JPH0584087A - Acidic chitinase derived with ethylene of azuki bean - Google Patents

Abstract

PURPOSE:To obtain the title enzyme usable for breeding plants having high disease and insect pests and pathogenic germ resistances, having ability of hydrolyzing polysaccharides bonded with N-acetyl-D-glucosamine by beta-1,4 bond isolated from a primary leaf of azuki bean. CONSTITUTION:A primary leaf of azuki bean treated with ethylene is cut off, treated with 20ppm ethylene for 24 hours, a protein is extracted with a buffer solution of acetic acid having pH4.0 to give a crude extracted solution, which is subjected to ammonium sulfate salting out and then to anion exchange chromatography to collect a chitinase active fraction. The fraction is subjected to gel filtration and a chitinase fraction eluted at 21,000 molecular weight is recovered to give the objective protein which has an amino acid sequence deficient in an amino acid sequence from N end to 34 amino acid sequences among an amino acid sequence of the formula and chitinase activity of acting polysaccharides prepared by polymerizing N-acetyl-D-glucosamine by beta-(1,4) bond, hydrolyzing the bond and libreating N-acetyl-D-glucosamine.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a protein having chitinase activity and a DNA sequence encoding the protein, which can be used for breeding plants having high resistance to pests and pathogens.

[0002]

2. Description of the Related Art Chitinase acts on chitin, which is a polymeric polysaccharide in which N-acetyl-D-glucosamine is bound to β (1,4), and hydrolyzes β- (1,4) to give N- It has an activity of releasing acetyl-D-glucosamine.

Chitinase is distributed over a wide range of species from microorganisms to crustaceans, arthropods such as insects, and higher plants. These chitinases have unique and important roles in each species. For example,
In arthropods whose outer coat is composed of chitin, chitinase is indispensable for the process of molting during growth.

Although higher plants do not contain chitin as a constituent, chitinase is widely distributed in higher plants such as pea, tomato, melon, onion and cabbage. These chitinases are believed to be involved in the self-defense function of higher plants.

In nature, plants are also infected with phytopathogenic fungi, eaten by insects, and constantly in contact with foreign enemies. Upon receiving these invasions, plants also activate various defense reactions to counter external enemies. Plant chitinase is induced as one of these defense responses. It is believed that these chitinases decompose the cell wall of pathogens composed of chitin and the epidermis of insects to destroy or kill the pathogens and insects.

Further, the degradation products of chitinase such as cell walls of pathogenic bacteria have elicitor activity for inducing phytoalexin synthase, protease inhibitor, antibacterial protein, etc., which are antibacterial substances produced by plants, and induce chitinase. Will trigger various self-defense functions. That is, it can be considered that chitinase has an important function for the plants to exhibit disease resistance.

[0007] In agriculture, controlling the occurrence of diseases is a very important issue for improving productivity. Repeated famines in the past are often due to the loss of harvest due to the outbreak of plant diseases. Also, the fact that the yield has increased more than the increase in the cultivated area
Undoubtedly, successful control of disease is one of the factors.

The control of plant diseases has contributions from two different aspects: the development of pesticides and the breeding of disease resistant varieties. However, in recent years, as the concern about environmental problems has increased, there has been a concern that the use of large amounts of pesticides may adversely affect the ecosystem. Therefore, the control of plant diseases by breeding means of breeding cultivars with stronger disease resistance has come to be highlighted.

The resistance trait is introduced by crossing from closely related wild species and the like, but in most cases these wild species do not have the economic properties required for cultivated species,
To grow a practical cultivar requires many generations of crossing, and requires many years.

In recent years, recombinant DNA technology has progressed in plants as well, and by introducing the recombinant DNA technology into breeding that has conventionally required a long time, a breeding program can be performed more efficiently in a shorter period of time. Are expected to progress.

The improvement of the disease resistance was first achieved by the recombinant DNA.
This is the area where the technology was applied. For example, a virus-resistant plant was bred by introducing a virus coat protein gene into the plant.

[0012] As described above, chitinase not only has an action of directly attacking a pathogenic bacterium, but also has an action of activating a series of self-defense reactions possessed by plants, which is very important in the early stage of disease resistance expression. It is considered to have a function. Therefore, it is considered significant to take up the chitinase gene as a target for improving disease resistance by the recombinant DNA method. That is, it can be expected that strong disease resistance can be imparted to plants by manipulating the chitinase gene to increase its expression level or constitutively express it.

