JPH0576361A - Tissue plasminogen activator mutein - Google Patents

Abstract

PURPOSE:To obtain a new tpA mutein useful as a therapeutic agent for cardiac infarction, cerebral infarction, lung embolism and peripheral arteriovenous thrombosis. CONSTITUTION:The objective mutein being a tpA mutein from which a finger (F) domain, growth factor (E) domain and Kringle (K) 1 domain are lost and e.g. having an amino acid sequence of amino acid residue No.174 to 527 expressed by the formula and obtained from a cultured product of transformant transformed by a vector containing a recombinant DNA having a base sequence coding the above-mentioned mutein.

Description

Detailed Description of the Invention

[0001]

The present invention relates to tissue plasminogen activator (hereinafter sometimes abbreviated as tPA).
Mutein and technology for manufacturing it.

[0002]

BACKGROUND OF THE INVENTION A thrombus consisting of a fibrin reticulum is
It causes partial or complete occlusion of blood vessels and causes vascular diseases such as myocardial infarction, stroke, pulmonary embolism and peripheral venous thrombosis. Plasmin is one of the enzymes that dissolves such fibrin, but it usually exists in blood as an inactive precursor enzyme, plasminogen. t
PA converts plasminogen to plasmin. The produced plasmin acts on fibrin and decomposes into soluble peptides. Thus, tPA could be used as a thrombolytic agent [Camiolo et al., Proc. Soc. Exp. Biol.
Med.) 138 : 277-280 (1971) and Ranby et al., BioHimica Biophysicact Actor (Biochem. Biophy.
s. Acta) 704 : 461-469 (1982)]. However, when tPA is administered to human blood, the half-life of tPA is very short [Tiefehbrunn et al., Circulation
n) 71 : 110-116 (1985)]. This is tP in the liver
By the rapid degradation of A [Korninger et al., Thrombosis
And Hemostasis (Thromb. Haemostes.) 46 : 6
58-661 (1981)].

Further, in blood, various plasma protease inhibitors, particularly plasminogen activator inhibitor type 1 (PAI-1), type 2 (PAI-2),
The existence of plasminogen activator inhibitors such as type 3 (PAI-3) and protease nexin I has been revealed [Saksela and Rifkin, Annual Review of Cell Biology (Ann. Rev. Cell Biol.) 4 :
93-126 (1988) and Loskutoff et al., Progress in Hemostasis and Thrombosis.
mostasis and Thrombosis) (Coller, BS, ed., WB
Saunders Co., Philadelphia) pp87-115 (1989)], which form a complex with tPA and inhibit the action of tPA. For these reasons, it is necessary to administer a large amount of tPA in order to induce thrombolysis, and it has been reported that this often causes a generalized bleeding tendency and causes serious side effects. .

[0004]

Problems to be Solved by the Invention tPA is a protein consisting of 527 amino acid residues. For the tPA molecule,
N-terminal to finger (F) domain (amino acid residues 1-43), epidermal growth factor (E)
Domain (amino acid residue number 44-91), kringle (K) 1 domain (amino acid residue number 92-173), K2 domain (amino acid residue number 180-261), and protease (P) domain (amino acid residue number 262-527) exists for each domain [Pennica et al., Nature 30
1 : 214-220 (1983); Banyai et al., Febbs Letters (FE
BS Lett.) 163 : 37-41 (1983)]. The fibrin affinity characteristic of tPA is thought to be mainly derived from the K2 domain.

By deleting the entire domains of F, E and K1, the present inventors have made it possible to reduce the molecular weight of the tPA molecule without impairing the activity and affinity of fibrin, thereby delaying the clearance in the liver and reducing it in the blood. We expected that the half-life could be extended. It was thought that by further adding amino acid deletions or substitutions to this low molecular weight tPA mutein, inactivation by the protease inhibitor could be suppressed. In addition, tPA, which is microbiologically produced by recombinant DNA technology, contains cysteine residues, which form undesired intermolecular or intramolecular bonds, resulting in biologically inactive proteins. It is a cause of lowering the specific activity. Therefore, the present inventors
It was thought that microbiologically produced inactive or very low recombinant tPA could be converted to active tPA by denaturation and activation under appropriate conditions.

[0006]

[Means for Solving the Problems] The present inventors have proposed recombinant DNA technology and site-directed mutation (Site directed
modified tPA mutein by utagenesis), and as a result of diligent studies on their stability in blood, activity, inhibition by plasma inhibitors and biological activity, a mutein superior to the original tPA was found. I found it. Further, as a result of earnest research on a method for activating microbiologically produced tPA having no biological activity or very low activity, the optimum condition for activation was found. As a result of further research based on these findings, the present invention has been completed.

That is, the present invention is (1) F, E, K1
Of the tPA mutein (amino acid residues 174-527;
~ 179 amino acids may be deleted), and a further mutein of said tPA mutein,
(2) A transformant transformed with a vector containing the recombinant DNA having the nucleotide sequence encoding the mutein of (1) above, and (3) the recombinant DNA having the nucleotide sequence encoding the mutein of (1) above. And (4) the transformant transformed with the vector containing the recombinant DNA having the nucleotide sequence encoding the mutein of (1) above is cultivated in a medium, and the mutein is produced and accumulated in the culture. Is collected, and (5) is optionally activated by an activation treatment to produce the mutein. The tPA before mutation in the mutein of the present invention may be any tPA of warm-blooded mammals.

As described above, in the present invention, FEK1-deleted tP
A mutein further includes mutein,
This mutein is originally a mutation in the amino acid sequence of the original peptide or protein, and therefore the mutation includes deletion of constituent amino acids and substitution with other amino acids. As the deletion of the constituent amino acids,
An example is one in which at least one of the FEK1-deleted tPA mutein-constituting amino acids is deleted. Examples of the substitution with the other amino acid include those in which at least one of the FEK1-deleted tPA mutein-constituting amino acids is substituted with another amino acid. The number of defective constituent amino acids in the FEK1-deleted tPA mutein in which at least one constituent amino acid is deleted is as follows.
Any number may be used as long as the characteristics of the A mutein are not lost.
Examples of the defective constituent amino acids include amino acid residues of amino acid residue numbers 296 to 302 of tPA.

The number of amino acids to be substituted in the FEK1-deleted tPA mutein in which at least one constituent amino acid is replaced with another amino acid is the FEK1-deleted t
Any number may be used as long as the characteristics of the PA mutein are not lost. As the amino acid site to be substituted, one obtained by substituting a part or all of the amino acid residues between amino acid residue numbers 296 to 304 with another amino acid residue, or amino acid residue number 296
As an example thereof, a part or all of the region from No. 302 to 302 is deleted, and a part of the amino acid residue in the region from amino acid residue number 296 to 304 is replaced with another amino acid residue. Examples of the constituent amino acids before substitution are:
Examples include cysteine and substances other than cysteine (eg, aspartic acid, arginine). When the constituent amino acid before substitution is cysteine, the substituted amino acid is preferably, for example, a neutral amino acid. Specific examples of the neutral amino acid include glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine. In particular,
Serine and threonine are preferred.

When the constituent amino acid before substitution is other than cysteine, another amino acid substituted is, for example, the hydrophilicity, hydrophobicity or charge of the amino acid before substitution. Choose ones that have different properties than amino acids. Specifically, when the amino acid before substitution is aspartic acid, examples of the amino acid after substitution include asparagine, threonine, valine, phenylalanine, and arginine, but asparagine and arginine are particularly preferable. When the amino acid before substitution is arginine, the amino acids after substitution are glutamine, glutamic acid, threonine, leucine,
Examples thereof include phenylalanine, asparagine and aspartic acid, with glutamic acid or histidine being particularly preferred. When the amino acid before substitution is glutamic acid, tyrosine is preferred as the amino acid after substitution. The mutein of the present invention may be a combination of the above-mentioned deletions and substitutions.

In order to produce the mutein of the present invention, site-directed mutagenesis technology is employed in addition to conventional recombinant DNA technology. The technique is well known and is described by L.F.
RF) and Jay P. Lecoq (Lecoq, JP),
Genetic Engineering (Genetic Engineer
ing), Academic Press, Inc. (1983), pp. 31-50. Oligonucleotide-directed mutagenesis was performed by Smith, M. and Gillam,
S.), Genetic Engineering: Principles and Methods, Plenum Press (1981) Vol. 3, pp. 1-32.

In order to produce the structural gene encoding the mutein of the present invention, for example, (a) single-stranded DNA consisting of a single strand of the structural gene of tPA is hybridized with a mutant oligonucleotide primer ( b) DNA
A polymerase extends the primer to form a mutant heteroduplex, and (c) replicates this mutant heterodimer. The size of the oligonucleotide primer depends on the conditions required for stable hybrid formation of the primer to the gene region to be mutated, and on the limitations of currently available oligonucleotide synthesis methods. Factors to consider in designing oligonucleotides for use in oligonucleotide-directed mutagenesis (eg, overall size, size of the portion bypassing the mutation site) are M. Smith and S. Guilam. (Ibid.). In general, the total length of the oligonucleotide is such that it optimizes stable and unique hybridization at the mutation site, and the extensions from the mutation site to the 5'and 3'ends are DNA It is large enough to prevent the repair of mutations due to the exonuclease activity of the polymerase. The oligonucleotides used for mutagenesis in accordance with the present invention will typically have from about 12 to about 24 bases, preferably about 14 to about 20 bases, more preferably about 14 to about 18 bases. Contains. These are usually at least about 3 of the changed codons.
It contains the 3'side of each base.

[0013] For example, there are three possible methods for constructing a mutant tPA gene for the purpose of obtaining a mutein lacking FEK1-deleted tPA mutein-constituting amino acids. One is to delete the amino terminus of the FEK1-deleted tPA mutein, the second is to delete the central part of the FEK1-deleted tPA mutein, and third is to delete the carboxyl terminus of the FEK1-deleted tPA mutein. is there. In the case of deleting the amino terminus, the codon of the gene encoding the carboxyl terminus of the amino acid sequence to be deleted is changed to ATG encoding Met by using the site-directed mutagenesis method, and the 5'end of the codon is further changed. An appropriate restriction enzyme recognition site is generated on the side to facilitate ligation with the promoter.

When the amino acid sequence is deleted at its central portion, unique restriction enzyme recognition sites are generated at the 5'and 3'ends of the gene encoding the sequence to be deleted by using the site-directed mutagenesis method. Then, this site is digested with an enzyme, extracted, and religated to ligate based on the gene, whereby a gene encoding tPA lacking the target amino acid is completed. At this time, it goes without saying that the reading frame should not be displaced due to digestion with a restriction enzyme. When deleting the amino acid sequence on the carboxyl terminal side,
The codon of the gene encoding the amino terminal amino acid of the sequence to be deleted may be changed to a stop codon by site-directed mutation.

When producing the tPA mutein protein by site-directed mutation, it is recognized that a plurality of mutations may be made in the DNA sequence, that is, that the codon of the DNA corresponding to the amino acid is degenerate. I have to keep it. For example, as a method for constructing a mutant tPA gene in the case where a constituent amino acid is an amino acid other than cysteine and the mutein is obtained by substituting the amino acid with another amino acid, a codon is changed by an oligonucleotide primer. However, it goes without saying that the design of the oligonucleotide primer differs depending on which amino acid is changed.

