JPH0591880A - Human mk gene - Google Patents

Abstract

PURPOSE:To provide the subject gene coding a human cell differentiation promoting factor (MK) having a specific amino acid sequence, active to promote the cultivation efficiency of various culture cells and easily giving human MK protein such as tissue-restoration agent and cancer treating agent in a mass. CONSTITUTION:A cDNA library originated from human fetal kidney is incubated together with E.coli, etc., at 37 deg.C for 20min to adsorb a phage to a host cell. The cells are scattered on a culture dish and cultivated at 37 deg.C for 7-9hr to form a plaque, which is transferred on a nitrocellulose filter and screened by plaque hybridization process using a probe prepared from a mouse cell differentiation promoting factor (MK). A positive clone containing a DNA coding a human cell differentiation promoting factor (MK) is selected and cultivated to separate a phage DNA by conventional process. The DNA is subjected to restriction enzyme treatment to obtain the objective human MK gene having a base sequence coding the amino acid sequence of formula.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a human MK gene, and more particularly to a human MK gene encoding a protein that promotes differentiation of human cells, which is useful in various cell culture and pharmaceutical fields.

[0002]

2. Description of the Related Art If cancer cells are mutated while normal cells are being differentiated, or if they arise as a result of disorders in the differentiation pathway, it may be possible to treat cancer by further promoting differentiation. .. Based on this idea, retinoic acid, which has the ability to differentiate cancer cells, is also one of the molecules that regulate development, and the study of the relationship between cancer treatment and retinoic acid is noteworthy. Retinoic acid is a derivative of vitamin A (retinol) and is produced from vitamin A in the body. Vitamin A deficiency causes abnormal differentiation, which was already reported in 1925 in Warba and Wou (Wo
Lbach & Howe). Boll
ag) showed that retinoic acid produced some derivatives of vitamin A and had the effect of suppressing chemical carcinogenesis in mouse skin [Bollag, W., Eur. J. Canc.
er., 8 , 689 (1972)], Strickland
d) et al. succeeded in inducing differentiated and carcinogenesis of teratocarcinoma stem cells by retinoic acid [Strickla
nd, et al., Cell, 15 , 393 (1978)]. After that, it was reported that retinoic acid has a certain level of differentiation ability against many cancer cells such as HeLa cells and malignant melanoma cells. As described above, information about the relationship between retinoic acid and differentiation and development is obtained using chicken limb buds, and the morphogen concentration gradient that determines the anterior-posterior axis in limb morphogenesis is due to retinoic acid. (Tickle, C., et al., Nature, 296 , 564 (1982); Th
Aller, C., et al., Nature, 327 , 625 (1987)], the relationship between vitamin A overdose and malformation has also come to be noted from this viewpoint. Furthermore, the intracellular receptor for retinoic acid was found to be a DNA-binding protein that is related to steroid hormone receptors and thyroid hormone receptors [P
etkovich, M., et al., Nature, 330 , 444 (1987)], retinoic acid is a substance that regulates a broader aspect of development and differentiation. It is considered that it binds to the regulatory region and promotes or suppresses its expression. In the molecular mechanism of development and differentiation, various molecular discrimination cascades occurring in the nucleus and the cell surface are considered to be important, and it is speculated that molecules controlled by retinoic acid also act in a cascade. Then, this cascade is revealed, and when this cascade reaches the cell surface, it becomes important from the viewpoint of cancer treatment. Although retinoic acid alone is considered to have a therapeutic effect on cancer to some extent, the side effects associated with large doses prevent its use, and in some cancers it is one of the cascades of differentiation mechanisms under the control of retinoic acid. It is also a problem that parts may be destroyed. Therefore, the present inventors believe that it is possible to approach the treatment of cancer by differentiation by catching a polypeptide that is located downstream of the cascade and is of critical importance. We focused on teratocarcinoma stem cells.

Teratocarcinoma stem cells are EC cells (embr
yonalcarcinoma cells; embryonal tumor cells, embryonal carcinoma cells)
EC cells have properties very similar to those of undifferentiated cells in the early embryo and have the ability to induce differentiation into various cells [Takamura Muramatsu, Cell Differentiation, Maruzen (1987); Takehiko Noguchi, Takashi Muramatsu). Ed., Mouse teratoma, Rikogakusha (1987); Takashi Muramatsu, Protein / nucleic acid / enzyme, 33 , 281 (1988)]. EC cells are malignant cancer cells, and when they are inoculated into mice, they infiltrate and proliferate until they eventually defeat the host.However, what the EC cells have completely differentiated and disappeared is a benign tumor.
a; teratoma). Based on this phenomenon, EC cells are regarded as a suitable system for analyzing the differentiation and carcinogenesis phenomenon, and various studies have been reported.