In order to enhance the disease resistance of plants by introducing the chitinase gene, it is essential to isolate the chitinase gene. The chitinase gene is already present in many microorganisms (eg JDG Jones, et al., EMBOJ., 5, 467-47).
3 (1986)) and common bean (KE Broglie, et a
L., Proc. Natl. Acad. Sci. USA, 83, 6820-6824 (198
6)), tobacco (H. Shinshi, et al., Proc. Natl. Acad.
Sci. USA, 84, 89-93 (1987)), cucumber (JP Metrau
x, et al., Proc. Natl. Acad. Sci. USA, 86,896-900
(1989)), potato (JJ Gaynor, Nucleic Acid Re
s., 16, 5210 (1988)), etc., but most of them are basic chitinases having a high isoelectric point or homology with it except cucumber chitinase. It was

In higher plants, chitinase has various isozymes and is considered to have functional differentiation. Among such isozymes, it is known that acidic chitinase having a low isoelectric point is secreted and accumulated in the intercellular space, and (T. Boller, Physiol. Mol. Plant Pa
thol., 33, 11-16 (1988)) It is considered that such an acidic chitinase is involved in the development of disease resistance.

Further, the substance involved in signal transduction in the earliest stage of disease resistance expression is ethylene, and it is considered that the above-mentioned acid chitinase is also induced by ethylene. It has been observed that basic chitinase is induced by ethylene in many plant species, but the induction of acid chitinase from cucumber by ethylene is not clear (JP Metraux, et al.
al., Proc. Natl. Acad. Sci. USA, 86, 896-900 (198
9)).

From the above viewpoints, in order to enhance the disease resistance by introducing the chitinase gene, it is necessary to isolate the ethylene-induced acid chitinase gene which is considered to be involved in the expression of disease resistance. was there.

[0017]

Therefore, the problem to be solved by the present invention is to isolate the gene of ethylene-induced acid chitinase.

[0018]

Means for Solving the Problems As a result of extensive studies, the present inventor has isolated and purified an ethylene-induced acid chitinase from primary leaves of azuki bean which has been treated with ethylene, and has determined the amino acid sequence of the N-terminal fragment of the protein. Were determined. Based on this, a probe was prepared by a PCR reaction, a cDNA encoding the protein was cloned from a cDNA library prepared from ethylene-treated azuki bean primary leaves, and its nucleotide sequence was determined. Escherichia coli AJ carrying a cDNA encoding this red bean acid chitinase
12645 has been deposited with the Institute of Microbial Science and Technology of the Ministry of International Trade and Industry and has been given the deposit number FERM P-12485.

That is, the present invention relates to a protein having a chitinase activity having the amino acid sequence of SEQ ID NO: 1 in which 34 sequences from the N-terminus are deleted from the amino acid sequence of SEQ ID NO: 1 in the sequence listing. The present invention also relates to a precursor protein of the protein having the chitinase activity, in which 34 amino acid sequences are added to the N-terminal serving as a secretory signal sequence. The present invention also relates to a DNA sequence encoding the protein or a DNA sequence encoding a protein having the amino acid sequence of the precursor protein of the protein.

In the chitinase of the present invention, as long as it has chitinase activity, one or several amino acid residues in the amino acid sequences shown in SEQ ID NOs: 1 and 2 of the sequence listing are replaced with other amino acid residues. And those in which one to several amino acids have been deleted from the N-terminus or C-terminus.

[0021]

[Examples] Hereinafter, specific examples will be described.

Example 1 Ethylene-Induced Acid Chitinase of Azuki Bean Chitinase from ethylene-treated Azuki primary leaves was purified as follows. The Azuki primary leaves 10 days after seeding were cut off, treated with 20 ppm of ethylene for 24 hours, and the protein was extracted with an acetate buffer of pH 4.0 to obtain a crude extract. For chitinase activity, colloidal chitin is reacted with a sample solution and the reducing sugar produced is analyzed by the method of Boller et al. (T. Boller, et al., Planta, 15
7, 22-31, (1983)). The crude extract was salted out with ammonium sulfate and then FPL manufactured by Pharmacia Co. equipped with a MonoQ column.
Anion exchange chromatography with C was performed to collect chitinase active fractions. Furthermore, F equipped with Surperose 6
The chitinase fraction eluted at a molecular weight of 21,000 by gel filtration was collected by PLC. Chitinase was purified by 90% or more by these operations. The amino acid sequence of the obtained protein was determined by a gas phase protein sequencer manufactured by Applied Biosystems, and the sequence up to the 40th position was the sequence described in SEQ ID NO: 3 in the sequence listing.