The primer was M13 [Yanisch-Perror, C., Vieira, J., in which the single strand of the tPA gene was cloned.
Messing, Gene, 33 103-119 (1985), Messing
J. Methods in Enz
ymology), 101 20-78 (1983)], fd (R. Herrman at al.
Molecular and General Genetics (Mol.
Gen. Genet.), 177 231 (1980)], or φ × 174 (M. Smi
th and S. Gillam, Genetic Engineering
(Genetic Engineering), Plenum Press, Vol. 3 , ppl-3
2 (1981)] and hybridized to a single-stranded phage.
It is recognized that the phage can carry either the sense or antisense strand of the gene. When the phage carries the antisense strand, in addition to the mismatch with this codon, which determines the triplet encoding another amino acid, the primer is identical to the region of the sense strand that contains the codon to mutate due to codon degeneracy. It may not be. Similarly, when a phage carries the sense strand, it may not be complementary to the region of the sense strand that contains the codon to be mutated, except for the appropriate mismatch in the triplet that pairs with the codon to be deleted. Good. The conditions used for hybrid formation are described by M. Smith and S. Guilam (supra). The temperature is usually about 0 ℃
To 70 ° C, more usually in the range of about 10 ° C to 50 ° C. After hybridization, the primer is extended on the phage DNA by reaction with E. coli DNA polymerase I, T4 DNA polymerase, reverse transcriptase or other suitable DNA polymerase. The resulting dsDNA is T4DN
It is converted to closed circle dsDNA by treatment with a DNA ligase such as A ligase. D containing a single-stranded region
NA molecules can be destroyed by treatment with S1 endonuclease. The resulting mutagenized heterodimer is used to transform a host organism or cell that is capable of infection. Heterodimer replication by the host produces progeny from both chains. Following replication, the mutant gene is isolated from the mutant progeny of the strand and inserted into a suitable vector,
This vector is used to transform a suitable host organism or cell.

Next, phage DNA carrying the mutated gene is isolated and integrated into a plasmid. DN
As a plasmid incorporating A, for example, pBR322 derived from Escherichia coli [gene, 2 , 95 (1977)], pBR32
5 [Gene, 4, 121 (1978)], pUC12 [Gene, 19 , 2
59 (1982)], pUC13 [Gene, 19 , 259 (1982)],
PUB110 derived from Bacillus subtilis [Biochemical and Biophysical Research Communication (Bioch
emical and Biophysical Research Communication), 11
2 , 678 (1983)] and the like, but any other one can be used as long as it is replication-retained in the host. As a method for incorporating into a plasmid, for example, T. Maniatis et al., Molecular Cloning, Cold Spring Harbor Lab.
Oratory), page 239 (1982).

The cloned gene can be ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression type vector. As the vector, a plasmid derived from the above E. coli (eg, pBR322,
pBR325, pUC12, pUC13), a Bacillus subtilis-derived plasmid (eg, pUB110, pTP5, pC194), a yeast-derived plasmid (eg, pSH19, pSH15), or bioviruses such as λ phage, and retroviruses, animal viruses such as vaccinia virus, etc. Etc. The gene may have ATG as a translation initiation codon at its 5'end and TAA, TGA or TAG as a translation stop codon at its 3'end. Furthermore, in order to express the gene, a promoter is connected upstream thereof. The promoter used in the present invention may be any promoter as long as it is suitable for the host used for gene expression.

When the host for transformation is a genus Escherichia, T7 promoter, trp promoter, lac promoter, recA promoter,
λPL promoter, lpp promoter, etc., when the host is Bacillus, SPO1 promoter,
When the host is yeast, such as SPO2 promoter and penP promoter, PHO5 promoter, PGK
A promoter, GAP promoter, ADH promoter and the like are preferable. It is particularly preferable that the host is Escherichia and the promoter is T7 promoter, trp promoter or λpL promoter. When the host is an animal cell, SV40-derived promoter, retrovirus promoter and the like can be mentioned, and SV40-derived promoter is particularly preferable. A transformant is produced using the vector containing the recombinant DNA having the nucleotide sequence encoding the mutein thus constructed. Examples of the host include Escherichia, Bacillus, yeast, animal cells and the like.

Examples of the above Escherichia bacterium include Escherichia coli K12DH1 [Procedures of the National Academy of
Science (Proc. Natl. Acad. Sci. USA), 60 , 160
(1968)], JM103 [Nucleic Acids Research
(Nucleic Acids Research) 9 , 309 (1981)], JA221
[Journal of Molecular Biology (Jo
urnal of Molecular Biology)] 120 , 517 (1978)], H
B101 [Journal of Molecular Biology, 41 , 459 (1969)], C600 [Genetics (Genet
ics), 39 , 440 (1954)], MM294 [Procedures]
Of the National Academy of Science (Pro
c. Natl. Acad. Sci. USA) 73 , 4174 (1976)] and the like. Examples of the bacterium of the genus Bacillus include Bacillus subtilis, MI114 (Gene,
24 , 255 (1983)], 207-21 [Journal of Biochemistry 95 , 87 (198
4)] and the like. Examples of the yeast include Saccharomyces cerevisiae.
e) AH22R ~, NA87-11A, DKD-5D and the like. Animal cells include adherent cells such as monkey cells COS-7, Vero, Chinese hamster cells CH
O, mouse L cells, human FL cells and the like, and lymphoid cell lines such as mouse SP2 / 0 cells.

To transform the above Escherichia bacterium, for example, Proc. Natl. Acad. Sci. U.
SA), 69 , 2110 (1972); Gene, 17 , 107 (1982). To transform Bacillus, for example, Molecular & General Genetics
s), 168 , 111 (1979) and the like. Transformation of yeast is carried out, for example, according to the method described in Proc. Natl. Acad. Sci. USA, 75 ; 1929 (1978). For transforming animal cells, for example, Virology 52 , 456 (1
973).

Thus, a transformant transformed with the vector containing the recombinant DNA having the nucleotide sequence encoding the mutein can be obtained. The mutein is produced by culturing the transformant in a medium. When the host is culturing a transformant that is a bacterium of the genus Escherichia, a bacterium of the genus Bacillus, a liquid medium is suitable as the medium used for the culture, and among them, a carbon source necessary for the growth of the transformant,
A nitrogen source, an inorganic substance, etc. are contained. Examples of the carbon source include glucose, dextrin, soluble starch, and sucrose, and examples of the nitrogen source include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, and potato extract. Further, examples of the organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 6-8.

As a medium for culturing Escherichia bacteria, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journal of Experim
ents in Molecular Genetics), 431-433, Cold Spring
Harbor Laboratory, New York (1972)] is preferable. In order to work the promoter efficiently if necessary, for example, 3β-indolyl acrylic acid or isopropyl β-D-thiogalactopyranoside (IPT
Drugs such as G) can be added.

When the host is a bacterium of the genus Escherichia, the culture is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium of the genus Bacillus, the culture is usually carried out at about 15 to 40 ° C. for about 6 to 24 hours, and aeration and agitation can be added if necessary. When culturing a transformant whose host is yeast, for example, a Burkholder minimum medium [Bostian,
KL et al., Proc. Natl. Acad. Sci. US
A,) 77 , 4505 (1980)]. The pH of the medium is preferably adjusted to about 5-8. Culturing is usually about 20 ℃ ~ 35
Approximately 24-72 hours at ℃, add aeration and stirring as needed. When culturing a transformant whose host is an animal cell, the medium may be, for example, M containing about 5 to 20% fetal bovine serum.
EM medium [Science 122 , 501 (1952)],
DMEM medium [Virology, 8 , 396 (195
9)], RPMI1640 medium [The Journal of the American Medical Association (The Journal
of the American Medical Association) 199 , 519 (196
7)], 199 medium [Proceeding of the Society for Biological Medicine (Proceedin
g of the Society for the Biologcal Medicine) 73 , 1
(1950)] and the like. The pH is preferably about 6-8. Culturing is usually about 30-40 ℃, culturing time is about 15-60
Perform for a period of time and add aeration and agitation as needed.

Separation and purification of mutein from the above culture can be carried out, for example, by the following method. When the mutein is extracted from the cultured bacterial cells or cells, the bacterial cells or cells are collected by a known method after culturing, and the cells are suspended in a buffer solution containing a protein denaturing agent such as guanidine hydrochloride, and then the extracellular matrix After destroying the cells or cells by a method of eluting the protein, French press, ultrasonic waves, lysozyme and / or freeze-thawing, a supernatant containing mutein can be obtained by centrifugation. When the mutein accumulates in the cells as insoluble inclusion bodies, French press treatment, ultrasonic treatment, lysozyme treatment or a combination of these is used to destroy the cells and subject to centrifugation,
After collecting the inclusion bodies as a precipitate, the inclusion body can be solubilized with a protein denaturing agent to obtain a supernatant containing mutein. In order to purify mutein from the above-mentioned supernatant, appropriate separation and purification methods known per se can be combined. Known separation and purification methods for these include methods utilizing the difference in solubility such as salting out and solvent precipitation methods, folding methods, ultrafiltration methods, gel filtration methods, and SDS-polyacrylamide gel electrophoresis methods. Mainly by using difference in molecular weight, by using difference in charge such as ion exchange chromatography, by using specific affinity such as affinity chromatography, difference in hydrophobicity by reverse phase high performance liquid chromatography, etc. And a method of utilizing a difference in isoelectric points such as an isoelectric focusing method.

In the case of solubilization using a buffer containing a protein denaturing agent, an activation operation for removing the denaturing agent is incorporated in any process of separation and purification. In particular, when the extract-solubilized mutein does not have a disulfide bond to be cross-linked and a free SH group is present, or an erroneous disulfide bond is generated, an operation for forming a correct disulfide bond is performed. Incorporation results in the desired mutein having activity. As this operation, reduction with a reducing agent such as dithiothreitol and removal of the reducing agent by dialysis, or appropriate in a redox buffer solution containing reduced glutathione / oxidized glutathione or cysteine / cystine at an appropriate concentration Incubation at various temperatures, for example, about 0 to 50 ° C.

The mutein thus obtained has a long half-life in blood and is not inactivated by plasma protease inhibitors. Due to its low molecular weight, it has good permeability to thrombus and higher lytic activity. Therefore in
When used in vivo, side effects such as generalized bleeding tendency can be suppressed because the dose can be reduced. When the mutein of the present invention is produced in an E. coli transformant, it often accumulates as an insoluble inclusion body, so that it can be easily purified and obtained. Furthermore, since the number of disulfide bonds is smaller than that of tPA, which is the original substance, it has an advantage that activation of the inactive mutein in the insoluble inclusion body is easy.

Such a mutein is used for myocardial infarction, cerebral infarction,
It can be used as a therapeutic agent for pulmonary embolism and peripheral arteriovenous thrombosis. In order to use the mutein of the present invention as a medicine, as it is as a powder, or together with other pharmacologically acceptable carrier, excipient or diluent, a pharmaceutical composition (eg, injection, tablet, capsule, liquid, As an ointment, it can be safely administered parenterally or orally to a warm-blooded animal (eg, human, mouse, rat, hamster, rabbit, dog, cat). The injection is formulated according to a conventional method using, for example, physiological saline or an aqueous solution containing glucose and other auxiliary agents. Pharmaceutical compositions such as tablets and capsules can also be prepared according to a conventional method. When the mutein of the present invention is used as the above-mentioned medicine, for example, it is administered to the above-mentioned warm-blooded animal in an appropriate amount selected from the daily dose of about 0.1 to 20 mg / kg in consideration of the administration route, symptoms and the like. It

[0029]

[Effect] By deleting the FPA, E, and K1 domains of tPA, the tPA molecule can be reduced in molecular weight without impairing its activity and fibrin affinity, delaying its clearance in the liver and prolonging its half-life in blood, thereby increasing the half-life of tPA. This low molecular weight tPA mutein suppresses the side effects of large doses,
Furthermore, by adding deletions or substitutions of amino acids, inactivation by protease inhibitors is suppressed. Furthermore, a recombinant tPA which has been produced microbiologically by recombinant DNA technology and has no or very low biological activity is converted into an active tPA by once denaturing and then activating under appropriate conditions. Is.

In the present specification and drawings, when abbreviations of bases and amino acids are used, IUPAC-IUB Commis
It is based on the abbreviations based on ion on Biochemical Nomenclature or abbreviations commonly used in this field, and examples are given below. When amino acids may have optical isomers, they are L-forms unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxyribonucleic acid Cytidine triphosphate ATP: Adenosine triphosphate Tdr: Thymidine EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Gly (G): Glycine Ala (A): Alanine Val (V): Valine Leu (L): Leucine Ile (I) ): Isoleucine Ser (S): serine Thr (T): threonine Cys (C): cysteine Met (M): methionine Glu (E): glutamic acid Asp (D): aspartic acid Lys (K): lysine Arg (R): Arginine His (H): histidine Phe (F): phenylalanine Tyr (Y): tyrosine Trp (W): tryptophan Pro (P): proline Asn (N): asparagine Gln (Q): glutamine.