There are various methods for inducing the differentiation of EC cells, but the most reliable method among them is the above-mentioned retinoic acid treatment. When treated with 10 ⁻⁸ to 10 ⁻⁶ M retinoic acid for 2 days, EC cells start to differentiate and finish differentiation in 5 to 14 days. Differentiated cells are diverse such as myoblasts, nerve cells, glial cells, fibroblasts, and extraembryonic endoderm cells. For example, a high concentration of 10 ⁻⁶ M retinoic acid is required for the differentiation of nerve cells, whereas extraembryonic endoderm cells require
It has been found that a low concentration of 10 ⁻⁸ M is sufficient, and that long-term treatment with a high concentration of retinoic acid, on the contrary, causes inhibition of differentiation. In vitro differentiation of EC cells leads to expression and repression of many genes. α-fetoprotein appears with proximal endoderm differentiation, and SSEA-1
Some carcinoembryonic glycan markers, including the phenotype, disappear as a result of differentiation [Muramatu, T., J. Cell Biochem., 3
6 , 1 (1988)]. On the other hand, the cell membrane recognition molecule H-2 antigen and Thy-1
Antigens are expressed with differentiation. Those involved in the differentiation process include a group of DNA-binding proteins, and the expression of myc and N-myc is suppressed at the early stage of differentiation. On the other hand, there are some homeobox-containing genes whose expression is promoted, and viral genes such as mouse sarcoma virus cannot be expressed in EC cells, but can be expressed with differentiation. It is considered that there is a transcriptional regulatory factor that binds to the enhancer region of the viral gene in EC cells, and it disappears with differentiation. It has been pointed out that this transcriptional regulatory factor is similar to the adenovirus EIA gene product [Griep,
AE, et al., Proc. Natl. Acad. Sci., 83, 5539 (198
6); Jokobovits, A., et al., Nature, 318, 188 (1985);
Jokobovits, A., et al., Proc. Natl. Acad. Sci., 8
1, 7132 (1986); La Thangue, NB, et al., Cell, 4
9, 507 (1987)].

Therefore, there is no doubt that a complicated cascade reaction of DNA-binding proteins occurs in the early stage of differentiation, and this triggers differentiation, and it is arguable that an unknown differentiation factor of a polypeptide that appears with this differentiation can be called a differentiation factor. The present inventors considered the high possibility of existence and have conducted intensive research. As a result, the present inventors have found that mouse testicular teratocarcinoma ST
We established a pluripotent cell line HM-1 from T-2 [Muramat
u, T., et al., Develop. Biol., 110 , 284 (1985)],
A gene that was expressed in the early stage of differentiation when constantly monolayer-cultured with 1 × 10 ⁻⁶ M retinoic acid was found, cDNA was cloned, and named MK (hereinafter referred to as “mouse MK”). The polypeptide encoded by this mouse MK (hereinafter,
The "mouse MK polypeptide") has no strong homology with the previously reported proteins and was recognized as a novel protein. The mouse MK polypeptide consists of 90 amino acids, is rich in basic amino acids and cysteine, and is transiently expressed in the metaphase embryo during mouse development.
-1 cells were produced only in myoblasts. In the mouse development process, it was not expressed in the 5-day embryo, but was widely expressed in the 7-9 day embryo. The part that is expressed after that is gradually localized,
In the 15th day embryo, it was expressed only in the kidney. This mode of expression strongly suggests that mouse MK polypeptide is a factor widely required for cells in the intermediate stage of differentiation [Ka
domatu, K., et al., Biochem. Biophy. Res. Commun.,
151 , 1312 (1988)]. In subsequent studies, the mouse MK cDNA had a signal peptide-like sequence in the N-terminal region,
It is thought that the polypeptide is mainly synthesized as a secretory protein. The structure of the 5'end of mouse MK is MK
Three types, namely, 1, MK2, and MK3, were observed, and it was found that MK2 had a structure corresponding to the main mRNA, and its molecular weight was about 15,500. RNA using MK2-specific probes
From the blot, it was confirmed that the MK2 sequence was certainly increased by the treatment with retinoic acid. As a result of isolation and analysis of the genomic DNA of the mouse MK gene, the 5'side structures of MK1, MK2, and MK3 were located upstream of the common structure in the order of MK3, MK2, and MK1.
It was revealed that the species mRNA was caused by the difference in the reading start points. About 50 bp upstream of the MK2 sequence induced by retinoic acid, a sequence with high homology to the binding site of steroid hormones and thyroid hormone receptors was found, and the retinoic acid-retinoic acid receptor complex directly binds to this sequence. Estimated to be possible [Mats
ubara, S., et al., J. Biol. Chemistry, 265 , (16) 9
441 (1990); Tomomura, M., et al., J. Biol. Chemistr.
y, 265 , (18) 10765 (1990)].

