JPH062064B2 - Novel DNA strand - Google Patents

Description

TECHNICAL FIELD The present invention relates to a DNA strand having a promoter function. More specifically, the present invention relates to a DNA chain derived from a gene encoding the intermediate subunit A ₂ B _1a of glycinin, which is a soybean seed storage protein, and a DNA chain having a nucleotide sequence substantially homologous thereto.

[Prior Art and Problems to be Solved by the Invention] In recent years, attention has been paid to studies on biosynthesis, amino acid sequence, processing, etc. of seed storage proteins.

Most soybean seed storage proteins are salt-soluble globulins, which make up 70-80% of the total protein in ripe seeds. Ultracentrifugation treatment of this glyburin resulted in 7
It is divided into s-component conglycinin and 11s-component glycinin. Glycinin has a molecular weight of 3.6 × 10 ⁵ , 6 acidic subunits (A) group (A _1a , A _1b , A ₂ , A ₃ , A ₄ , A ₅ ) and ₅ basic subunits (B) group (B _1a , B _1b , B ₂ , B ₃ , B ₄ ) and 5 subunits (A _1a B ₂ , A _A1b B _1b , A ₂ B _1a , A ₃ B ₄₎ , A ₅ A ₄
It is composed of a hexamer of B ₃ ) and is present in the protein body (protein granule) in the cotyledon cells of seeds.

Studies on the biosynthesis of glycinin proteins show that
The glycinin protein is translated as a glycinin precursor protein linked from the N-terminal side in the order of signal peptide-acidic subunit-basic subunit. The signal peptide part of this precursor is the endoplasmic reticulum,
The resulting polypeptide, which is composed of acidic subunits and basic subunits, is further cleaved into individual subunits to form an intermediate subunit in which both units are disulfide-bonded.

The present inventor has previously cloned 5 types of cDNAs encoding glycinin precursor proteins and analyzed the nucleotide sequences to clarify the amino acid sequence of each intermediate subunit of glycinin.

Since each gene encoding the glycinin precursor protein is rapidly and extremely strongly expressed during the ripening stage of seeds, the promoter controlling the transcription of these genes is used in gene recombination technology in host cells. ,
In particular, it is expected to be effectively used when a foreign gene is introduced into a plant cell and it is strongly expressed, but so far no reports have been found regarding these promoters.

[Means for Solving Problems] In the present invention, a gene encoding A ₂ B _1a, which has a high expression level among the gene groups of 5 kinds of intermediate subunits constituting glycinin, is obtained from a soybean chromosomal library. It was completed by cloning and specifying the promoter portion.

That is, the present invention has a promoter function and
It is a DNA chain characterized by having the base sequence shown in.

Table 1 5'-ATATACAGTACAAATTATTCTCTACTAATCTTTATGATATG TAAACCAAAGCATGATTAATTATTTCCTAATTAAATTAAAAAAA ATTGAGTAACTAGTATCACATAAAGATCTGTCAAAACCATGAAT AGTGATAATTTCATAACACCTAATAATTTCTCTATCCCTAGAGT GAGGTCATTTTTGGACGGCCCTTCTTCTCACTTTGAGGATCCCA TCATTGTCACACGGTGTATTCATATAATTTCATATGTCATAAAC CCGCGAACATGAAATGAAACCATGGTCCCCCTCTCCACCACCGT TTTCTGGCAATTGCATGCAATACAAACACACTTGGTATTTGTCA CATAATGTTGATGTCGAACTGTCGAAGCCACCTCACACCCATGA ACTTAATGAGGTGTAACACACAAGGCTTCCATAGCCATGCATAC TGAAGAATGTCTCAAGCTCAGCACCCCACTCCTGTGACGTGTCC CTCACCCACCTTCCTCTCTTCCCTATAAATAACCACGCCTCAGG TTCTCCGCTT-3 'DNA strand of the present invention has a promoter function, and a DNA strand which is characterized by having the nucleotide sequence shown in Table 1 is there.
The term "DNA strand" as used herein means a complementary double strand of polydeoxyribonucleic acid having a certain length, and in the claims and Table 1, this DNA strand is one complementary strand. Needless to say, the description is omitted. Further, the “promoter function” refers to a signal function for initiating transcription of DNA to RNA.

Further, the DNA chain of the present invention basically has a base sequence of 53S base pairs shown in Table 1, but as long as it has a promoter function, it has at least a part of the base sequence or is substantially the same. It also includes those having a homologous base sequence. The term “substantially homologous base sequence” means that some base sequences may have deletions, substitutions, additions, etc. as long as they have a promoter function.