The deposit numbers and deposit dates of the respective transformants obtained in the following Examples to the Institute for Fermentation Research (IFO) and the Institute of Microbial Technology (FRI) of the Ministry of International Trade and Industry are shown below. It is as follows. Microorganism name IFO deposit number FRI deposit number Escherichia coli MM294 (DE3) / pLysS, pTB1133 IFO 15031 FERM BP-2882 April 17, 1990 May 1, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1134 IFO 15032 FERM BP-2883 April 17, 1990 May 1, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1277 IFO 15116 FERM BP-3199 December 6, 1990 December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1159 IFO 15117 FERM BP-3200 December 6, 1990 December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1161 IFO 15118 FERM BP-3201 December 6, 1990 Date December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTG1360 IFO 15166 FERM BP-3365 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1363 IFO 15167 FERM BP-3366 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1346 IFO 15168 FERM BP-3367 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1366 IFO 15169 FERM BP-3368 April 10, 1991 April 1, 1991 7th Esherichia coli MM294 (DE3) / pLysS, pTG1369 IFO 15170 FERM BP-3369 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTB1272 IFO 15172 Registered mail post number Heisei May 6, 3 Yodagawa b183 Esherichia coli MM294 (DE3) / pLysS, pTB1326 IFO 15173 Registered mail post number May 6, 1991 Yodagawa b183 Esherichia coli MM294 (DE3) / pLysS, pTB1335 IFO 15174 Registered mail post Number May 6, 1991 Yodagawa b183 Esherichia coli MM294 (DE3) / pLysS, pTB1354 IFO 15175 Registered mail post number May 6, 1991 Yodagawa b183 Esherichia coli MM294 (DE3) / pLysS, pTB1357 IFO 15176 IFO 15176 Underwriting number May 6, 1991 Yodagawa b183.

In the present specification and drawings, human tPA
Regarding the numbers of the constituent amino acids of Met, Met generated by the translation initiation codon in FIG. 1 is the first. The present invention will be described more specifically with reference to the following Reference Examples and Examples.
The present invention is not limited to these.

Reference Example 1 Construction of Plasmid Containing Gene Encoding Human tPA (1) Isolation of Plasmid Containing cDNA: cDNA synthesized from mRNA of primary culture of human foreskin pCD vector [Okayama et al., Molecular Cell Bio (See Molecular Cel1 Biology, 3 , 280 (1983)], and a cDNA library using Escherichia coli x1776 as a host was prepared by Dr. Okayama of the Institute for Microbial Diseases, Osaka University. From this cDNA library, the alkaline method (Birnboim. HC & Doly. J. Nucleic Acids Research, 1 , 1513 (197
9)], the plasmid DNA was extracted, and this DNA was infected with Escherichia coli DH1 to prepare a cDNA library using E. coli DH1 as a host consisting of about 2 × 10 ⁶ clones.

A cDNA library using Escherichia coli DH1 described above was prepared by using a nitrocellulose filter (Millipore, H
On the ATF filter, 10 sheets were spread so as to be about 5 × 10 ⁴ clones / filter, and two replica filters were prepared with each set of two as master filters to make a total of 20 replica filters. Escherichia coli on the replica filter was dissolved in 0.5N NaOH solution, and the exposed denatured plasmid DNA was immobilized on the filter [Grunstein,
M. & Hogness, DS, Proc. Natl. Aca
d. Sci. USA) 72 , 3961 (1975)].

On the other hand, human tPA reported by D. Pennica et al. [Nature 301 : 214 (1983)].
Based on the amino acid sequence of amino acid No. 248-260 (Asn-A
rg-Arg-Leu-Thr-Trp-Glu-Tyr-Cys-Asp-Val-Pro-Ser)
(SEQ ID NO: 1), Amino acid No. 489-501 (Arg-Met-Thr-Leu
-Val-Gly-Ile-Ile-Ser-Trp-Gly-Leu-Gly) (SEQ ID NO: 2) and amino acid No. 516-527-stop (Asn-Tyr-Leu-Asp-
Based on Trp-Ile-Arg-Asp-Asn-Met-Arg-Pro-Stop) (SEQ ID NO: 3), each oligonucleotide having a nucleotide sequence corresponding to these amino acid sequences AAC CGC AGG CTG ACG
TGG GAG TAC TGT GATGTG CCC TCC (SEQ ID NO: 4); CG
C ATG ACT TTG GTG GGC ATC ATC AGC TGG GGCCTG GGC
(SEQ ID NO: 5); AAC TAC CTA GAC TGG ATT CGT GAC AA
C ATG CGA CCGTGA (SEQ ID NO: 6) was chemically synthesized. A 50 μl reaction solution [oligonucleotide 0.1 μg, 50 mM Tris-HCl pH8.0, 10 mM MgCl 2] was added to this oligonucleotide using T4 polynucleotide kinase (Takara Shuzo).
_2, 10mM mercaptoethanol, 50μCiγ- ³² P AT
P (> 5000 Ci / mmole), 3 units T4 polynucleotide kinase] and reacted at 37 ° C. for 1 hour to label the 5 ′ end of the oligonucleotide with ³² P. Two oligonucleotides labeled by the above method were used as probes, and D
The NA was fixed to a fixed replica filter. The association reaction was performed with 5 × SSPE [180 mM containing 10 μCi probe]
NaCl, 10 mM NaH ₂ PO ₄ , 1 mM EDTA (pH 7.4)], 5 × Denhar
dt's, 0.1% SDS, 100 μg / ml denatured salmon sperm DNA
The reaction is carried out in 10 ml of the solution at 35 ° C. for 16 hours, and after the reaction, the filter is 5 × SSC [0.15M NaCl, 0.015M Sodium citrate]
% SDS solution at room temperature three times for 30 minutes and 45 ° C. for 30 minutes twice twice [T. Maniatis et al., “Molecular Cloning”]
Cold Spling Harbor Laboratory, P. 309 (1982)].

Radioautograms were taken from the washed filters, and strains that react with all of the three types of probes were searched by superimposing a set of two radioautograms of replica filters. 5 by this method
One strain [Escherichia coli K12 DH1 / TPA13] that reacts with three kinds of probes was obtained from × 10 ⁵ colonies.
From this strain, plasmid DNA (pTPA13) was prepared by the alkaline method [Nucleic Acids Res.
search) 1: 1513 (1979)] and purified by
Examination of the length of A revealed that it was 2.3 kb. However, it was found that this cDNA chain length did not encode up to the N-terminal side.

(2) Isolation of phage containing human tPA cDNA Human neuroblastoma using λgt10 as a vector, cDNA library (Clontech) with E. coli C600 and HflA as hosts, on a soft agar plate, about 1 10 clones were spread on each of 10 ⁵ clones, transferred to a nitrocellulose filter (HATF filter manufactured by Millipore), and the phage DNA that had been exposed and denatured by combing with a 0.5 N NaOH solution was dried and fixed on the filter. (Maniatis et al., “Molecular Cloning (Mo
leculler Cloning) '' cold Spring Harbor Laboratory,
p320, 1982). On the other hand, a 0.3 Kb DNA fragment obtained by digesting the plasmid pTPA13 obtained in (1) of Reference Example 1 with restriction oxygens EcoRI and NarI was labeled with ³² P by the nick translation method (Mainatis et al., Ibid., P109), and probed. And A labeled probe and a filter on which DNA is immobilized are added to a 5 × SS containing a labeled probe.
PE (0.9 M NaCl 50 mM sodium phosphate buffer (pH 7.4),
5 mM EDTA), 50% formamide, 5 × Denhar dt's, 0.1%
SDS, 100 μg / ml in denatured salmon sperm DNA solution 10 ml
Perform the association reaction at 42 ℃ for 16 hours, and after the reaction, filter
X SSC (1 x SSC = 0.15M NaCl, 0.015M sodium citrate), 0.1% SDS solution at room temperature for 30 minutes twice twice.
It was washed twice at 68 ° C. for 30 minutes each in a × SSC, 0.1% SDS solution. After the washed filter was dried, a radio-autogram was taken to search for a clone that reacts with the probe. Da from clone λTPA7 obtained by this method
vis et al. (Davis et al., "Advanced Bacterial
Genetics (Advanced Bacterial Genetics), cold
Sprihg Harbor Laboratory 1980) by Phage DN
As a result of extracting A and examining it with several kinds of restriction enzymes, the clone λTPA7 showed that human tP lacking in pTPA13.
It was found to have a cDNA encoding the N-terminal side of A. As a result of the above, the obtained pTPA13 and λTP
By combining the cDNA portion of A7, human t
It was possible to cover the entire PA coding area. The nucleotide sequence of the obtained cDNA portion was determined by the dideoxynucleotide synthesis chain termination method [Messing et al., "Nucleic Acids Research" 9 , 309, (198
1)]. As a result of comparison with the reported nucleotide sequence, the nucleotide sequence encoding amino acid No. 129 (Arg)
(No.552-554) It was found that CGG was replaced by TGG, and the encoded amino acid was replaced by Arg → Trp (FIG. 1) (SEQ ID NO: 7).

(3) Construction of plasmid for expressing animal cells The above-mentioned λTPA7 was cleaved with EcoRI to obtain 0.8 kb of D
The NA fragment was obtained. Meanwhile, plasmid pTB652 (Science 236 : 1116-1120, 1987) was transformed with EcoRI.
Ampicillin resistance gene obtained by digestion with Escherichia coli, MuLV-
Fragment containing LTR and SV40 promoter (about 4.2 kb)
Was prepared and ligated with both plasmid pλTPA7
E0.8 was built. A 2.1 kb DNA fragment obtained by digesting pλTPA7E0.8 with NarI and ClaI and a fragment containing tPA cDNA prepared by digesting plasmid pTPA13 with NarI and ClaI were ligated to construct plasmid pTB920 (FIG. 2). . Next, a 2.7 kb DNA fragment obtained by digesting pTB920 with BamHI was added to pT
B399 [Cell Structure and Function 12 : 208-217, 198
7] was inserted into the BamHI site to construct pTB926.
This plasmid was digested with ClaI to prepare a 4.0 kb fragment, and pTB348 (Cell Structure and Function 12 :
205-217, 1987) was incorporated into the ClaI site to construct plasmid pTB927 (Fig. 3).

Reference Example 2 Expression of human tPA cDNA in animal cells: monkey COS-7 cells ["Cell", 27 ,
279-288 (1981)] was subjected to monolayer culture (Falcon diameter 60 mm plastic dish) in DMEM medium containing 5% fetal bovine serum, and the medium was replaced with the same medium. After 4 hours of exchange, a known method [Graham et al., "Virology",
52 , 456 (1973)], plasmid p per dish
Calcium phosphate gel containing 10 μg of DNA of TB920 or pTB927 was prepared and added to cells.
Infected cells or pTB927 infected cells were obtained, respectively. Four hours later, the cells were treated with glycerol, and the pTB920-infected COS-7 cells or TB927-infected COS-7 cells were continuously cultured in a medium containing 5% fetal bovine serum. After 70 to 72 hours, the culture supernatant was collected, and the amount of tPA in the supernatant was measured by the EIA method. As a result, 200 μg to 400 μg / ml of tPA was detected, and it was confirmed that the above cDNA correctly encodes human tPA. Was given.

Reference Example 3 Method for measuring tPA enzyme activity using fibrin agarose plate containing plasminogen The plasminogen activating ability of tPA-1 and tPA-2 was measured using the fibrin agarose plate method containing plasminogen. did. A fibrin agarose plate containing plasminogen was prepared according to the following method. Bovine fibrinogen (Seikagaku Corporation)
After dissolving in 50 mM phosphate buffer (pH 7.4), lysine sepharose 4B chromatography was carried out for the purpose of removing bovine plasmin and bovine plasminogen, and the fractions having a flow through were collected. To 3 ml of this bovine fibrinogen solution (protein concentration 10 mg / ml), human plasminogen solution (10
u / ml, Nippon Pharmaceutical Industry Co., Ltd.)
1% (W / V) agarose [FMC, SeaKem (registered trademark) ME agarose, 12 mM NaCl-50 mM Tris-hydrochloric acid buffer solution (pH 7.5), which was kept at 50 ° C. for 2 minutes. Dissolved in 10 ml. Immediately after adding 10 μl of a bovine thrombin solution (100 u / ml, Mochida Pharmaceutical Co., Ltd.) and mixing, the solution was poured onto a gel bond film R (8 × 12.5 cm, FMC Co.) so as to have a uniform thickness, and then at room temperature. It was left still for 1 hour. A hole having a diameter of 3 mm was made in the fibrin agarose plate thus produced, and 5 μl of tPA-1, tPA-2 and a standard tPA solution (human melanoma cell-derived single-chain tPA, Biopool, Sweden) were added, and the temperature was 37 ° C. Was reacted for 3 hours. The diameter of the plaque was measured and the tPA enzyme activity in the subject was calculated from the standard curve.