[0006]

Mouse MK polypeptide is considered to act as a factor that controls cell differentiation under the control of retinoic acid, and further research is desired in relation to cancer treatment by promoting differentiation. It is rare. As described above, the present inventors have isolated the MK gene of mouse so far and determined the amino acid sequence of the polypeptide encoded by the gene. However, since the polypeptide is derived from mouse, it is not preferable to administer it to humans as a drug because of problems such as antigenicity. Therefore, human MK that can be used as a differentiation promoting factor for human cells and can be used as a therapeutic agent for cancer due to its association with cell differentiation
The human MK gene for preparing polypeptides has been desired.

[0007]

[Means for Solving the Problems] Under such circumstances, the present inventors have conducted diligent research and as a result, found that the human MK gene can be obtained by cloning using a DNA fragment obtained from the mouse MK gene as a probe. Heading, completed the present invention.

That is, the present invention provides a human MK gene.

The gene of the present invention contains, for example, a base sequence encoding the amino acid sequence shown in the following sequence listing, a base sequence complementary to the amino acid sequence, or both. More specifically, it contains a base sequence shown in the sequence listing below, a base sequence complementary to the base sequence, or both.

The human MK gene of the present invention is prepared, for example, as follows. That is, first, total RNA was isolated from cells containing human MK protein, and mRNA was purified from this,
A cDNA library is constructed by a conventional method. Then this cd
A clone having the human MK gene is selected from the NA library to obtain the human MK gene of the present invention. Next, the method for producing the gene of the present invention will be described in detail.

(1) Construction of human cDNA library The cells used for the isolation of total RNA are human kidney,
Human fetal kidney, brain, connective tissue or cultured cells thereof can be used. Here, as the cultured cells, human teratocarcinoma cells were prepared by the method of Muramatsu et al.
T., et al., Develop. Biol., 110 , 284 (1985)], cells differentiated with retinoic acid can be used.
Examples of teratocarcinoma cells include PA1 and Tera1 [Muramatu, T., et al., Somatic Cell
Genet., 5 , 753 (1979)]. Here, the treatment time of retinoic acid is 8 hours to 72 hours, preferably 24 hours,
The concentration of retinoic acid is 10 ⁻⁹ M / ml to 10 ⁻⁵ M / ml, preferably about 10 ⁻⁸ to 10 ⁻⁶ M / ml. Further, the cells obtained above can be cultured in an ordinary medium. Examples of the medium used here include RPMI-1640 medium, CEM medium, and CM.
RL-1066 medium, DM-160 medium, Dulbecco's modified Eagle's minimum essential medium (Eagle's MEM), Fisher's medium, F
-10 medium etc. can be mentioned. Further, if necessary, a medium obtained by adding serum such as fetal calf serum (FCS) or a serum component such as albumin to these media can also be used in the same manner. The amount of cells used in the above medium is usually 1 x 10
^It is preferably about ⁴ to 10 ¹⁰ cells / ml. Culturing can be performed by an ordinary method, for example, a carbon dioxide gas culturing method,
It may be carried out at about 37 ° C for about 5 to 17 days, preferably about 8 to 11 days.

Total RNA is extracted from the cultured cells or tissues. The extraction operation from the cultured cells is preferably carried out at the time when the human MK protein is most produced and accumulated in the culture supernatant by the above-mentioned culture.
Isocyanate mixture or suitable surfactant such as SD
S, NP-40, Triton X100, deoxycholic acid, etc., or by a physical method such as homogenizer or freeze-thaw, after partially or completely disrupting and solubilizing, the chromosome
The DNA is sheared to some extent using a mixer such as a polytron or a syringe, and then the protein and the nucleic acid fraction are separated. For this operation, cesium chloride multi-layer method [Chirgwin, JM, eta] using phenol / chloroform extraction or ultracentrifugation of about 100,000 × g
L., Biochemistry, 18 , 5294 (1979)] and the like are generally adopted. In addition, in each of the above methods, in order to prevent RNA degradation by RNase, it is preferable to add an RNase inhibitor such as heparin, polyvinyl sulfate, diethylpyrocarbonate, vanadium complex, bentonite, macaloid and the like.

Since the protein fraction separated from the nucleic acid fraction contains human MK protein, it can be isolated by usual means for separating and purifying proteins, for example, various chromatographies.

M from RNA obtained according to the above extraction procedure
Separation and purification of RNA are carried out by a method using an adsorption column such as oligo dT-cellulose (Colaborative Research Inc.), poly U-Sepharose (Pharmacia), Sepharose 2B (Pharmacia), or by a batch method. Can be implemented.

The purified mRNA obtained above is usually unstable, converted into a stable complementary DNA (cDNA) form, and ligated to a replicons derived from a microorganism in order to allow amplification of a target gene. The above-mentioned conversion of mRNA into cDNA, that is, synthesis of cDNA in vitro can be generally performed as follows.