(Example 2 Acquisition of cDNA encoding azuki bean acid chitinase) Cloning of chitinase cDNA was carried out as follows. 20 μg by a method similar to that described in Example 1.
The primary leaves of Azuki bean were treated with ethylene, frozen with liquid nitrogen, and pulverized with a Waring blender. 80 this
The cells were suspended in ml of 4.2 M guanidine thiocyanate, 25 mM trisodium citrate, 0.1 M mercaptoethanol, 0.5% aqueous solution of lauroyl sarcosinate, and the tissue was completely disrupted with a polytron. After filtering with a nylon mesh, centrifugation was carried out at 20 ° C. for 20 minutes at 15,000 rpm to collect the supernatant. After performing the same centrifugation once again and collecting the supernatant, use the ultra-centrifuge swing rotor SRP28 made by Hitachi
9 ml of 5.7 M CsCl, 0.1 M EDTA (p
H 7.5) was overlaid, and RNA was precipitated by performing ultracentrifugation at 28,000 rpm at 20 ° C. for 24 hours. After discarding the supernatant, the precipitated R
NA was dissolved in 0.5 mM 0.5 M NaCl, and ethanol precipitation was performed according to a conventional method. The precipitate is 10 ml of 10 mM Tris-HCl (p
It was dissolved in H 7.5), 1 mM EDTA to obtain a crude RNA solution. Coarse R
The NA solution was passed through an oligo dT cellulose column according to a conventional method (T. Maniatis, et al., Molecular Cloning, 1, 7.
26-7.27 (1989)), poly (A) + RNA was recovered and
The RNA fraction was used. mRNA is cD manufactured by Amersham
It was subjected to NA synthesis kit to prepare cDNA. After adding an EcoRI linker to the prepared cDNA, it was incorporated into a λgt11 vector to construct a cDNA library. cDN
Screening of the A library was performed as follows. Based on the amino acid sequence of the chitinase N-terminal fragment determined by protein chemistry, an amino acid sequence corresponding to the 7th to 14th amino acid residues,
A DNA encoding an amino acid sequence corresponding to the 24th amino acid residue to the 31st amino acid residue is synthesized, and the DNA is used as a template for PCR reaction (H. Erliched: PCR Technologie).
The probe was amplified by logy, Stockton Press (1989), this fragment was labeled with 32P, and the cDNA library was screened. When the nucleotide sequence of the obtained cDNA was determined by the dideoxy method according to a conventional method, the DNA sequence described in SEQ ID NO: 2 in the sequence listing was obtained, which was SEQ ID NO: 3 in the sequence listing of chitinase determined in Example 1. It was confirmed that this cDNA is a chitinase cDNA. Also,
The entire amino acid sequence of chitinase deduced from this DNA sequence is shown in SEQ ID NOs: 1 and 2 in the sequence listing.

[0024]

INDUSTRIAL APPLICABILITY The present invention provides an ethylene-inducible acid chitinase, which is considered to be involved in the self-defense function of plants, and a DNA sequence encoding the same in Azuki bean, thereby having resistance to pathogens and pests. It makes it possible to breed plants.