Reference Example 4 Method for Measuring tPA Enzyme Activity Using Synthetic Substrate The ability to activate plasminogen of tPA-1 and tPA-2 was measured by using a tPA enzyme activity measurement kit (SPECTROLYSE ™ / fibr).
in, BioPool Co., Ltd.). Ie tPA-1, tPA-2 and standard tPA
50 μl solution and PAR solution (0.04 mg / ml human Glu plasminogen, 0.48 μmol / ml D-But-CHT-Lys-pNA) 1
After mixing with 50 μl of the mixture and leaving it on ice for 15 minutes, 5 μl of DESAFIB-X (registered trademark) (des AA fibrinogen decomposed by plasmin 2.67 mg / ml) was mixed and incubated at 37 ° C. for 1 hour. After 20 μl of STOP / fibrin solution was added to stop the reaction, the absorbance at 405 nm was measured and the tPA enzyme activity was calculated from the standard curve.

Example 1 Production of Recombinant DNA Having Nucleotide Sequence Encoding Mutein The plasmid pTB927 described in Reference Example 1 was digested with Bgl II to obtain a 2.1 kb DNA fragment, which was further digested with ApaLI and BstYI. A 1.3 kb fragment was obtained. After blunting both ends of this DNA by a reaction using a klenow fragment, a plasmid pTB1127 was constructed by incorporating it into the SmaI site of the plasmid pUC118 and used as a template for site-directed mutagenesis using a synthetic oligonucleotide. Oligonucleotide-directed in vitr
o Mutagenesis System (Amersham) and synthetic oligomers were used. Two synthetic oligomers were used and their sequences are as shown below. 5'-ACTGTTTCCCTCAGACATATGAGGGGTGCTGCAGAA-3 by using a '(36-mer) (SEQ ID NO: 8) 5'-GCACAGGAACCGCTCAGCAAAGATGGCAGCC-3' (31mer) ( SEQ ID NO: 9), C ¹⁷³ has a recognition site for simultaneously Ndel when substituted M Introduced human tPA cD
We were able to construct NA (Fig. 4). That is, a tPA mutein lacking the FEK1 domain from amino acid Nos. 1 to 173 of tPA was obtained. Further, when the K ²⁹⁶ -G ³⁰² is lost by using a simultaneously FEK1 domain deleted human recognition site has been introduced in DdeI tPA cD
We were able to construct NA (Fig. 4). FIG. 5 (SEQ ID NO: 10) shows the nucleotide sequences of tPA mutein and tPA-1 obtained by using
FIG. 6 (SEQ ID NO: 11) shows the nucleotide sequences of tPA mutein and tPA-2 obtained by using and the amino acid sequences deduced therefrom. The difference between these muteins and tPA is as follows. The resulting plasmid was designated as pTB1128, and the resulting plasmid was designated as pTB1132 (FIG. 7).

Example 2 Transformation of Escherichia coli with a gene encoding a human tPA mutein (1) Plasmid pTB11 for expressing human tPA mutein
Construction of 33 and pTB1134 pTB1128 and pTB1132 obtained in Example 1 were
It was digested with NdeI and BamHI to obtain a DNA fragment of about 1.1 kb each. This fragment was used as plasmid pET3c [Srudier,
FW (Brookhaven National Labs. USA)] and inserted into the NdeI-BamHI site to construct plasmids pTB1133 and pTB1134 (FIG. 7). (2) Transformation Next, Escherichia coli MM294 strain was incorporated with λ phage DE3 [Studier,
FW et al., Journal of Molecular Biology (J. Mol. Biol.), 189 : 113-130 (1986)] and lysogenized, and plasmid pLysS carrying the lysozyme gene of T7 phage [Studier, FW et al., Journal of
Molecular Biology (J. Mol. Biol.), 189 : 113
-130 (1986)] was introduced to prepare Escherichia coli MM294 (DE3) / pLysS strain. PTB1133 or pTB11 was added to this E. coli strain.
E. coli MM294 (DE3) / pLysS, pTB1133 or Escherichia coli MM294 (DE3) / pLysS, pTB1134 was introduced into each of these cells. Each of these strains is a human tPA mutein tPA-
1 or tPA-2 was produced.

Example 3 Culture of Escherichia coli expressing tPA-1 and tPA-2 Escherichia coli MM294 (DE3) / pLysS, PTB1133 obtained in Example 2
Alternatively, use MM294 (DE3) / pLysS, pTB1134 in a 200 ml Erlenmeyer flask equipped with a technique, 1% Bacto tryptone (Difco Laboratories, USA), 0.5% Bacto yeast extract (Difco Laboratories, USA), 0.5% Na.
Cl, 100 μg / ml sodium ampicillin and 10
40 ml of liquid medium containing μg / ml chloramphenicol
Was inoculated and cultured at 37 ° C. overnight with shaking. 10m of this culture
l in a 1,000 ml Erlenmeyer flask with 1% bactotryptone, 0.5% bacto yeast extract, 0.5% NaCl, 100
μg / ml ampicillin sodium and 10 μg / ml
Add 200 ml of the above liquid medium containing chloramphenicol to tPA-1 at 37 ° C and tPA-2 at 30 ° C.
After that, 0.1 mM of isopropyl-β-D-thiogalactopyranoside (Wako Pure Chemical Industries, Ltd.) was added, and the mixture was further shake-cultured for 4 hours to obtain a culture solution. The culture was centrifuged to collect the cells, which were frozen at -80 ° C and stored.

Example 4 Examination of activation condition of tPA-1 The frozen E. coli cells expressing tPA-1 obtained in Example 3 were suspended in 50 mM Tris-HCl buffer (pH 8.0). After sonicating the suspension (2A x 2 minutes, twice) to obtain a lysate, 1
A precipitate was obtained by centrifugation at 8,900 xg for 20 minutes. The precipitate was washed with 10 mM Tris-HCl buffer (pH 8.0) and
A precipitate was obtained by centrifugation at 8,900 xg for 20 minutes. This precipitate was further added with 0.25% (v / v) Triton X-100 10
Wash with mM Tris-HCl buffer (pH 8.0), 18,900 xg
A precipitate was obtained by centrifugation at 20 minutes. Extraction buffer (7M guanidine hydrochloride-0.1M KH ₂ PO ₄ (p
H7.5) -5 mM 2-mercaptoethanol) and added 4
Stir overnight at ° C. This extract was centrifuged at 18,900 xg for 20 minutes to obtain an extraction supernatant, and 7M guanidine hydrochloride-0.1
It was dialyzed against M KH ₂ PO ₄ (pH 7.5) -5 mM 2-mercaptoethanol. This extract was used for examination of activation conditions.

(1) Examination of Optimum pH tPA-1 extract was activated with buffers for activation having different pH, and then the tPA enzyme activity was measured. Various p
H activation buffer [2.5M urea-10mM NaCl-5mM
EDTA-10 mM lysine-0.5 mM reduced glutathione (G
SH) -50 mM sodium phosphate buffer (pH 6.0 and pH 7.0) containing 0.3 mM oxidized glutathione or 50 mM
Tris-HCl buffer (pH 8.0, pH 8.75 and pH 9.
5)] was degassed, then mixed with the tPA-1 extract and kept at 15 ° C. The activated tPA-1 solution was dialyzed against 50 mM Tris-HCl buffer (pH 8.0) -0.01% Tween 80, and then the tPA enzyme activity was measured according to Reference Example 3. p
The tPA enzyme activity showed the maximum value at H8.75 or pH 9.5 (Fig. 8). In FIG. 8, the activity at pH 8.75 is 100
%. (2) Optimal concentration of reduced glutathione (GSH) and oxidized glutathione (GSSG) Activation buffer containing reduced glutathione and oxidized glutathione (2.5M urea-50 mM Tris-HCl buffer) with different amounts ratio (PH8.75) -10mM NaCl-5mM EDTA-10m
M lysine) was degassed and then mixed with tPA-1 extract,
It was kept warm at 5 ° C. Activated tPA-1 solution at 50 mM
After dialyzing against Tris-HCl buffer (pH 8.0) -0.01% Tween 80, tPA enzyme activity was measured according to Reference Example 3. GSH / GSSG = 0.5mM / 0.3mM or 1mM / 0.6m
TPA enzyme activity showed the maximum value in M (Fig. 9, 0.5 mM GSH
/0.3mM GSSG activity 100%). (3) Examination of heat retention time for activation Activation buffer (2.5 M urea-50 mM Tris-HCl buffer (pH8.75) -10 mM NaCl-5 mM EDTA-10 mM lysine-0.5 mM GSH-0.3 mM GSSG) and tPA -1 extract was mixed and kept at 15 ° C. for 1, 2, 3, 4, 5 days. After activating the activated tPA-1 solution against 50 mM Tris-HCl buffer (pH 8.0) -0.01% Tween 80,
The tPA-1 enzyme activity was measured according to Reference Example 3. The enzyme activity increased with the number of days of incubation and reached a maximum at 3 days (Fig. 10).

Example 5 Extraction, activation and purification extraction and activation of tPA-1 and tPA-2 proteins The tPA-1 expressing E. coli frozen cells or tPA-2 expressing E. coli frozen cells obtained in Example 3 were treated with 50 mM Tris-HCl buffer (pH 8). .0) suspended in 50 ml. Sonicate suspension
18,900 after being subjected to (2A x 2 minutes, twice) to obtain a lysate
A precipitate was obtained by centrifugation at × g for 20 minutes. This precipitate
Wash with 50 ml of 10 mM Tris-HCl buffer (pH 8.0) and
A precipitate was obtained by centrifugation at 8,900 xg for 20 minutes. This precipitate was added to 10 m containing 0.25% (v / v) Triton X-100.
Wash with M Tris-HCl buffer (pH 8.0) at 18,900 xg
A precipitate was obtained by centrifugation for 20 minutes. Extraction buffer [7M guanidine hydrochloride-0.1M KH ₂ PO ₄ (pH
7.5) -5 mM 2-mercaptoethanol] (25 ml) was added and the mixture was stirred at 4 ° C overnight. This extract is 20 at 18,900 × g
Centrifugation was performed for 25 minutes to obtain 25 ml of the extraction supernatant. Extraction supernatant 25m
1M 7M guanidine hydrochloride-0.1M KH ₂ PO ₄ (pH 7.5)
After dialysis against -5 mM 2-mercaptoethanol, it was degassed and then activated buffer [2.5 M urea-50 mM Tris-HCl buffer (pH8.75) -10 mM NaCl-5 mM EDT]
A-10 mM lysine-0.5 mM reduced glutathione-0.3 mM oxidized glutathione] 1,250 ml, and after stirring, 15 ° C
It was kept warm at.

Purified and activated tPA-1 and tPA-2 solutions respectively 1,
250 ml of 50 mM Tris-HCl buffer (pH 8.0) -0.01% Twe
It was dialyzed against en80. The dialyzed solution was centrifuged at 18,900 xg for 20 minutes to obtain a dialysis supernatant. This dialysis supernatant was loaded onto a QAE Toyopearl 550C (Tosoh Corp.) column (column volume 70 ml) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) to adsorb proteins, and then the column was washed with the same buffer. After that, a linear concentration gradient elution method of 0 to 1.0 M NaCl (elution buffer volume 600 ml) was applied to tPA-1 and tPA-2.
Was eluted. The active fraction was loaded on a column (column volume 20 ml) of benzamidine sepharose 6B (Pharmacia, Sweden) equilibrated with 0.5 M NaCl-50 mM Tris-HCl buffer (pH 8.0) -0.01% Tween80 to load active tPA. After adsorption and then washing the column with the same buffer
Active tPA was eluted with 0.2 M arginine-0.5 M NaCl-50 mM Tris-HCl buffer (pH 8.0) -0.01% Tween80. By the above purification operation, tPA-1 preparation and tPA-2 preparation showing a single band by SDS-PAGE were obtained.