That is, first, using oligo dT as a primer (this primer may be either free oligo dT or oligo dT already added to the vector primer),
Single-stranded cD complementary to mRNA using reverse transcriptase in the presence of dNTP (dATP, dGTP, dCTP or dTTP) using mRNA as a template
Synthesize NA. The next steps differ as follows depending on whether the free oligo dT or the oligo dT added to the vector primer was used in the above.

In the former case, mRNA used as a template is decomposed and removed by alkali treatment or the like, and thereafter, double-stranded DNA is formed by using single-stranded DNA as a template and reverse transcriptase or DNA polymerase.
To create. Both ends of the double-stranded DNA obtained next are treated with exonuclease, and an appropriate linker is added to each of them.
A plurality of DNAs or a combination of bases that can be annealed is added, and this is incorporated into an appropriate vector. This is carried out using a known method such as the Gubler and Hoffman method depending on the vector used. The above-mentioned cDNA can be easily synthesized by using a commercially available cDNA synthesis kit.

The vector is not particularly limited, but λgt
The phage vector or plasmid vector of the system can be appropriately selected according to the host or used in combination.
Examples of the vector used here include λgt10 and λgt11, and the method of using λgt10 and λgt11 as a vector can be based on the method of Young et al. [Young, RA,
et al., in DNA Cloning, 1 , 49 (1985)].

In the latter case, an open circular plasmid to which a linker similar to the above is added and a linker DNA (often a region capable of autonomous replication in animal cells and a transcription promoter region of mRNA) with the mRNA used as a template remaining DNA containing
Fragment is used) to form a closed circle, and then RNase H and DNA polymerase I are added in the presence of dNTPs.
By coexisting with and replacing mRNA with a DNA chain, complete plasmid DNA can be prepared.

The DNA obtained as described above can be introduced into a host microorganism of a vector to transform the microorganism. As a host microorganism, Escherichia coli (Esch
erichia coli) is typical, but is not limited to this, and Bacillus subtilis
s), Saccharomyces cere
visiae) etc. can also be used.

As a method for introducing DNA into a host microorganism and transforming the same by a generally used method, for example, cells mainly in a logarithmic growth phase are collected and treated with CaCl ₂ to make it easy to take up DNA, and then a plasmid Can be adopted. In the above method, MgCl ₂ or RbCl can be further coexisted in order to further improve the efficiency of transformation, as is commonly known. Alternatively, a method in which microbial cells are transformed into spheroplasts or protoplasts and then transformed can also be adopted. For more information on these methods, see Gubler and Hoffman's method [Gubl
er, U. and Hoffman, BJ Gene, 25 , 263 (1983)].

(2) Selection of human MK gene clone Gene screening from a human cDNA library can be carried out by combining conventionally known methods. For example, using a human MK protein-specific antibody against a protein produced by cDNA, a method of selecting a corresponding cDNA clone by Western blotting, a Southern blotting method using a probe that selectively binds to a target DNA sequence, or Screening is possible by the Northern blotting method. It is also possible to use these in combination. Here, as the probe,
Generally, a chemically synthesized DNA sequence is used based on the information on the DNA or RNA sequence or the amino acid sequence encoded by the DNA or RNA sequence, but naturally-prepared DNA or RNA can also be used. In particular, the human MK protein component gene is considered to have a high homology with that of the mouse, and therefore the cDNA of the corresponding mouse component or a part thereof can be labeled and used.

The gene of the present invention obtained above can be cloned into various plasmids by a conventional method. For example, a fragment containing the gene of the present invention, which was purified by cutting with EcoRI, was similarly digested with EcoRI to obtain pUC19 [Yanisc
h-Perron, C., et al., Gene, 83 , 103-119 (1985)]. As a result, the desired recombinant vector can be obtained. In addition, introduction of the obtained recombinant vector into a host and amplification and individualization of the recombinant vector by this are carried out by various commonly used methods, for example, by collecting cells mainly in a logarithmic growth phase and treating with CaCl ₂ naturally. It can be carried out by a method in which DNA is easily incorporated into the vector, and a vector is incorporated therein.

Various operations adopted in the above, for example, chemical synthesis of a part of DNA, enzyme treatment for the purpose of breaking, deleting, adding or binding a DNA chain, isolation, purification, replication, selection of DNA, etc. Can follow the usual methods.
More specifically, the isolation and purification of the above DNA can be performed by agarose gel electrophoresis or the like.

The nucleotide sequence of the gene of the present invention obtained above can be determined by digesting DNA with an appropriate restriction enzyme and then using the dideoxy method [Sanger, et al., Proc. Natl. Acad. Sci.
USA, 74 , 5463 (1977)] or Maxam-Gilbert method (A.
M. Maxam and W. Gilbert, Methods in Enzymology, 6
5 , 499 (1980)] and the like. Furthermore, the above-mentioned base sequence can be easily determined by using a commercially available sequence kit or the like.