[Sequence listing] SEQ ID NO: 1 Sequence length: 298 Sequence type: Amino acid Topology: Linear Sequence type: Protein Origin organism name: Vigna angularis Tissue type: Ethylene-treated primary leaves Sequence features Features : Sig peptide Presence position: -34. ． -1 Method of determining the characteristic: P Characteristic symbol: mat peptide Location: 1..264 Method of determining the characteristic: P Other information: Ethylene-induced acid chitinase of adzuki bean Sequence: Met Lys Pro Asn Met Ala Cys Leu Lys Gln Val Ser Ala Leu Leu Leu -30 -25 -20 Pro Leu Leu Phe Ile Ser Phe Phe Lys Pro Ser His Ala Gly Gly Ile -15 -10 -5 Ser Val Tyr Trp Gly Gln Asn Gly Asn Glu Gly Ser Leu Ala Asp Ala 1 5 10 Cys Asn Thr Gly Asn Tyr Lys Tyr Val Asn Ile Ala Phe Leu Phe Thr 15 20 25 30 Phe Gly Gly Gly Gln Thr Phe Gln Leu Asn Leu Ala Gly His Cys Asn 35 40 45 Pro Ser Ile Asn Asn Cys Asn Val Phe Ser Asp Gln Ile Lys Glu Cys 50 55 60 Gln Ser Lys Asp Ile Lys Val Leu Leu Ser Leu Gly Gly Ala Ser Gly 65 70 75 Ser Tyr Ser Leu Thr Ser Ala Asp Asp Ala Thr Gln Val Ala Asn Tyr 80 85 90 Ile Trp Asn Asn Phe Leu Gly Gly Gln Ser Ser Ser Arg Pro Leu Gly 95 100 105 110 Asp Ala Ile Leu Asp Gly Val Asp Phe Asp Ile Glu Ser Gly Thr Gly 115 120 125 Glu His Trp Asp Asp Leu Ala Ar g Ala Leu Lys Gly Phe Asn Ser Gln 130 135 140 Leu Leu Leu Thr Ala Ala Pro Gln Cys Pro Ile Pro Asp Ala His Leu 145 150 155 Asp Thr Ala Ile Lys Thr Gly Leu Phe Asp Ile Val Trp Val Gln Phe 160 165 170 Tyr Asn Asn Pro Pro Cys Gln Tyr Ser Ser Gly Asn Thr Asn Asp Leu 175 180 185 190 Ile Ser Ser Trp Asn Gln Trp Thr Ser Ser Gln Ala Lys Gln Leu Phe 195 200 205 Leu Gly Val Pro Ala Ser Thr Ala Ala Ala Gly Ser Gly Phe Ile Pro 210 215 220 Ala Asp Val Leu Thr Ser Gln Val Leu Pro Thr Ile Lys Gly Ser Ser 225 230 235 Lys Tyr Gly Gly Val Met Leu Trp Asp Arg Phe Asn Asp Gly Gln Ser 240 245 250 Gly Tyr Ser Gly Ala Ile Ile Gly Ser Val 255 260 SEQ ID NO: 2 Sequence length: 1089 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Origin Biological name: Vigna angularis Tissue Type: Ethylene-treated primary leaves Sequence features Characteristic symbols: CDS Location: 13..906 Method of determining features: P Characteristic Issue: sig peptide Location: 13..114 Characteristic determination method: P Characteristic symbol: mat peptide Location: 115..906 Characteristic determination method: S Sequence: GACAACACACTC ATG AAA CCT AAC ATG GCT TGC CTC AAA CAA GTT TCA GCC 51 Met Lys Pro Asn Met Ala Cys Leu Lys Gln Val Ser Ala -30 -25 CTG TTA CTT CCT CTG TTG TTC ATT TCC TTC TTC AAA CCC TCC CAC GCC 99 Leu Leu Leu Pro Leu Leu Phe Ile Ser Phe Phe Lys Pro Ser His Ala -20 -15 -10 GGA GGA ATT TCC GTC TAC TGG GGT CAA AAC GGT AAC GAG GGC TCC CTG 147 Gly Gly Ile Ser Val Tyr Trp Gly Gln Asn Gly Asn Glu Gly Ser Leu -5 1 5 10 GCC GAC GCA TGC AAC ACC GGC AAC TAC AAA TAC GTC AAT ATA GCA TTC 195 Ala Asp Ala Cys Asn Thr Gly Asn Tyr Lys Tyr Val Asn Ile Ala Phe 15 20 25 TTG TTC ACG TTC GGC GGC GGC CAG ACC CCG CAA CTG AAC CTT GCC GGC 243 Leu Phe Thr Phe Gly Gly Gly Gln Thr Phe Gln Leu Asn Leu Ala Gly 30 35 40 CAC TGC AAC CCC TCT ATC AAC AAC TGC AAC GTG TTC AGC GAC CAG ATC 291 His Cys Asn Pro Ser Ile Asn Asn Cys Asn Val Phe Ser As p Gln Ile 45 50 55 AAG GAG TGC CAG AGC AAG GAC ATC AAA GTG CTC CTG TCA CTA GGC GGC 339 Lys Glu Cys Gln Ser Lys Asp Ile Lys Val Leu Leu Ser Leu Gly Gly 60 65 70 75 GCC AGT