Example 6 Properties of tPA-1 and tPA-2 The following properties of the tPA-1 and tPA-2 proteins obtained in Example 5 were examined. (1) Unity and molecular weight Laemmli's method [Nature, 227, 680 (197)
0)] according to SDS-PAG under reducing and non-reducing conditions.
E was performed and stained with Coomassie Brilliant Blue. t
Both PA-1 and tPA-2 proteins showed a single band. The molecular weight is 39,500 for tPA-1 under reducing conditions,
tPA-2 is 39,000, and under non-reducing conditions, tPA-
1 was 35,000 and tPA-2 was 34,000. These are all theoretical values estimated from the primary structure (tPA-1 = 3
9,621, tPA-2 = 38,802) (Fig. 1)
1). (2) tPA Enzyme Activity Since tPA-1 or tPA-2 does not cause lysis plaque on a fibrin agarose plate containing no plasminogen, the present tPA-1 and tPA-2.
Was found to convert plasminogen to plasmin as a substrate. From the enzyme activity measured according to Reference Examples 3 and 4, and the protein concentration obtained by using bovine serum albumin as a standard protein according to the method of Lowry et al. [Journal of Biological Chemistry (JBC) 193, 265 (1951)], tPA-1 The specific activities of tPA-2 and tPA-2 were determined. The specific activity of tPA-1 determined by the fibrin agarose plate method containing plasminogen was 9.0 × 10 ^6.
The specific activity of IU / mg and tPA-2 was 1.9 × 10 ⁵ IU / mg. The specific activity of tPA-1 determined by the synthetic substrate method is 4.3 × 1.
The specific activity of 0 ⁵ IU / mg and tPA-2 was 1.8 × 10 ⁴ IU / mg.

(3) Inhibitory effect of PAI-1 on tPA-1 and tPA-2 Using the purified preparations of tPA-1 (molecular weight 40,000) and tPA-2 (molecular weight 39,000) obtained in Example 5, The inhibitory effect of plasminogen activator inhibitor-1 (PAI-1) on these tPA mutants was investigated. As a control, a natural single-chain tPA derived from melanoma cells (0.9 mg / ml, molecular weight 65,000) obtained from American Diagnostics (USA) was used. PA
I-1 (38 μg / ml, molecular weight 50,000) was obtained from Biopool. PAI-1 was activated by incubating it at 37 ° C. for 30 minutes in the presence of 4 M guanidine hydrochloride and then dialyzing it against PBS at 4 ° C. overnight. 0.25 pmoles (final concentration 0.005 μM) of tPA mutant and native tPA,
0.1M Tris-HCl (pH 8.4) /0.1M NaCl /
Different concentrations of activated PAI-diluted with 0.01% Tween80
1 was mixed (50 μl liquid volume) and reacted at room temperature for 20 minutes. After that, the residual tPA activity was measured using the SPECTROLYSE ™ / fibrin kit of Reference Example 4. When measuring this tPA activity, after adding PAR and DESAFIB-X ™ and stirring, 1 hour at 37 ° C. for tPA-1, tPA-2
In the case of, the reaction was carried out for 15 hours. The result is shown in FIG.
The vertical axis shows the relative value of residual activity in%. As is clear from this result, tPA-1 has the same level of P as that of natural tPA.
It was inhibited by AI-1, but tPA-2 is native t
It was less susceptible to inhibition by PAI-1 than PA or tPA-1. Thus it was possible to reduce the reactivity with PAI-1 by deleting the Lys ²⁹⁶ -Gly ^302.

Example 7 Production of Recombinant DNA Having Nucleotide Sequence Encoding Mutein (tPA-6 ′) The plasmid pTB1128 described in Example 1 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. I was there. Specific site-directed mutation is Oligonucleotide-di
rected in vitro Mutagenesis System (Amersham)
And a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5′-GGGCGACTCTTCGTGCTTGGCAAA-3 ′ (24mer) (SEQ ID NO: 12) By using this synthetic oligomer, R ²⁹⁸ ' ²⁹⁹ was replaced with E ²⁹⁸ ' ²⁹⁹ , and at the same time, a recognition site for MboII was introduced and the FEK1 domain was deleted. Human tPA cDNA
Could be constructed (Fig. 13). FIG. 14 shows the nucleotide sequences of tPA mutein and tPA-6 ′ obtained using this synthetic oligomer and the amino acid sequence deduced therefrom.
This is shown in (SEQ ID NO: 13). The difference between these muteins and tPA is as follows. The plasmid obtained as a result of using this synthetic oligomer was designated as pTB1038 (FIG. 13).

Example 8 Human tPA mutein (tPA
Transformation of Escherichia coli with the gene encoding -6 ') (1) Human tPA mutein expression plasmid pTB12
Construction of 77 pTB1038 obtained in Example 7 above was transformed with NdeI and BamH.
Cleavage with I gave a DNA fragment of about 1.1 kb. This fragment was cloned into the plasmid pET3c [Srudier, FW (Brookhaven N
adeal (from ational Labs. USA)]
-Incorporated into the BamHI site to construct plasmid pTB1277 (Figure 13). (2) Transformation Next, the E. coli MM294 (DE3) / pLysS strain shown in Example 2 was transformed with pT.
B1277 was introduced into E. coli MM294 (DE3) / pLysS, pTB1277
Made. These strains are human tPA mutein tPA
It was designed to produce -6 '.

Example 9 Mutein (tPA-7, tPA
Production of Recombinant DNA Having Nucleotide Sequence Encoding -8) The plasmid pTB1128 and pTB1132 synthetic oligonucleotides described in Example 1 were used as templates for site-directed mutagenesis. Oligonuc is a site-directed mutation
This was performed using a leotide-directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. Two synthetic oligomers were used and their sequences are as shown below. 5'-GCACAGGAAGTGATATCCGGGCGA-3 '(24mer) (SEQ ID NO: 14) By using 5'-GCACAGGAAGTGATATGCAAAGAT-3' (SEQ ID NO: 15), E ³⁰³ R ³⁰⁴ was replaced with Y ³⁰³ H ³⁰⁴ and at the same time. FE into which EcoRV recognition site has been introduced
A K1 domain deleted tPA mutein was obtained. Also,
By replacing E ³⁰³ R ³⁰⁴ with Y ³⁰³ H ³⁰⁴ , the human tPA lacking the K ²⁹⁶ -G ³⁰² deficient FEK1 domain.
The cDNA could be constructed (Figure 15). The nucleotide sequences of the tPA mutein and tPA-7 obtained by using and the amino acid sequences deduced therefrom are shown in FIG. 16 (SEQ ID NO: 1).
6), the tPA mutein and tPA-obtained by using
FIG. 17 (SEQ ID NO: 17) shows the nucleotide sequence of 8 and the amino acid sequence deduced therefrom. TP of these muteins
The difference from A is as follows. The resulting plasmid using pTB1128 was designated as pT
The plasmid obtained by using B1158 and pTB1132 was designated as pTB1160 (FIG. 15).

Example 10 Human tPA (tPA-7, t
Transformation of Escherichia coli with the gene encoding the mutein of PA-8) (1) Plasmid pTB11 for expressing mutein of human tPA
Construction of 59 and pTB1161 pTB1158 and pTB1160 obtained in Example 1 above were
It was digested with NdeI and BamHI to obtain a DNA fragment of about 1.1 kb each. This fragment was used as plasmid pET3C [Studier,
FW (Brookhaven National Labs. USA).] Was inserted into the NdeI-BamHI site to construct plasmids pTB1159 and pTB1160 (Fig. 1).
5). (2) Transformation Next, the E. coli MM294 (DE3) / pLysS strain shown in Example 2 was transformed with pT.
B1159 or pTB1161 was introduced into E. coli MM294 (DE3)
/ pLysS, pTB1159 or E. coli MM294 (DE3) / pLysS, p
I made TB1161 for each. These strains are human t
It was engineered to produce the PA mutein tPA-7 or tPA-8.

Example 11 Extraction of tPA-6 'protein,
Activation and purification extraction E. coli MM294 (DE3) / plysS, pTB127 obtained in Example 7
7 was cultured under the culture conditions shown in Example 3, and tPA-
A 6'expressing E. coli body was obtained. 20 g of this E. coli cell expressing tPA-6 'was suspended in 0.2 liter of 50 mM Tris-HCl buffer (pH 8.0). Sonicate suspension (2A x 2 minutes, 2 times)
Then, the lysate was obtained and then centrifuged at 18,900 xg for 20 minutes to obtain a precipitate. This precipitate was washed with 0.2 liter of 50 mM Tris-HCl buffer (pH 8.0) containing 0.5% (v / v) Triton X-100, and centrifuged at 18,900 xg for 20 minutes to obtain a precipitate. Furthermore, this precipitate was added to 50 mM Tris-HCl buffer.
It was washed with 0.2 liter of (pH 8.0) and centrifuged at 18,900 xg for 20 minutes to obtain a precipitate. Extraction buffer (7
0.1 liter of M guanidine hydrochloride-0.1 M KH ₂ PO ₄ (pH 7.5) -0.1 M _2- mercaptoethanol) was added, and the mixture was stirred at 4 ° C. overnight. This extract was centrifuged at 18,900 xg for 20 minutes to obtain 0.1 liter of extraction supernatant. Activation buffer (2.5 M urea 50 mM Tris-HCl buffer (pH 8.
75) -10 mM NaCl 5 mM EDTA-10 mM lysine 0.5 mM reduced glutathione] To 20 liters, add 0.1 liter of extraction supernatant and stir at 15 ° C for 1 hour, and then add oxidized glutathione to a final concentration of 0.3 mM. And kept warm at 15 ° C. The purified activated tPA-6 'solution was concentrated to 2 liters by ultrafiltration and then 50 mM Tris-HCl buffer (pH 8.5).
After dialyzing against 01% Tween 80, it was centrifuged at 18,900 × g for 20 minutes to obtain 2 liters of dialysis supernatant. This dialysis supernatant
A QAE Toyopearl 550C (Tosoh Corporation) column (column volume 150 ml) equilibrated with 50 mM Tris-HCl buffer (pH 8.5) was loaded to adsorb the protein, and then the column was washed with 0.3 liter of the same buffer, and then 0 TPA-6 'was eluted using a linear gradient elution method of ~ 1.0 M NaCl (elution buffer volume 1,200 ml). 0.2 liter of the active fraction was collected and dialyzed against 50 mM Tris-HCl buffer (pH 8.5) -0.01% Tween80. Lysine Sepharose 4B (Pharmacia, Sweden) column equilibrated with 0.2 liter of this dialyzed solution
(Column volume 40 ml) was loaded to adsorb tPA-6 ′. 0.5M NaCl-50mM Tris-HCl buffer (pH8.5) -0.01% T
After washing the column with 80 ml of ween80, 0.2M arginine-
0.5M NaCl-50mM Tris-HCl buffer (pH8.5) -0.01% Twee
tPA-6 'was eluted at n80. By the above purification operation, tPA-6 ′ showing a single band on SDS-PAGE
38 mg of a standard product was obtained.