The nucleotide sequence of the human MK gene of the present invention thus obtained and the corresponding amino acid sequence are shown in the sequence listing. The base number is 1 at the 5'end and is assigned in the direction from the 5'end to the 3'end. Amino acid residue numbers start with C
It is attached in the end direction, and the first encoded amino acid is 1. The sequence of the human MK gene consists of a total of 563 bases including the translated region and the 5'side and 3'side untranslated regions. The translation region was 429 bases long and was found to correspond to a protein of 143 amino acids. The homology with the mouse MK2 gene was 82% at the nucleic acid level and 87% at the amino acid level.

The obtained gene of the present invention can be used by a conventional publicly known general gene recombination technique [Science, 2
24 , 1431 (1984); Biochem. Biophys. Res. Comm., 130 ,
692 (1985); Proc. Natl. Acad., USA, 80 , 5990 (198
3); EP Patent Publication No. 187991, etc.], the human MK protein can be easily produced and obtained in a large amount. Also,
Using the human MK protein thus obtained, an antibody specific to the human MK protein can be prepared. As the component used as an antigen, a component produced in a large amount by a genetic engineering method can also be used. Antibodies are produced according to the usual methods for producing polyclonal antibodies and monoclonal antibodies. The method for producing polyclonal antibodies against human MK protein complex is the method of Weinberger et al. [Sience,
228 , 740-742 (1985)], it is also possible to obtain an epitope-specific antibody. Antibodies are for purification and measurement of human MK protein,
Used for identification, etc.

The human MK protein obtained as described above includes a polypeptide in which methionine is not bound to the N-terminus of the amino acid sequence shown in the sequence listing, and a human MK gene at the N-terminus of the above amino acid sequence. Intermediates in which a part or all of the signal peptide of is bound or deleted are also included. Such mutations are naturally obtained, for example, by post-translational modification, or in the genetic engineering method, a gene obtained from nature is modified by a method such as cytospecific mutagenesis, or a phosphite triester method is used. Genes can be synthesized by synthesizing mutated DNA by a chemical synthesis method or by combining both.
By utilizing these genes, incorporating them into a microbial vector, and producing them from a transformed microorganism, a component having a mutation can be obtained.
Further, these proteins can be partially substituted with amino acids or modified in sequence by natural or artificial mutation while maintaining their functions. Therefore, the human MK of the present invention
The gene also includes genes encoding proteins having the above-mentioned various mutations. Stop codons such as TAG and TAA can be added to the ends of the genetic code. The genetic code is not limited to the codons exemplified in SEQ ID NO: 1 above, and arbitrary codons can be selected for each amino acid without changing the amino acid sequence. For example, the codon usage of the host used for gene recombination is usually considered. You can follow the law [Nucl. Acids. Res.,
9 , 43-74 (1981)].

[0029]

EFFECTS OF THE INVENTION By using the human MK gene of the present invention, human MK
The protein can be easily produced in large quantities. Since the human MK protein acts as a cell differentiation promoting factor, use of this enhances the culturing efficiency of various cultured cells and enables the culturing of cells, which has been impossible in the past. It can be used as a tissue repair agent, or as a therapeutic agent for cancer because cells are considered to become cancerous if their differentiation is weak.

[0030]

The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

Example 1 (1) Preparation of mouse MK probe Since it is generally expected that human and mouse genes have high homology, the MK2 cDNA clone of the mouse MK gene [Tomomura, M., et al., J. Biol.
Chem., 265 , 10765-10770 (1990)] was digested with a restriction enzyme MspI (Takara Shuzo) to obtain a DNA fragment of about 482 base pairs. Ms
The cleavage site of pI is located 5 bases upstream of the MK2 cDNA sequence and about 482 bases downstream thereof. This is a multiprime DNA labeling method [Feinberg, AP, et al., Anal. Biochem., 1
37 , 266-267 (1984)] using α- [ ³² P] -dCT by the multiprime DNA labeling system (manufactured by Amersham)
It was labeled with P and used as a probe. A restriction enzyme map of the probe is shown in FIG.

(2) Separation of recombinant phage clone from cDNA library Human fetal kidney (20 to 24) purchased from Clonetex
Weekly fetus) λgt10 cDNA library (catalog number
NL1071a) and the screening probe prepared in Example 1- (1), Benton and Davis [Benton,
Screening was carried out by the plaque hybridization method developed by W. and Davis, R., Science, 196 , 383-394 (1977)].