GGC AGC TAC TCC CTC ACG TCC GCC GAT GAC GCA ACA CAG GTT 387 Ala Ser Gly Ser Tyr Ser Leu Thr Ser Ala Asp Asp Ala Thr Gln Val 80 85 90 GCC AAC TAC ATC TGG AAC AAC TTT CTC GGC GGG CAG TCG AGC TCC CGT 435 Ala Asn Tyr Ile Trp Asn Asn Phe Leu Gly Gly Gln Ser Ser Ser Arg 95 100 105 CCT CTG GGC GAC GCT ATT TTA GAC GGT GTC GAT TTC GAC ATC GAA TCA 483 Pro Leu Gly Asp Ala Ile Leu Asp Gly Val Asp Phe Asp Ile Glu Ser 110 115 120 GGC ACC GGT GAG CAT TGG GAT GAT CTC GCA AGA GCC CTA AAA GGG TTT 531 Gly Thr Gly Glu His Trp Asp Asp Leu Ala Arg Ala Leu Lys Gly Phe 125 130 135 AAT TCA CAG TTG CTC TTA ACT GCT GCA CCG CAG TGT CCG ATC CCT GAT 579 Asn Ser Gln Leu Leu Leu Thr Ala Ala Pro Gln Cys Pro Ile Pro Asp 140 145 150 155 GCT CAC TTG GAT ACT GCC ATC AAA ACT GGG CTC TTT GAC ATT GTT TGG 627 Ala His Leu Asp Thr Ala Ile Lys Thr Gly Leu Phe A sp Ile Val Trp 160 165 170 GTG CAA TTC TAC AAC AAC CCT CCT TGC CAG TAT TCG AGT GGC AAC ACC 675 Val Gln Phe Tyr Asn Asn Pro Pro Cys Gln Tyr Ser Ser Gly Asn Thr 175 180 185 AAC GAC CTC ATC AGT TCT TGG AAC CAG TGG ACC TCA AGC CAG GCG AAG 723 Asn Asp Leu Ile Ser Ser Trp Asn Gln Trp Thr Ser Ser Gln Ala Lys 190 195 200 CAG TTG TTT TTG GGA GTG CCA GCT TCT ACA GCA GCT GCT GGA AGT GGG 771 Gln Leu Phe Leu Gly Val Pro Ala Ser Thr Ala Ala Ala Gly Ser Gly 205 210 215 TTT ATT CCT GCT GAT GTG TTA ACT TCT CAG GTT CTT CCT ACC ATC AAG 819 Phe Ile Pro Ala Asp Val Leu Thr Ser Gln Val Leu Pro Thr Ile Lys 220 225 230 235 GGT TCT TCC AAG TAT GGA GGA GTC ATG CTG TGG GAC AGA TTC AAT GAC 867 Gly Ser Ser Lys Tyr Gly Gly Val Met Leu Trp Asp Arg Phe Asn Asp 240 245 250 GGT CAA AGC GGA TAT AGT GGT GCT ATC ATA GGA AGT GTT TAGTTTGTTTT 917 Gly Gln Ser Gly Tyr Ser Gly Ala Ile Ile Gly Ser Val 255 260 AGGTTGACATTACATATCCATATATTTAGATACTGTTTTCTGTCTTTGGAATAAGTAGCA 977 CCTTCCGTAGGATTTCTTTTCTTCCTACACACACATGTAGAGTGCTATGTGTTATT TATC 1037 ATATAAAATATGTCTCATCACAGTAAAAGAAAGTATAGATTATCTTCAAAAA 1089 SEQ ID NO: 3 Sequence length: 40 Sequence type: Amino acid Topology: Linear Sequence type: Protein Fragment type: N-terminal fragment Origin organism name: Vigna angularis Tissue type: Ethylene treated Primary leaf Sequence features Characteristic symbol: mat peptide Location: 1..40 Method by which the feature was determined: E sequence: Tyr Trp Gly Gln Asn Gly Asn Glu Gly Ser Leu Ala Asp Ala Cys Asn 1 5 10 15 Thr Gly Asn Tyr Lys Tyr Val Asn Ile Ala Phe Leu Phe Thr Phe Gly 20 25 30 Gly Gly Gln Thr Phe Gln Leu Asn 35 40

Claims (5)

[Claims] 1. An amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, which has an amino acid sequence in which 34 amino acid sequences are deleted from the N-terminal, and N-acetyl-D-glucosamine is β- Acts on the polysaccharide polymerized by the (1,4) bond,
A protein having chitinase activity, which retains the ability to release N-acetyl-D-glucosamine by hydrolyzing its β- (1,4) bond. 2. The protein according to claim 1, which has the amino acid sequence set forth in SEQ ID NO: 1 in the sequence listing. 3. A DNA sequence encoding the protein according to claim 1 or 2. 4. The DNA sequence according to claim 3, which has a nucleotide sequence in which 114 nucleotide sequences at the 5'end are deleted among the nucleotide sequences shown in SEQ ID NO: 2 in the sequence listing. 5. The DNA sequence according to claim 3, which has the base sequence shown in SEQ ID NO: 2 in the sequence listing.