The DNA chain of the present invention can be obtained by any purposeful method such as a chemical synthesis method or cloning from a soybean chromosomal gene library.

From the soybean chromosomal gene library, the present inventor
The gene encoding the intermediate subunit A ₂ B _1a of glycinin was obtained by screening using its cDNA as a probe (see Examples below).
It was as shown in the figure.

That is, the gene of the intermediate subunit A ₂ B _1a is composed of 3 introns and 4 exons, and encodes the intermediate subunit precursor of glycinin A ₂ B _1a consisting of 485 amino acids. . In Fig. 1, the fractions of ~ are signal peptides and the fractions of ~ are A ₂
It encodes the intermediate subunit of B _1a , and this intermediate subunit is It is cleaved into a _5'side A ₂ subunit and a _3'side B _1a subunit at the site indicated by. Moreover, it is confirmed by SI mapping that the fractions of ~ are transcribed to mRNA. The fractions of ~ are the DNA strands of the present invention, and this base sequence contains TATAbox, which is a constituent of the eukaryotic promoter.

[Examples] Next, the present invention will be described in detail with reference to Examples.

Example 1 Preparation of soybean chromosomal DNA 1 to 5 g of freeze-dried soybean (variety: Bonminori) leaves
Was ground in a mortar in the presence of liquid nitrogen. Transfer this to a 50 ml polypropylene centrifuge tube and add 15 ml of 50 mM Tris-HCl (pH
8.0), 0.7M NaCl, 10mM EDTA, 1% CTAB (cetyl
(Trimethylammonium bromide) and 1% mercaptoethanol. 56 ° C
Suspend gently for 20 minutes while heating at 25 ° C, cool to 25 ° C, and then cool with 15 ml of chloroform, isoamyl alcohol (24:
1) The mixed solution was added and gently emulsified. 20 ℃ at 8000 × g
After centrifugation at 10 minutes for 10 minutes, the aqueous layer was recovered and then extracted again with chloroform and isoamyl alcohol to recover the aqueous layer. 1.5 ml of 10% CTAB, 0.7M Na was added to the obtained aqueous layer.
Cl solution was added and mixed, then 17 ml of 50 mM Tris-HCl (pH 8.
0), 10mM EDTA, 1% CTAB solution were added and mixed, and the mixture was mixed at 25 ℃ for 3
It was left for 0 minutes. This was centrifuged at 1500 × g at 20 ° C. for 15 minutes, the supernatant was completely discarded, and the precipitate was recovered. 7 for precipitation
After adding 50 ml of 50% CsCl (w / w) solution to completely dissolve it, 400 μm
l of 10 mg / ml ethidium bromide solution was added and mixed, followed by centrifugation at 44,000 rpm for 26 hours at 20 ° C. in a Hitachi RP 65T rotor. After centrifugation, DNA-containing fractions were collected with a Pasteur pipette using a UV hand monitor. Add 20-fold diluted SSC solution (3
3 ml of isopropanol saturated with M, NaCl, 0.3 M sodium citrate) was added and mixed, and ethidium bromide was removed by isopropanol extraction. After performing this extraction procedure 5 times, transfer the aqueous layer to a dialysis membrane and
Dialysis was performed 3 times against Tris-HCl (pH 8.0) and 1 mM EDTA. From 1 g of freeze-dried leaves, 250 to 300 μg of chromosomal DNA was obtained.

Example 2 Preparation of soybean gene library 50 μg of soybean chromosomal DNA obtained in Example 1 was added to 10 mM T
After partial decomposition with 100 units of restriction enzyme MboI (Takara Shuzo) in a buffer solution containing ris-HCl (pH 7.5), 7 mM MgCl ₂ , and 100 mM NaCl, this was sucrose density gradient solution (200 mM Tris-HC).
l (pH7.5), 1M NaCl, 10 mM EDTA, 10-40% sucrose)
The cells were layered on top of each other and centrifuged at 28,000 rpm and 20 ° C for 16 hours using a Hitachi RPS 40T rotor. A part of the 0.5 ml fractions was fractionated at 0.5 Kbp by 0.6% agarose gel electrophoresis.
2 μg of a 20 Kbp DNA fragment was obtained.

Next, 1 μg of this DNA fragment and 1 μg of λ phage vector EMBL3 (manufactured by Promega) were ligated with T4 DNA ligase (manufactured by Takara Shuzo) to obtain a hybrid DNA in which soybean chromosomal DNA was inserted at the BamHI cleavage site of EMBL3. Obtained.
Ligation reaction is 66 mM Tris-HCl (pH7.6), 6.6 mM MgC
1 at 12 ℃ in a solution containing l ₂ , 10 mM DTT, 66 μM ATP
It was carried out for 2 hours. About the obtained hybrid DNA inv
In vitro packaging using itro's packaging kit (Gigapack; Promega) [Becker, A & M. G
old; Proc. Nat. Acad. Sci. 72 , 581 (1975)] to obtain a soybean gene library (3.0 × 10 ⁶ PFU / μg).