First, the above λgt10 cDNA library and E. coli were placed on a dissolved LB soft agar medium [1% bacto tryptone, 0.5% yeast extract, 1% sodium chloride, 1.5% bacto agar, pH 7.5]. Incubate C600Hfl at 37 ℃ for 20 minutes, and spread the library in which phages are adsorbed to the host bacteria to about 2 × 10 ⁴ cells per culture dish.
The cells were cultured for 9 hours to form plaques. A total of 80 culture dishes
One sheet was prepared. Then, it cooled at 4 degreeC for 1 hour or more. Next, nitrocellulose filters (Schleicher & Schnel
l; Schleicher & Chanel, cut into 13 × 9 cm) was placed on the surface of the agar plate, left at room temperature for 10 minutes, and then the filter was removed. A serial number was assigned to this filter to make a master filter, and the same operation was performed again.

The above filter was placed in 0.5M NaOH and 1.5M NaCl.
Place the contact surface with the plaque on the filter paper (Wattman 3MM; manufactured by Whatman) soaked with the solution, leave it for 10 minutes to treat the phage DNA with alkali, and then filter the filter with 1 M Tris-HCl (pH 8.0). ) And 1.5M NaCl solution were soaked in filter paper for 10 minutes to neutralize, and then 2 × SS
C (1 × SSC = 0.15M NaCl, 0.015M sodium citrate) solution was placed on the filter paper soaked for 5 minutes. After air-drying the filter at room temperature, it was further dried by heating at 80 ° C. for 2 hours in a vacuum dryer and baked to fix the phage DNA on the filter. Then 2 baked filters
After soaking in SSC, prewashing solution [50 mM Tris-
The mixture was transferred to hydrochloric acid, pH 8.0, 1 M NaCl, 1 mM EDTA, 0.1% SDS] and shaken at 42 ° C. for 1 hour to wash, and the colonies on the filter were removed.

Furthermore, a filter was used as a prehybridization solution [5 × SSC, 50% formamide, 50 mM sodium phosphate (pH 6.5), 10 × Denhardt's solution (0.02% bovine serum albumin, 0.02% polyvinylpyrrolidone, 0.02).
% Ficoll), 0.1% SDS, 200 μg / ml heat-denatured salmon sperm DNA] at 42 ° C. for 20 hours to perform pre-hybridization. Then, the solution was discarded, and 10 ml of the hybridization solution having the same composition was added again. Then α
Mouse M obtained in Example 1- (1) by labeling with-[ ³² P] -dCTP
K probe was added at 5 × 10 ⁵ cpm per filter, and hybridization was carried out at 42 ° C. for 20 hours. After the hybridization was completed, the filter was taken out and washed with 2 × SSC and 0.1% SDS solution at room temperature for 10 minutes. After washing 3 times in the same manner, add 0.5 × SSC.
The plate was washed twice in a 0.1% SDS solution at 56 ° C for 30 minutes each, and then air-dried at room temperature. Attach the air-dried filter to filter paper, mark it with [ ³² P] ink, put it in a cassette together with X-ray film (Kodak XAR5; Kodak) and intensifying screen, and expose it at -70 ° C overnight. .. The film is developed
After fixing, search for overlapping signals on the two filters, scrape multiple plaques corresponding to the positions where the signals were found together with the upper layer agar, and use SM buffer [50 mM Tris-HCl, pH 2.5, 8 mM MgSO 4. ₄ , 100 mM NaCl, 0.01%
Gelatin], and this time, dilute the plaques one by one so that they do not overlap each other, spread them on a nitrocellulose filter, perform hybridization again from this filter, perform secondary screening, and isolate pure phage clones. .. The positive clones thus obtained were two positive clones out of 1.6 × 10 ⁶ clones. Further, No.A1 was selected from the positive clones obtained by subjecting these positive clones to secondary screening. Each of the selected clones was isolated and purified by agarose electrophoresis. The recombinant phage clone obtained from the λgt10 human MK cDNA library was cloned into
hMK ”.

(3) Isolation of Recombinant Phage DNA Encoding Human MK Protein The human MK gene recombinant phage clone (λhMK) of the present invention obtained in Example 1- (2) was used as a host in E. coli C600Hfl. After being propagated as (Molecular Cloning (ALaborator
y Manual); T. Maniatis, EF. Fritsch, J. Sambrook; C
old Spring Harbor Laboratory (1982)], a recombinant phage DNA (λhMK DNA) was prepared.

(4) Preparation of plasmid phMK transformant λhMK DNA was digested with restriction enzyme EcoRI (Nippon Gene) to obtain a DNA fragment of about 500 base pairs. On the other hand, the plasmid vector pUC19 (Takara Shuzo) was also digested with the same restriction enzyme EcoRI, and both fragments were T4 DNA ligase (Takara Shuzo).
The recombinant plasmid phMK of the present invention obtained by ligating it with a ligation kit (manufactured by Takara Shuzo) using E.
The competent cells of oli HB101 (Takara Shuzo) were transduced.

