple and efficient detection of double-stranded nucleic acid involved in amplification or production, and simple and reliable detection of mutated nucleic acid.

[0034]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other sequence Synthetic DNA primer Sequence: ATGCTAAGTTTAGCTTTACAG SEQ ID NO: 2 Sequence Length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other sequence Synthetic DNA primer Sequence: ACAGTTTCATGCCCATCGTC

[Brief description of drawings]

FIG. 1 is a schematic diagram of a method for detecting the production state of double-stranded nucleic acid in a DNA synthesis reaction according to the present invention.

FIG. 2 is a schematic diagram of a method for detecting the dissociation state of a double-stranded nucleic acid according to the present invention by applying a temperature change.

FIG. 3 is a sketch including a block diagram showing the configuration of a double-stranded nucleic acid detection device according to the present invention.

FIG. 4 is a front view and a side view of a reaction container used in the double-stranded nucleic acid detection device of the present invention.

FIG. 5 is a diagram showing the results of Example 2 and Example 3.

Continuation of the front page (72) Inventor Katsuji Murakawa 1-280, Higashi Koikekubo, Kokubunji, Tokyo Inside the Central Research Laboratory, Hitachi, Ltd.

Claims (7)

[Claims] 1. A method for detecting a double-stranded nucleic acid selectively produced by a reaction, which comprises a specific reaction at a double-stranded nucleic acid forming portion in a reaction solution in a reaction vessel for carrying out the reaction. A method for detecting a double-stranded nucleic acid, comprising adding a labeling reagent for exciting a specific reaction to detect the excitation of the specific reaction, and detecting the generation state of the double-stranded nucleic acid in the reaction solution. 2. At least before the end of the amplification or dissociation reaction, a labeling reagent that excites a specific reaction in the double-stranded nucleic acid-forming portion is added, and the excitation of the specific reaction is detected with time. The method for detecting double-stranded nucleic acid according to claim 1, wherein 3. A method for producing a double-stranded nucleic acid, which comprises using a specific DNA
The method for detecting a double-stranded nucleic acid according to claim 1, which is a method of specifically amplifying a specific DNA region by repeating a DNA synthesis reaction with two types of primers sandwiching the region. 4. A double-stranded nucleic acid, which is obtained by pairing a single-stranded nucleic acid serving as a sample and a single-stranded nucleic acid probe complementary to a base sequence originally possessed by the single-stranded nucleic acid. Labeled with a labeling reagent that excites a specific reaction at the nucleic acid forming part,
The double-stranded nucleic acid label is dissociated by increasing the temperature,
The dissociation temperature is detected by the disappearance of the specific reaction,
A method for detecting a nucleic acid sample, which comprises comparing with a dissociation temperature of a double-stranded nucleic acid in which the nucleic acid probe is paired with a complementary DNA strand. 5. A labeling reagent that excites a specific reaction in a portion where a double-stranded nucleic acid is formed has different fluorescence emitted from a double-stranded nucleic acid labeled and a fluorescence emitted from a single-stranded nucleic acid labeled. It is a fluorescent dye, The detection method of Claim 1, Claim 2, Claim 3, or Claim 4 characterized by the above-mentioned. 6. A thermostat comprising a reaction container, an excitation light source for exciting a fluorescent dye, and a photodetector for detecting the fluorescence emitted by the fluorescent dye. A fluorescence detection device, which detects from an angle different from an incident direction of excitation light emitted from the excitation light source. 7. The fluorescence detection device according to claim 6, wherein the reaction container is provided with an entrance window for entering the excitation light from the excitation light source and an exit window for emitting the fluorescence emitted by the fluorescent dye.