Example 3 Screening for Synin Gene A gene library, which is an assembly of EMBL3 phages containing soybean-derived DNA obtained in the above Example 2, was used as Escherichia coli LE 392.
_{^{(F -, hsdR514 (Y k}} -, m k -), supE44, s
upF58, lacY1, galK2, galT
22, metB1, trpR55, λ ⁻ ) to form plaques. Escherichia coli LE392 manufactured by Promega was used.

The clones containing the glycinin gene from the obtained plaques were cloned by the plaque hybridization method [Benton, WD &
RWDavis; Science 196,180 (1977)] using ³² p-labeled glycinin A ₂ B _1a subunit cDNA with Nick Translation Kit (manufactured by Amersham Japan).
[Momma, T. et al; FEBS LETTERS, 188: 117 (1985)]. For the plaques hybridized with the glycinin A ₂ B _1a subunit cDNA, chemically synthesized DNA [Momma, T. et al., Corresponding to the 6th to 11th amino acid sequence from the N-terminal of the A ₂ subunit of glycinin A ₂ B _1a . et al; FEBS LETTER
S, 188: 117 (1985)] labeled with ³² p was used as a probe to perform plaque hybridization again, and the one showing the strongest hybridization signal was selected.

Example 4 Preparation of Phage DNA Containing Glycinin A ₂ B _1a Gene 80 ml of the phage (2 × 10 ⁹ ) obtained in Example 3 above
IYE medium [Maniatis, T. et al; "Molecular cloning" Cold
Spring Harbar Labo. (1982)] E. coli LE392 grown
Was adsorbed on the plate for 20 minutes at room temperature.

Next, this was transplanted to TYE medium 4 and cultured at 37 ° C. for 6 to 8 hours to obtain a lysate. Lysate 6000 × g,
Centrifuge at 4 ℃ for 10 minutes, and use the supernatant in 0.5M NaCl, 10%
It was adjusted to be polyethylene glycol (PEG) 6000 and left at 0 ° C. for 1 hour to form a coprecipitate of phage and PEG. This precipitate at 6000 × g at 4 ℃
Centrifuge for 10 minutes to collect, 20 ml of 50 mM Tris-H
It was suspended in Cl (pH 7.5), 10 mM MgSO ₄ buffer. Add 20 ml of chloroform to the phage / PEG suspension, mix, and
Centrifugation was performed at 0 × g and 4 ° C. for 10 minutes to separate the aqueous layer and the chloroform layer, and the aqueous layer was recovered. This operation was repeated, and the phage suspension was added to a cesium chloride step density gradient solution (50 mM Tris-HCl (pH 7.5), 10 mM MgSO ₄ , 1.7 g / ml C).
sCl-1.5g / ml CsCl-1.45g / ml CsCl), Hitachi RPS 4
Centrifugation was carried out at 22000 rpm and 4 ° C for 2 hours using a 0T rotor.
After collecting the phages with a Pasteur pipette, transfer them to a dialysis membrane and add 2 to 50 mM Tris-HCl (pH 7.5), 10 mM MgSO ₄ solution.
Was dialyzed against. DN to the obtained phage suspension
aseI (Takara Shuzo) and RNaseA (Pharmacia) were added at concentrations of 1 μg / ml and 10 μg / ml, and treated at 37 ° C for 30 minutes to digest mixed E. coli DNA and RNA, then 0.5% SDS, 50mM Tris-HCl (pH7.5), 0.4 MEDT
0.2 volume of A, 1 mg / ml proteinase K (manufactured by BRL) solution was added to deactivate DNase I and RNase A. Then 1 at 50 ° C
The proteinase K was inactivated by treatment for 5 minutes.

An equal amount of 10 mM Tris-HCl (pH 8.0) was added to this phage suspension,
Phenol saturated with 1 mM EDTA was added and gently mixed. After centrifugation at 1000 × g for 10 minutes, the aqueous layer was recovered and mixed with an equal amount of chloroform / phenol / isoamyl alcohol (24: 25: 1), and then the aqueous layer was recovered. After repeating this extraction process, DNA was collected by the ethanol precipitation method. 1.2 mg of DNA was obtained from the phage lysate of 4.