(5) Preparation of human MK cDNA restriction enzyme map The plasmid phMK obtained in (4) above was cleaved with various restriction enzymes to prepare restriction enzyme maps of these cDNAs.
That is, the plasmid phMK obtained in the above (4) was replaced with [Molecu
lar Cloning (A Laboratory Manual); T. Maniatis, EF.
Fritsch, J. Sambrook; Cold Spring HarborLaborator
y, 138-141 (1982)], and the restriction map of the phMK clone of the present invention was prepared according to the method of p150-163 of the above-mentioned document. The result is shown in FIG. In FIG. 2, the scale shown at the top shows the nucleotide length (base) based on the first base of cDNA. The middle row shows the cDNA clone phMK encoding the protein of the present invention, and the boxed portion shows the coding region. Arrows indicate the direction and length of the base sequence determined for each DNA fragment.

The length of the cDNA of the above-mentioned plasmid is 486 bp, in which there are one site each cleaved by SmaI and RsaI, and three sites cleaved by AccII.
It was confirmed that there were two sites, and two sites were cut by EcoT14I, and in this order it was confirmed that there were recognition sites for these restriction enzymes.

[0040] (6) The resulting plasmid phMK in determining the above embodiment of the nucleotide sequence of phMK clone 1- (4), Sanger et al using ^[35 S] dATP [Sanger, F., et a
L., Proc. Natl. Acad. Sci. USA, 74 , 5463-5467 (197
The nucleotide sequence of the cDNA region was determined using a T7 sequence kit (Pharmacia) using the deoxy chain termination method of [7)]. As a result, it was revealed that the phMK clone lacked a part corresponding to the 5'end region of the mRNA encoding the protein of the present invention.

(7) Determination of 5'end region of hMK Therefore, the 5'end region of hMK was determined to determine the nucleotide sequence of all hMK genes. (a) Preparation of hMK probe That is, the phMK obtained in the above Example 1- (4) from the above λgt10 cDNA library was designated as "phMK-1", and this phMK
Example 1 An EcoRI fragment obtained by cleaving -1 cDNA with a restriction enzyme EcoRI
-It was labeled with [ ³² P] by the method of (1) and used as a labeled probe.

(B) Isolation of Recombinant Phage Clone from Genomic DNA Library Genome D derived from human placenta DNA purchased from Clontech
NA library (catalog number HL1067J; lot number 112)
5; EMBL-3 SP6 / T7 vector) and the labeled probe of (a) above were used to carry out plaque hybridization in the same manner as in Example 1- (2). As a result, No. 1 was selected from the obtained positive clones, and the selected clone was isolated and purified. Then, the recombinant phage clone obtained from the human placental DNA-derived genomic DNA library was designated as "λ
hgMK ”. Also, this λhgMK restriction enzyme XhoI /
The fragment obtained by cleavage with HindIII was further transformed into the plasmid phgMK according to the method of Example 1- (3) and (4) above.
A transformant was prepared. As a result, this fragment is about 1.8 Kb
Of different size and bound to pUC19 plasmid
-1 transformant was prepared.

(C) Preparation of hgMK-1 restriction enzyme map and determination of nucleotide sequence A hgMK-1 restriction enzyme map was prepared according to the method of Example 1- (5) above, and Example 1- (6) above was prepared. The nucleotide sequence of the 5'end region of the cDNA encoding the gene of the present invention contained in the recombinant plasmid DNA was determined according to the method described in 1. The result is shown in FIG. In FIG. 3, the scale shown at the top shows the nucleotide length (kilobase) based on the first base of cDNA. The middle row shows a cDNA clone phgMK-1 encoding the protein of the present invention. The lower arrow indicates each DNA
The direction and length of the base sequence determined for the fragment are shown. Usually, genomic DNA has a transcribed region to RNA and a non-transcribed region, and it is said that this boundary is clearly divided by Chambon's rule. This hgMK-1 also has a transcribed and translated region shown in FIG. It is divided into (white box) and non-transfer area. Furthermore, Kozak's rule [Kozak, M., Nucleic Acid Res., 12 ,
857-872 (1984)], the first translation region containing the initiation codon ATG was determined by searching the 5'region. Also,
This part had 84% homology with the same region of mouse. Short fragments (about 100 to 200 bp) obtained by digestion with various restriction enzymes shown in FIGS. 2 and 3 were ligated to pUC19 plasmid to prepare several transformants, and their nucleotide sequences were changed in the same manner as above. By determining (the direction of the arrow in the figure), the entire nucleotide sequence of phMK-1 and phgMK-1 was determined. As a result, the cDNA length of the above phgMK-1 plasmid was 1.8.
Kb, which has one site for each of XhoI, HindIII, and Sau3AI, and SmaI and HinfI
There were 3 sites each of which were cleaved by and 2 sites that were cleaved by ApaI.