Example 12 Various Properties of tPA-6 ′ The following properties of the tPA-6 ′ protein obtained in Example 11 were examined. (1) Unity and molecular weight Laemmli's method [Nature, 227,680 (197)
SDS-PAGE was carried out under reducing and non-reducing conditions according to (0)] and stained with Coomassie-Brilliant Blue. tPA-6 '
The protein showed a single band. Molecular weight is under reducing conditions
39,000 and 33,000 under non-reducing conditions. This value was in good agreement with the theoretical value estimated from the primary structure (tPA-6 '= 39,561) (Fig. 18). (2) tPA enzyme activity The enzyme activity measured according to Reference Examples 3 and 4 and Lowry
TPA-6 'from the protein concentration obtained by using bovine serum albumin as a standard protein according to the method described in [Journal of Biological Chemistry (JBC) 193,265 (1951)].
Was determined. The specific activity of tAP-6 'determined by the fibrin agarose plate method containing plasminogen was 3.1.
× a 10 ⁶ IU / mg, specific activity of tPA-6 'obtained from the synthetic substrate method was 2.6 × 10 ⁴ Iu / mg. (3) Inhibitory effect of PAI-1 on tPA-6 ′ PAI-1 was prepared using the purified preparation of tPA-6 ′ obtained in Example 11.
The inhibitory effect by As a control, recombinant single-chain tPA produced in CHO cells (Activase (registered trademark), Genentech, Inc., USA) and tPA-2 obtained in Example 5 were used. Activation of PAI-1 was according to Example 6. 125fmoles
Activase®, tPA-2 and tPA-6 ', 0.1M
Tris-HCl buffer (pH 8.4) -0.1M NaCl -0.01% Tween80
Mix with various concentrations of activated PAI-1 diluted with
μl) and reacted at room temperature for 20 minutes. After that, SP of Reference Example 4
Residual tPA activity was measured using the ECTROLYSE ™ / fibrin kit (Table 1). Table 1 Inhibition enzyme of tPA mutein by PAI-1 IC ₅₀ (fmole) Activase® 62.5 (1) tPA-2 383.6 (6.1) tPA-6 '> 8,000 (> 120) tPA-7 137.9 (2.2) tPA-8 353. 4 (5.7) IC ₅₀ : the amount of active PAI-1 required to inhibit the enzyme activity of 125 fmoles of Activase® and tPA mutein by 50%. From this table, it was found that tPA-6 'was more difficult to be inhibited by PAI-1 than tPA-2. So Arg ²⁹⁸ and Arg ²⁹⁹
By converting into Glu ²⁹⁸ and Glu ²⁹⁹ , the reactivity with PAI-1 could be significantly reduced.

[0057] Example 13 tPA-7 and PA-8 Extraction of the protein, the E. coli was obtained in activatable and purification extraction Example 10 MM294 (DE3) / pLysS pTB1159 and MM294 (DE3) / plysS, 1161 Example 3 The cells were cultured according to the above procedure to obtain tPA-7 and tPA-8-expressing E. coli cells. tPA-
Crushing of E. coli cells expressing 7 and tPA-8 and washing of the insoluble gene product were carried out according to Example 11. Extraction buffer [7 M guanidine hydrochloride-0.1 M KH ₂ PO ₄ (pH 7.5)] was added to the precipitates obtained from E. coli expressing tPA-7 and tPA-8, and the mixture was stirred at 4 ° C. for 2 hours. The liquid was centrifuged at 18,900 xg for 20 minutes to obtain each extraction supernatant. Activation buffer (2.5M Urea-50mM Tris-HCl buffer (pH
8.75) -10 mM NaCl-5 mM EDTA-10 mM lysine-0.5 mM reduced glutathione-0.3 mM oxidized glutathione] to tPA-7 and t
The extraction supernatant of PA-8 was added and the mixture was kept warm at 15 ° C. According to the method shown in Purification Example 5, QAE ion exchange chromatography was performed to elute tPA-7 and tPA-8. 50 mM Tris-HCl buffer (pH 8.0) -0.01% Tw for each active fraction
Loaded onto a benzamidine sepharose 6B column (column volume 20 ml) equilibrated with een80, and then washed with 0.5 M NaCl-50 mM Tris-HCl buffer (pH 8.0) -0.01% Tween80, and then 0.
2M Arginine-0.5M NaCl-50mM Tris-HCl buffer (pH8.0)
-TPA-7 and tPA-8 were eluted with -0.01% Tween80, respectively.
The active fraction was added to 50 mM Tris-HCl buffer (pH 8.0) -0.01%.
After dialyzing against Tween80, it was loaded on a lysine sepharose 4B column equilibrated with the same buffer. 0.5M NaCl-50mM
After washing the column with Tris-HCl buffer (pH8.0) -0.01% Tween80, 0.2M arginine-0.5M NaCl-50mM Tris-HCl buffer (pH8.0) 0.01% Tween80 was used to tPA-7 and tPA- 8
Were eluted respectively. By the above purification operation, tPA-7 standard preparation and tPA-8 standard preparation showing a single band by SDS-PAGE were obtained.

Example 14 Properties of tPA-7 and tPA-8 The following properties of the tPA-7 and tPA-8 proteins obtained in Example 13 were examined. (1) Unity and molecular weight Laemmli's method [Nature, 227,680 (1970)]
SDS-PAGE under reducing and non-reducing conditions according to
It was stained with Coomassie-Brilliant Blue. tPA-7 and tP
All A-8 proteins showed a single band. The molecular weights were calculated to be 39,000 for tPA-7 and 38,000 for tPA-8 under reducing conditions, and 33,000 for tPA-7 and 32,000 for tPA-8 under non-reducing conditions. All of these were in good agreement with the theoretical values estimated from the primary structure (tPA-7 = 39,636, tPA-8 = 38,817).
(Figure 19, Figure 20). (2) tPA enzyme activity The enzyme activity measured according to Reference Examples 3 and 4 and Lowry
TPA-7 and tPA from the protein concentration obtained by using bovine serum albumin as a standard protein according to the method of J. et al.
Each specific activity of -8 was determined. The specific activity of tPA-7 determined by the fibrin agarose plate method containing plasminogen was 9.4 × 10 ⁶ IU / mg, and the inactivity of tPA-8 was 4.4 × 10 ⁵ IU / mg.
Met. The specific activity of tPA-7 calculated from the synthetic substrate method is 4.1 ×
The specific activity of 10 ⁵ IU / mg, tPA-8 was 1.4 × 10 ⁴ IU / mg. (3) Inhibitory effect of PAI-1 on tPA-7 and tPA-8 The purified sample of tPA-7 and tPA-8 obtained in Example 13 was used to examine the inhibitory effect of PAI-1. Activase as a control
(Registered trademark) was used. PAI-1 activation, tPA and activated PA
Reaction with I-1 and measurement of residual tPA activity was according to Example 12 (Table 1). From this result, tPA-7 is inhibited by PAI-1 similarly to Activase (registered trademark), but tPA-8 is inhibited by Activa.
It was found that it was less likely to be inhibited by PAI-1 than se (registered trademark).

[0059]

Example 15 Production of Recombinant DNA Having a Nucleotide Sequence Encoding tPA-11 Mutein The plasmid pTB1128 described in Example 1 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-d
It was performed using an irected in vitro Mutagenesis System (Amersham) and a synthetic oligomer. Two synthetic oligomers were used and their sequences are as shown below. By using 5'-CCG CTC TCC TGG CGA CCT CCT-3 '(21mer) (SEQ ID NO: 18) 5'-TGG CGA CTT CTT GTG CTT GGC AAA-3' (24mer) (SEQ ID NO: 19), P ³⁰¹ PTB in which the NciI recognition site present at that site was eliminated without replacing
1431 was obtained. By using this plasmid, it was possible to construct an FEK1 domain-deleted human tPA cDNA in which R ²⁹⁸ ' ²⁹⁹ was replaced with K ²⁹⁸ ' ²⁹⁹ (Fig. 21). TPA mutein and tP obtained using
The nucleotide sequence of A-11 and the amino acid sequence deduced therefrom are shown in Fig. 22 (SEQ ID NO: 20).

The difference between this mutein and tPA is as follows.

Amino acid number The resulting plasmid was designated as pTB1334 (Fig. 23).

[0062]

Example 16 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-11 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 35 pTB1334 obtained in the above Example 15 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1335 was constructed (Figure 23). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1335 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1335 was made. This strain was engineered to produce the human tPA mutein tPA-11.

[0063]

Example 17 Preparation of Recombinant DNA Having Nucleotide Sequence Encoding tPA-12 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-TGG CGA TAG TAG GTG CTT GGC AAA-3 '(24mer) (SEQ ID NO: 21) By using this synthetic oligomer, F298 domain-deleted human tP in which R ²⁹⁸ ' ²⁹⁹ was replaced with D ²⁹⁸ ' ²⁹⁹ was used.
A cDNA could be constructed (Fig. 24). This tP
The nucleotide sequences of A mutein and tPA-12 and the amino acid sequences deduced therefrom are shown in FIG. 25 (SEQ ID NO: 22).

The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
TB1353 (Fig. 26)

..

Example 18 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-12 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 54 pTB1353 obtained in the above Example 17 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1354 was constructed (Figure 26).

(2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was transformed.
PTB1354 was introduced into the LysS strain, and Escherichia coli MM294 (D
E3) / pLysS, pTB1354 was made. This strain was engineered to produce the human tPA mutein tPA-12.

[0067]

Example 19 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-13 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5′-TGG CGA CTG CTG GTG CTT GGC AAA-3 ′ (24mer) (SEQ ID NO: 23) By using this synthetic oligomer, R ²⁹⁸ ' ²⁹⁹ was replaced with Q ²⁹⁸ ' ^299, and human tP lacking FEK1 domain was substituted.
A cDNA could be constructed (Fig. 27). This tP
The nucleotide sequence of A mutein and tPA-13 and the amino acid sequence deduced therefrom are shown in FIG. 28 (SEQ ID NO: 24). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was designated as TB1356 (Fig. 29).

[0068]

[Example 20] Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-13 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 57 The pTB1356 obtained in the above Example 19 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1357 was constructed (Figure 29). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1357 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1357 was made. This strain was engineered to produce the human tPA mutein tPA-13.

[0069]

Example 21 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-14 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using a synthetic oligonucleotide. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5′-TGG CGA CGC TGC GTG CTT GGC AAA-3 ′ (24mer) (SEQ ID NO: 25) By using this synthetic oligomer, R ²⁹⁸ ' ²⁹⁹ was replaced with A ²⁹⁸ ' ²⁹⁹ , and the FEK1 domain-deleted human tP was deleted.
A cDNA could be constructed (Fig. 30). This tP
The nucleotide sequence of A mutein and tPA-14 and the amino acid sequence deduced therefrom are shown in FIG. 31 (SEQ ID NO: 26). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was designated as TB1359 (Fig. 32).

[0070]

Example 22 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-14 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 60 pTB1359 obtained in the above Example 21 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1360 was constructed (Fig. 32). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1360 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1360 were made. This strain was engineered to produce the human tPA mutein tPA-14.

[0071]

Example 23 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-15 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-TGG CGA CCT ATC GTG CTT GGC AAA-3 '(24mer) (SEQ ID NO: 27) By using this synthetic oligomer, R ²⁹⁸ becomes D ^298.
FEK1 domain-deleted human tPA cDNA substituted with
Could be constructed (Fig. 33). The base sequence of this tPA mutein and tPA-15 and the amino acid sequence deduced therefrom are shown in FIG. 34 (SEQ ID NO: 28). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
TB1362 (Fig. 35).

[0072]

[Example 24] Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-15 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 63 pTB1362 obtained in the above Example 23 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1363 was constructed (Figure 35). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1363 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1363 was created. This strain was engineered to produce the human tPA mutein tPA-15.

[0073]

Example 25 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-16 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5′-TGG CGA GTC CCT GTG CTT GGC AAA-3 ′ (24mer) (SEQ ID NO: 29) By using this synthetic oligomer, R ²⁹⁹ becomes D ^299.
FEK1 domain-deleted human tPA cDNA substituted with
Could be constructed (Fig. 36). The nucleotide sequence of this tPA mutein and tPA-16 and the amino acid sequence deduced therefrom are shown in FIG. 37 (SEQ ID NO: 30). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was designated as TB1345 (Fig. 38).

[0074]

Example 26 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-16 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 46 pTB1345 obtained in Example 25 above was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1346 was constructed (Figure 38). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1346 was introduced into the LysS strain, and Escherichia coli MM294 (D
E3) / pLysS, pTB1346 was made. This strain was engineered to produce the human tPA mutein tPA-16.