Example 5 Analysis of Nucleotide Sequence of Glycinin A ₂ B _1a Genomic Gene 1 μg of the DNA obtained in Example 4 was treated with 4 units each of restriction enzyme EcoRI (Takara Shuzo) and SalI (Takara Shuzo) or HindIII (Takara Shuzo). ) And SalI each containing 4 units, 10 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ , 75
mM NCl, 7 mM 2-mercaptoethanol, 100 μg / ml
It was completely digested by warming to 37 ° C for 3 hours in BSA solution. A portion of this was subjected to 0.7% agarose gel electrophoresis, transferred to a nitrocellulose filter, and glycinin A ₂
Southern blot hybridization [Maniatis, T. et al; "Molecular cloning" Cold using the DNA containing the full length B _1a subunit cDNA labeled with ₃₂ p as a probe
Spring Harbar Labo. (1982)]. EcoRI and Sal
For the sample digested with I, the 2.6 Kbp and 3.7 Kbp fragments hybridized strongly with the probe. Meanwhile, HindIII and Sal
In the sample digested with I, fragments of 1.6 Kbp and 5.2 Kbp hybridized strongly with the probe. On the other hand, in the sample digested with HindIII and SalI, fragments of 1.6 Kbp and 5.2 Kbp strongly hybridized with the probe.

The above results and restriction enzyme digestion map of glycinin A ₂ B _1a subunit cDNA [Momma, T. et al; FEBS LETTERS, 188: 1
17 (1985)] and 2.6 Kbp digested with EcoRI and SalI and
Glycinin was added to the 1.6 Kbp fragment digested with HindIII and SalI.
A part of the A ₂ B _1a subunit structural gene at the 5'-end and its 5'-flanking region are also 3.7 Kbp cut with EcoRI and SalI and 5.2 Kbp cut with HindIII and SalI.
It was presumed that the 3'-terminal part of the A ₂ B _1a subunit structural gene and its 3'-terminal flanking region were present in this fragment.

Therefore, the phage DNA obtained in Example 4 was digested with EcoRI and SalI or HindIII and SalI to give 2.6 each.
A large amount of DNA fragments of Kbp and 3.7 Kbp or 1.6 Kbp and 5.2 Kbp were prepared. The digestion conditions are scaled maps of the above-mentioned conditions, and the extraction, purification, and recovery of each DNA fragment can be carried out by a conventional method [Maniatis, T. et al;
r cloning "Cold Spring Harbar Labo. (1982)].

The four types of DNA fragments obtained were used as they were or in A
After digestion with luI, DdeI, HpaII, Sau3AI and TagI (all are Takara Shuzo), the Maxam-Gilbert method [Maxam, AM &W.Gilbert; Proc.
t.Acad.Sci. 74 , 560 (1977)]. Five'
The transcription initiation point [(+) mark in Fig. 1] in the upstream region is the 3'-terminal poly (A) addition site in the template extension method. Was determined by SI-mapping method. Of the obtained nucleotide sequence, the complete structure of the glycinin A ₂ B _1a subunit gene and part of its 5′-terminal and 3′-terminal flanking regions are shown in FIG.

When the nucleotide sequence shown in FIG. 1 was compared with the cDNA of the gene, three introns were inserted,
The nucleotide sequences of the exons were completely the same. Also, the 5'-end and 3'-end untranslated regions of the cDNA were completely in agreement with the nucleotide sequences shown in FIG. From this, it was determined that the DNA chain of the present invention was chromosomal DNA encoding soybean glycinin A ₂ B _1a subunit protein.

In varying degrees of the 26 species from the 5 'clone population lacking flanking regions A ₂ B _1a gene, except for the DNA fragment with BamHI and HpaII. On the other hand, A ₂ B _1a cDNA clone [Momma, T.et
al; FEBS LETTERS, 188: 117 (1985)], a cDNA fragment lacking the 5'upstream region was excised with HpaII and PstI. Next, pUC11 containing the DNA fragment cleaved after the base encoding the 74th amino acid Gln from the upstream region of the A ₂ B _1a gene.
HpaII / PstI of A ₂ B _1a cDNA clone was added to each clone of 9 groups.
The fragment (cDNA lacking at the 5'end) was ligated with T4 DNA ligase, and the PstI cleavage site at the 3'end was treated with Mung bean nuclease and then treated with Klenow enzyme to prepare a blunt end. Is further cut with PvuII,
After blunt type ends were treated with the same enzyme, BamHI
The linker was ligated to the 5'and 3'ends using T4 DNA ligase. After treatment with BamHI, the yeast / E. Coli shuttle vector YEp13 plasmid [Broach, JR, Strantherm, J.
N. and Hicks, J, B .; Gene, 8 , 121 (1979)], the 5 ′ upstream region of the A ₂ B _1a gene was deleted to various extents, and the complete A _A series of clones (26 clones) having the sequence of ₂ B _1a cDNA was prepared.