The sequence of the human MK gene obtained from the results of Example 1- (6) and (7) is as shown in the sequence listing. The base sequence number shown in the sequence listing is 1 at the 5'end,
It is attached in the direction from the 5'end to the 3'end. The amino acid residues are numbered from N-terminal to C-terminal,
The start codon ATG is 1. The sequence of human MK is 56 in total, including the translated region and the 5'and 3'untranslated regions.
It consists of 3 bases. The translated region is 429 bases long and 143
It was found to correspond to a protein of individual amino acids. The homology with the mouse MK2 gene is 8 at the nucleic acid level.
2% and 87% at the amino acid level.

[0045]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 563 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Origin organism name: Homo sapiens Differentiation degree: fetal Tissue type: Kidney Direct origin Library: Human Fetal Kidney cDNA Library Sequence features Characteristic symbols: mat peptide Location: 1..429 Method of determining features: S

G 1 ATG CAG CAC CGA GGC TTC CTC CTC CTC ACC CTC CTC GCC CTG CTG GCG 49 Met Gln His Arg Gly Phe Leu Leu Leu Thr Leu Leu Ala Leu Leu Ala 5 10 15 CTC ACC TCC GCG GTC GCC AAA AAG AAA GAT AAG GTG AAG AAG GGC GGC 97 Leu Thr Ser Ala Val Ala Lys Lys Lys Asp Lys Val Lys Lys Gly Gly 20 25 30 CCG GGG AGC GAG TGC GCT GAG TGG GCC TGG GGG CCC TGC ACC CCC AGC 145 Pro Gly Ser Glu Cys Ala Glu Trp Ala Trp Gly Pro Cys Thr Pro Ser 35 40 45 AGC AAG GAT TGC GGC GTG GGT TTC CGC GAG GGC ACC TGC GGG GCC CAG 193 Ser Lys Asp Cys Gly Val Gly Phe Arg Glu Gly Thr Cys Gly Ala Gln 50 55 60 ACC CAG CGC ATC CGG TGC AGG GTG CCC TGC AAC TGG AAG AAG GAG TTT 241 Thr Gln Arg Ile Arg Cys Arg Val Pro Cys Asn Trp Lys Lys Glu Phe 65 70 75 80 GGA GCC GAC TGC AAG TAC AAG TTT GAG AAC TGG GGT GCG TGT GAT GGG 289 Gly Ala Asp Cys Lys Tyr Lys Phe Glu Asn Trp Gly Ala Cys Asp Gly 85 90 95 GGC ACA GGC ACC AAA GTC CGC CAA GGC ACC CTG AAG AAG GCG CGC TAC 337 Gly Thr Gly Thr Lys Val Arg Gln Gly Thr Leu Lys Lys Ala Arg Tyr 100 105 110 AAT GCT CAG TGC CAG GAG ACC ATC CGC GTC ACC AAG CCC TGC ACC CCC 385 Asn Ala Gln Cys Gln Glu Thr Ile Arg Val Thr Lys Pro Cys Thr Pro 115 120 125 AAG ACC AAA GCA AAG GCC AAA GCC AAG AAA GGG AAG GGA AAG GAC 430 Lys Thr Lys Ala Lys Ala Lys Ala Lys Lys Gly Lys Gly Lys Asp 130 135 140 TAGACGCCAA GCCTGGATGC CAAGGAGCCC CTGGTGTCAC ATGGGGCCTG GCCCACGCCAT 490 *** TCCCTCTCCCTCCATCTCTCCCAG CAGTGCCTTC

[Brief description of drawings]

FIG. 1 is a diagram showing a restriction enzyme map of a probe used for screening a gene of the present invention.

FIG. 2 is a diagram showing a restriction enzyme map and a nucleotide sequence determination method for a cDNA clone phMK encoding the protein of the present invention.

FIG. 3 is a cDNA clone phgMK- encoding the protein of the present invention.
FIG. 1 is a diagram showing a restriction enzyme map and a nucleotide sequence determination method of 1.

 ─────────────────────────────────────────────────── ─── Continuation of front page (72) Kenji Kadomatsu 2-chome Shiroyama, Kagoshima City, Kagoshima Prefecture 30-30-3 (72) Inventor Shuichiro Matsubara 6-46 Sakuragaoka Kagoshima City, Kagoshima Prefecture 105 (72) Inventor Takashi Muramatsu 3-26-9 Sakuragaoka, Kagoshima City, Kagoshima Prefecture

Claims (3)

[Claims] 1. A human MK gene. 2. The gene according to claim 1, which has a nucleotide sequence encoding the amino acid sequence shown in the sequence listing. 3. The gene according to claim 1, which has the nucleotide sequence shown in the sequence listing.