[0075]

Example 27 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-17 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-TGG CGA CTT CTC GTG CTT GGC AAA-3 '(24mer) ( SEQ ID NO: 31) By using this synthetic oligomer, R ^298' FEK1 domain deleted human tP ^{that 299} is replaced with E ²⁹⁸ K ²⁹⁹
A cDNA could be constructed (Fig. 39). This tP
The nucleotide sequence of A mutein and tPA-17 and the amino acid sequence deduced therefrom are shown in FIG. 40 (SEQ ID NO: 32).

The difference between this mutein and tPA is as follows.

Amino acid number The plasmid obtained by using this synthetic oligomer is
It was set to TB1365 (Fig. 41).

[0078]

Example 28 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-17 (1) Plasmid pTB13 for expressing mutein of human tPA
Construction of 66 The pTB1365 obtained in Example 27 above was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1366 was constructed (Figure 41). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1366 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1366 was made. This strain was engineered to produce the human tPA mutein tPA-17.

[0079]

Example 29 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-18 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-TGG CGA CTC CTT GTG CTT GGC AAA-3 '(24mer) (SEQ ID NO: 33) By using this synthetic oligomer, R ²⁹⁸ ' ²⁹⁹ was substituted with K ²⁹⁸ E ²⁹⁹ for deletion of FEK1 domain-deleted human tP.
A cDNA could be constructed (Fig. 42). This tP
The nucleotide sequences of A mutein and tPA-18 and the amino acid sequences deduced therefrom are shown in FIG. 43 (SEQ ID NO: 34). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was designated as TB1368 (Fig. 44).

[0080]

Example 30 Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-18 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 69 The pTB1368 obtained in Example 29 above was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1369 was constructed (Figure 44). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1369 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1369 was made. This strain was engineered to produce the human tPA mutein tPA-18.

[0081]

Example 31 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-5 Mutein The plasmid pTB1431 described in Example 15 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-GCA CAG GAA CTC CTC TCC TGG -3 '(21mer) (SEQ ID NO: 35) By using this synthetic oligomer, R ³⁰⁴ is converted to E ^304.
FEK1 domain-deleted human tPA cDNA substituted with
Could be constructed (Fig. 45). The nucleotide sequence of this tPA mutein and tPA-5 and the amino acid sequence deduced therefrom are shown in FIG. 46 (SEQ ID NO: 36). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was set to TB1271 (FIG. 47).

[0082]

[Example 32] Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-5 (1) Plasmid pTB12 for expressing human tPA mutein
Construction of 72 pTB1271 obtained in the above Example 31 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1272 was constructed (Figure 47). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1272 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1272 was made. This strain was engineered to produce the human tPA mutein tPA-5.

[0083]

EXAMPLE 33 Extraction of tPA-5 protein, activation, purification and properties extraction, activation, purification Example 32 Escherichia coli obtained in MM294 (DE3) / p
LysS and pTB1272 were cultured under the culture conditions shown in Example 3 to obtain tPA-5-expressing Escherichia coli. Example 1
According to the method described in 3, the extraction supernatant of tPA-5 protein obtained from 3 liters of cultured cells was added to the activation buffer for activation, and QAE-ion exchange column chromatography, benzemidine sepharose 6B was used. Column chromatography and lysine sepharose 4B column chromatography were performed to obtain a purified sample. Yield: 1.5
mg. Properties (1) Singleness and molecular weight Laemmli's method [Nature, 227, 680 (19
70)] and SDS-PAG under reducing and non-reducing conditions.
Performed E. tPA-5 showed a single protein band. The molecular weight was calculated to be 39,500 under reducing conditions and 35,000 under non-reducing conditions. (2) Inhibitory effect of PAI-1 According to the method described in Example 12, the inhibitory effect of PAI-1 on the purified preparation was examined. As a result, IC ₅₀ was 130 fmoles.
It was calculated as s (2.1 times that of Activase).

[0084]

Example 34 Production of Recombinant DNA Having Nucleotide Sequence Encoding tPA-6 Mutein The plasmid pTB1271 described in Example 31 was used as a template for site-directed mutagenesis using synthetic oligonucleotides. Site-directed mutation is Oligonucleotido-
This was performed using a directed in vitro Mutagenesis System (Amersham) and a synthetic oligomer. The sequences of the synthetic oligomers used are shown below. 5'-TGG CGA CTC TTC GTG CTT GGC AAA-3 '(24mer) (SEQ ID NO: 37) By using this synthetic oligomer, R ²⁹⁸ ' ²⁹⁹ '
³⁰⁴ can build FEK1 domain deleted human tPAcDNA substituted on E ^{298 '299' 304} (Figure 48).
The nucleotide sequences of this tPA mutein and tPA-6 and the amino acid sequences deduced therefrom are shown in FIG. 49 (SEQ ID NO: 38). The difference between this mutein and tPA is as follows. Amino acid number The plasmid obtained by using this synthetic oligomer is
It was designated as TB1325 (Fig. 50).

[0085]

Example 35: Transformation of Escherichia coli with genes encoding human tPA mutein and tPA-6 (1) Plasmid pTB13 for expressing human tPA mutein
Construction of 26 pTB1325 obtained in the above Example 34 was transformed with NdeI and B
It was cleaved with amHI to obtain a DNA fragment of about 1.1 kb. This fragment was used as plasmid pET3C [Srudier, FW (B
(Rookhaven National Labs. USA)
At the NdeI-BamHI site of
TB1326 was constructed (Figure 50). (2) Transformation Next, the Escherichia coli MM294 (DE3) / p shown in Example 2 was obtained.
PTB1326 was introduced into the LysS strain, and E. coli MM294 (D
E3) / pLysS, pTB1326 was created. This strain was engineered to produce the human tPA mutein tPA-6.

[0086]

Example 36 tPA-6 protein extraction, activation, purification and properties extraction, activation, purification Example 35 Escherichia coli obtained in MM294 (DE3) / p
LysS and pTB1326 were cultured under the culture conditions shown in Example 3 to obtain tPA-6-expressing Escherichia coli. Example 1
According to the method described in 3, the extraction supernatant of tPA-6 protein obtained from 3 liters of cultured bacterial cells was added to the activation buffer to activate it, and QAE-ion exchange column chromatography, benzemidine sepharose 6B was used. Column chromatography and lysine sepharose 4B column chromatography were performed to obtain a purified sample. Yield: 11.2
mg. Properties (1) Singleness and molecular weight Laemmli's method [Nature, 227, 680 (19
70)] and SDS-PAG under reducing and non-reducing conditions.
Performed E. tPA-6 showed a single protein band. The molecular weight was calculated to be 39,500 under reducing conditions and 35,000 under non-reducing conditions. (2) Inhibitory effect of PAI-1 According to the method described in Example 12, the inhibitory effect of PAI-1 on the purified preparation was examined. As a result, IC ₅₀ was> 8,000f.
It was calculated as moles (> 120 times that of Activase).

[0087]

[Example 37] tPA-11, 12, 13, 14, 1
5,16,17,18 protein extraction, activation and purification extraction, activation E. coli MM294 (DE3) / obtained in Examples 16, 18, 20, 22, 24, 26, 28 and 30 respectively
pLysS, pTB1355, MM294 (DE3) /
pLysS, pTB1354, MM294 (DE3) /
pLysS, pTB1357, MM294 (DE3) /
pLysS, pTB1360, MM294 (DE3) /
pLysS, pTB1363, MM294 (DE3) /
pLysS, pTB1346, MM294 (DE3) /
pLysS, pTB1366 and MM294 (DE3)
/ PLysS, pTB1369 was cultured under the culture conditions shown in Example 3, and tPA-11,12,13,14,1.
E. coli bodies expressing 5, 16, 17 and 18 were obtained. Example 1
According to the method described in 3, the extraction supernatant of tPA mutein protein obtained from 3 liters of the cultured bacterial cells was added to the activation buffer to activate the protein. For each of the purified activated tPA muteins, QAE-ion exchange column chromatography, benzemidine sepharose 6B according to the method described in Example 13.
Column chromatography and lysine sepharose 4B column chromatography were performed to obtain a purified sample. Yield: tPA-11, 2.3 mg: tPA-12, 7.0
mg: tPA-13,3.4 mg: tPA-14,2.
5 mg: tPA-15, 4.6 mg: tPA-16,
9.6 mg: tPA-17, 2.0 mg: tPA-1
8,1.5 mg.

[0088]

[Embodiment 38] tPA-11, 12, 13, 14, 1
Properties of 5, 16, 17, 18 Proteins The following properties of the tPA mutein protein obtained in Example 37 were examined.

(1) Unity and molecular weight Laemmli's method [Nature, 227 , 680 (19
70)] and SDS-PAG under reducing and non-reducing conditions.
Performed E. Each of the above tPA muteins showed a single protein band. Molecular weight under reducing conditions is 39,500
And the molecular weights under non-reducing conditions were calculated to be 35,000, respectively.

(2) Inhibitory effect of PAI-1 According to the method described in Example 12, the inhibitory effect of PAI-1 on the purified preparation was examined (Table 2).

Table 2 tPA muteins according to PAI-1
Inhibitory enzyme IC ₅₀ * (fmole) Activase (registered trademark) 62.5 (1) tPA-11 90.0 (1.4) tPA-12> 5000 (> 80) tPA-13> 5000 (> 80) tPA -14> 5000 (> 80) tPA-15 188 (3.0) tPA-16 375 (6.0) tPA-17 900 (14.4) tPA-18 325 (5.2) * IC _{50 of} 125 fmoles. Activase (registered trademark) and t
The amount of active PAI-1 required to inhibit the enzymatic activity of PA mutein by 50%. From this table, it is clear that the reactivity between tPA mutein and PAI-1 is markedly reduced in each case as compared with the reactivity between Activase and PAI-1.

[0092]

Example 39 Prolongation of half-life in blood The half-life in blood of plasminogen activator was measured using rabbits. TPA-2 and Activase (registered trademark) (protein content 0.42 mg / kg) were administered once from the rabbit ear vein, and blood was continuously collected from the catheter inserted into the jugular vein. Blood is citrated plasma until measurement at -80 ℃
The amount of tPA antigen in the sample was stored in sandwich ELI.
It was measured by the SA method. The obtained results are shown in FIG. 51 and Table 3. Area under the plasma concentration-time curve of tPA-2 (AUC
∞) is about 8 times larger than that of Activase (registered trademark), indicating that it is difficult to disappear from the blood. It was considered that the increase in AUC∞ of tPA-2 was mainly due to the prolongation of the blood half-life (t1 / 2α) in the α phase. Table 3 Pharmacokinetic parameters when administering tPA-2 and Activase (registered trademark) to rabbits tPA-2 Activase (registered trademark) t1 / 2 α (min) 6.6 1.5 t1 / 2 β (min ) 37 22 AUC (0 → ∞) (ng · min / ml) 147655 18475 Cl (ml / min / kg) 2.9 24.4

[0093]

[Example 40] Thrombolytic activity of tPA-6 'Rabbit jugular vein model [Journal of Clinical
Investigation (J. Clin. Invests
t. ), 71, 368 (1983)].
The thrombolytic effect of 6'was investigated. Human blood and thrombin were administered to the jugular vein of a rabbit to form a thrombus, and then tPA-
6 '(0.5 mg / kg, 0.1 mg / kg) and A
Ctivase (registered trademark) (0.5 mg / kg) was administered once via the ear vein, and 1 hour later, the wet weight of thrombus, the amount of fibrinogen and the α ₂ PI activity were measured. The obtained results are shown in FIG. The administration of 0.5 mg / kg of tPA-6 ′ reduced the wet weight of thrombus to 23% of that of the control.
Administration of 0.5 mg / kg of ivase® reduced the dose to 42%. On the other hand, 0.1 mg / of tPA-6 '
The wet weight of thrombus was reduced to 42% by the administration of kg. The amount of fibrinogen and α ₂ PI activity did not change compared with before administration. From these results, tPA-6 ′ is Acti
It was revealed that a dose of about ⅕ of Vase (registered trademark) has an equivalent thrombolytic effect.