These clones were transformed into yeast (Saccharomyces cerevisiae,
JHC8-24C strain; ura3-52, his3-11, his3-15, leu2-3, leu2-
112, ino1-13, ino4-8). Transformation is the lithium acetate method [Ito,
H. et al; J. Bacteriol. 153, 163 (1983)]. The transformants were screened primarily by growing the yeast on YNB minimal medium containing 2% glucose [making it possible to grow on a medium lacking leucine]. Bacteria were collected from an overnight culture in which positive clones were grown in YPD medium, and Zymol
2% SDS after protoplasting with yase 60000
Lysate and add water containing 1 mg of Pronase E
Incubated at 30 ° C for 30 minutes. Then, after phenol treatment, ethanol precipitation was performed according to a conventional method. RNaseA
After the treatment, 0.5 μg is denatured and adsorbed on nitrocellulose,
Using the A ₂ B _1a cDNA clone labeled by nick translation as a probe, dot hybridization was performed for secondary screening.

5'for each clone positive in the above screening
The expression of glycinin A ₂ B _{1a in} these transformants was examined by analysis of transcripts and translation products, since they were obtained for defective gene clones (26 types). Transcript analysis is A ₂
The expression of B _1a mRNA was searched by dot hybridization and Northern blot hybridization using the aforementioned nick translation-labeled A ₂ B _1a cDNA as a probe.

The translation product was analyzed by Western blotting of the yeast cell lysis supernatant. The RNA was extracted from the cultured cells by the method of Elder et al. The 5'end of the transcript is determined by the SI nuclease mapping method [Berk, AJ and PA Sharp; Cel.
l. 12 , 721 (1977)]. From these results, the regulatory region of the glycinin gene was identified in the yeast (Saccharomyces cerevisi
ae, strain JHC8-24C), and the 5'end sequence of glycinin mRNA extracted from yeast cells was completely identical to that of the glycinin mRNA extracted from soybean seeds during ripening. In addition, the size of the transcript was about 1.7 Kb, which was in agreement with that of intact. On the other hand, the translation product by Western blotting had a molecular weight of about 61 K Daltons. This size was consistent with the molecular weight of the glycinin translation product, which was carried out using mRNA extracted from ripening soybean seeds. These results indicate that the regulatory region of the glycinin gene is functional in yeast. Therefore, as a result of searching the strength of transcription and translation activity in the glycinin gene [5 'flanking region of glycinin gene + glycinin A ₂ B _1a cDNA] lacking various 5'ends, the transcription start point (Fig. At 535 bases or more upstream from the middle (+) 1), there is no effect on transcription / translation activity, but both of the above activities gradually decrease with deletion of the downstream from 535 bases, and 120 bases upstream from the transcription start point. When it was deficient, it lost most of its activity. From these results, it was confirmed that the 5'upstream region of the gene containing the nucleotide sequence shown in Table 1 is required for complete expression of the glycinin gene.

[Effects of the Invention] Since the DNA chain of the present invention has a strong promoter function in host cells, especially plant cells, it is effective when a foreign gene is introduced into a host cell and expressed by a gene recombination technique. Can be used.

[Brief description of drawings]

FIG. 1 shows the complete structure of the glycinin A ₂ B _1a gene.

Claims (1)

[Claims] 1. A DNA chain having a promoter function and having the following base sequence. 5'-ATATACAGTACAAATTATTCTCTACTAATCTTTATGATATG TAAACCAAAGCATGATTAATTATTTCCTAATTAAATTAAAAAAA ATTGAGTAACTAGTATCACATAAAGATCTGTCAAAACCATGAAT AGTGATAATTTCATAACACCTAATAATTTCTCTATCCCTAGAGT GAGGTCATTTTTGGACGGCCCTTCTTCTCACTTTGAGGATCCCA TCATTGTCACACGGTGTATTCATATAATTTCATATGTCATAAAC CCGCGAACATGAAATGAAACCATGGTCCCCCTCTCCACCACCGT TTTCTGGCAATTGCATGCAATACAAACACACTTGGTATTTGTCA CATAATGTTGATGTCGAACTGTCGAAGCCACCTCACACCCATGA ACTTAATGAGGTGTAACACACAAGGCTTCCATAGCCATGCATAC TGAAGAATGTCTCAAGCTCAGCACCCCACTCCTGTGACGTGTCC CTCACCCACCTTCCTCTCTTCCCTATAAATAACCACGCCTCAGG TTCTCCGCTT-3 '