[0094]

[Effect] The tPA mutein obtained in the present invention has a long half-life in blood and is not inactivated by a plasma protease inhibitor. Further, since it has a low molecular weight, it has good permeability to thrombus and higher lytic activity. Therefore
When used in vivo, the dose can be reduced and the side effects of systemic bleeding tendency can be suppressed. Also,
When this mutein is produced in an E. coli transformant,
Since it accumulates as an insoluble inclusion body, it can be easily purified and obtained. Furthermore, since the number of disulfide bonds is smaller than that of natural tPA, there is an advantage that activation of inactive mutein in the insoluble inclusion body is easy. Such muteins can be used as therapeutic agents for myocardial infarction, cerebral infarction, pulmonary embolism, peripheral arteriovenous thrombosis and the like.

[0095]

[Sequence listing] SEQ ID NO: 1 Sequence length: 13 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment type: Intermediate fragment sequence Asn Arg Arg Leu Thr Trp Glu Tyr Cys Asp Val Pro Ser 1 5 10 SEQ ID NO: 2 Sequence length: 13 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment type: Intermediate fragment Sequence Arg-Met-Thr-Leu-Val-Gly-Ile-Ile- Ser-Trp-Gly-Leu-Gly 1 5 10 SEQ ID NO: 3 Sequence length: 12 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment type: C-terminal fragment-stop sequence SEQ ID NO: 4 Sequence length: 39 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence AAC CGC AGG CTG ACG TGG GAG TAC TGT GAT GTG CCC TCC 39 SEQ ID NO: 5 Sequence Length: 39 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGC ATG ACT TTG GTG GGC ATC ATC AGC TGG GGC CTG GGC 39 SEQ ID NO: 6 Sequence length: 39 Sequence Type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AAC TAC CTA GAC TGG ATT CGT GAC AAC ATG CGA CCG TGA 39 SEQ ID NO: 7 Sequence length: 1800 Sequence type: Nucleic acid Number of strands : Double-strand Topology: Linear Sequence type: cDNA to mRNA Origin human foreskin-derived primary culture cell Sequence features Location: 552..554 Method of determining features: E sequence AAAACCTCTG CGAGGAAAGG GAAGGAGCAA GCCGTGAATT TAAGGGACGC TGTGAAGCAA 60 TC ATG GAT GCA ATG AAG AGA GGG CTC TGC TGT GTG CTG CTG CTG TGT 107 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys -35 -30 -25 GGA GCA GTC TTC GTT TCG CCC AGC CAG GAA ATC CAT GCC CGA TTC AGA 155 Gly Ala Val Phe Val Ser Pro Ser Gln Glu Ile His Ala Arg Phe Arg -20 -15 -10 -5 AGA GGA GCC AGA TCT TAC CAA GTG ATC TGC AGA GAT GAA AAA ACG CAG 203 Arg Gly Ala Arg Ser Tyr Gln Val Ile Cys Arg Asp Glu Lys Thr Gln 1 5 10 ATG ATA TAC CAG CAA CAT CAG TCA TGG CTG CGC CCT GTG CTC AGA AGC 251 Met Ile Tyr Gln Gln His Gln Ser Trp Leu Arg Pro Val Leu Arg Ser 15 20 25 AAC CGG GTG GAA TAT TGC TGG TGC AAC AGT GGC AGG GCA CAG TGC CAC 299 Asn Arg Val Glu Tyr Cys Trp Cys Asn Ser Gly Arg Ala Gln Cys His 30 35 40 TCA GTG CCT GTC AAA AGT TGC AGC GAG CCA AGG TGT TTC AAC GGG GGC 347 Ser Val Pro Val Lys Ser Cys Ser Glu Pro Arg Cys Phe Asn Gly Gly 45 50 55 60 ACC TGC CAG CAG GCC CTG TAC TTC TCA GAT TTC GTG TGC CAG TGC CCC 395 Thr Cys Gln Gln Ala Leu Tyr Phe Ser Asp Phe Val Cys Gln Cys Pro 65 70 75 GAA GGA TTT GCT GGG AAG TGC TGT GAA ATA GAT ACC AGG GCC ACG TGC 44 3 Glu Gly Phe Ala Gly Lys Cys Cys Glu Ile Asp Thr Arg Ala Thr Cys 80 85 90 TAC GAG GAC CAG GGC ATC AGC TAC AGG GGC ACG TGG AGC ACA GCG GAG 491 Tyr Glu Asp Gln Gly Ile Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu 95 100 105 AGT GGC GCC GAG TGC ACC AAC TGG AAC AGC AGC GCG TTG GCC CAG AAG 539 Ser Gly Ala Glu Cys Thr Asn Trp Asn Ser Ser Ala Leu Ala Gln Lys 110 115 120 CCC TAC AGT GGG TGG AGG CCA GAC GCC ATC AGG CTG GGC CTG GGG AAC 587 Pro Tyr Ser Gly Trp Arg Pro Asp Ala Ile Arg Leu Gly Leu Gly Asn 125 130 135 140 CAC AAC TAC TGC AGA AAC CCA GAT CGA GAC TCA AAG CCC TGG TGC TAC 635 His Asn Tyr Cys Arg Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr 145 150 155 GTC TTT AAG GCG GGG AAG TAC AGC TCA GAG TTC TGC AGC ACC CCT GCC 683 Val Phe Lys Ala Gly Lys Tyr Ser Ser Glu Phe Cys Ser Thr Pro Ala 160 165 170 TGC TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 731 Cys Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 175 180 185 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CC G TGG 779 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 190 195 200 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 827 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 205 210 215 220 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 875 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 225 230 235 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 923 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 240 245 250 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 971 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 255 260 265 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 1019 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 270 275 280 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AGG AGG TCG 1067 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Arg Arg Ser 285 290 295 300 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 1115 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 305 310 315 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 1163 Ile Leu Ser Ala Ala Hisa Cys Phe Gln Glu Arg Phe Pro Pro His His 320 325 330 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 1211 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 335 340 345 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 1259 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 350 355 360 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 1307 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 365 370 375 380 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 1355 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 385 390 395 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 1403 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 400 405 410 GGC TAC GGC AAG CAT G AG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 1451 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 415 420 425 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 1499 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 430 435 440 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 1547 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 445 450 455 460 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 1595 Thr Arg Ser Gly Gly Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly 465 470 475 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 1643 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 480 485 490 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1691 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 495 500 505 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1739 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 510 515 520 AT G CGA CCG TGACCAGGAA CACCCGACTC CTCAAAAGCA AATGAGATCC 1788 Met Arg Pro 525 527 CGCCTCTTCT TC 1800 SEQ ID NO: 8 Sequence length: 36 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ACTGTTTCCC TCAGACATAT GAGGGGTG 36 SEQ ID NO: 9 Sequence length: 31 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence GCACAGGAAC CGCTCAGCAA AGATGGCAGC C 31 SEQ ID NO: 10 Sequence length: 1068 Sequence type: Number of nucleic acid strands: Double stranded Topology: Linear Sequence type: Other nucleic acids Modified SEQ ID NO: 7 Sequence features Location: Amino acid deletions from 1 to 173 Method to determine features: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly A la Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AGG AGG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Arg Arg Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu I le Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala L eu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly 290 295 295 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355 SEQ ID NO: 11 Sequence Length: 1047 Distribution Type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence characteristics Location: Amino acid deletion from 1-173, Amino acid deletion from 296 to 302 Characteristics Method for determining P sequence: ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCT GAG CGG TTC CTG TGC 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Glu Arg Phe Leu Cys 115 120 125 GGG GGC ATA CTC ATC AGC TCC TGC TGG ATT CTC TCT GCC GCC CAC TGC 432 Gly Gly Ile Leu Ile Ser Ser Cys Trp Ile Leu Ser Ala Ala His Cys 130 135 140 TTC CAG GAG AGG TTT CCG CCC CAC CAC CTG ACG GTG ATC TTG GGC AGA 480 Phe Gln Glu Arg Phe Pro Pro His His Leu Thr Val Ile Leu Gly Arg 145 150 155 160 ACA TAC CGG GTG GTC CCT GGC GAG GAG GAG CAG AAA TTT GAA GTC GAA 528 Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gln Lys Phe Glu Val Glu 165 170 175 AAA TAC ATT GTC CAT AAG GAA TTC GAT GAT GAC ACT TAC GAC AAT GAC 576 Lys Tyr Ile Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asp Asn Asp 180 185 190 ATT GCG CTG CTG CAG CTG AAA TCG GAT TCG TCC CGC TGT GCC CAG GAG 624 Ile Ala Leu Leu Gln Leu Lys Ser Asp Ser Ser Arg Cys Ala Gln Glu 195 200 205 AGC AGC GTG GTC CGC ACT GTG TGC CTT CCC CCG GAG GAC CTG CAG CTG 672 Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Glu Asp Leu Gln Leu 210 215 220 CCG GAC TGG ACG GAG TGT GAG CTC TCC GGC TAC GGC AAG CAT GAG GCC 720 Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His Glu Ala 225 230 235 240 TTG TCT CCT TTC TAT TCG GAG CGG CTG AAG GAG GCT CAT GTC AGA CTG 768 Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val Arg Leu 245 250 255 TAC CCA TCC AGC CGC TGC ACA TCA CAA CAT TTA CTT AAC AGA ACA GTC 816 Tyr Pro Ser Ser Arg Cys Thr Ser Gln His Leu Leu Asn Arg Thr Val 260 265 270 ACC GAC AAC ATG CTG TGT GCT GGA GAC ACT CGG AGC GGC GGG CCC CAG 864 Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly Pro Gln 275 280 285 GCA AAC TTG CAC GAC GCC TGC CAG GGC GAT TCG GGA GGC CCC CTG GTG 912 Ala Asn Leu His Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Val 290 295 300 TGT CTG AAC GAT GGC CGC ATG ACT TTG GTG GGC ATC ATC AGC TGG GGC 960 Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly Ile Ile Ser Trp Gly 305 310 315 320 CTG GGC TGT GGA CAG AAG GAT GTC CCG GGT GTG TAC ACC ACC AAG GTT ACC 1008 Leu Gly Cys Gly Gln Lys Asp Val Pro Gly Val Tyr Thr Lys Val Thr 325 330 335 AAC TAC CTA GAC TGG ATT CGT GAC AAC ATG CGA CCG TGA 1047 Asn Tyr Leu Asp Trp Ile Arg Asp Asn Met Arg Pro 340 345 348 SEQ ID NO: 12 Sequence length: 24 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGCGACTCTTCGTGCTTGGCAAA 24 SEQ ID NO: 13 Sequence length: 1068 Sequence type: Nucleic acid Number: Double-stranded Topology: Linear Sequence type: Other nucleic acids Modified SEQ ID NO: 7 Sequence features Location: Amino acid deletions from 1 to 173, amino acid substitutions at positions 298 and 299 Methods to determine features: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GAA GAG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Ly s His Glu Glu Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro As p Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355 SEQ ID NO: 14 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic acid Synthetic DNA sequence GCACAGGAAG TGATATCCGG GCGA 24 SEQ ID NO: 15 Sequence length: 24 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GCACAGGAAG TGATATGCAA AGAT 24 SEQ ID NO: 16 Sequence length : 1068 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: Amino acid deletions from 1 to 173, amino acids 303 and 304 Method for determining substitution characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AGG AGG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Arg Arg Ser 115 120 125 CCC GGA TAT CAC TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Tyr His Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355 SEQ ID NO: 17 Sequence Length: 1047 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Sequence No. 7 is modified Sequence characteristics Location: Amino acid deletion from 1 to 173, Amino acid from 296 to 302 Deletion, amino acid substitutions at positions 303 and 304 Method for determining characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val L eu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCT TAT CAC TTC CTG TGC 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Tyr His Phe Leu Cys 115 120 125 GGG GGC ATA CTC ATC AGC TCC TGC TGG ATT CTC TCT GCC GCC CAC TGC 432 Gly Gly Ile Leu Ile Ser Ser Cys Trp Ile Leu Ser Ala Ala His Cys 130 135 140 TTC CAG GAG AGG TTT CCG CCC CAC CAC CTG ACG GTG ATC TTG GGC AGA 480 Phe Gln Glu Arg Phe Pro Pro His His Leu Thr Val Ile Leu Gly Arg 145 150 155 160 ACA TAC CGG GTG GTC CCT GGC GAG GAG GAG CAG AAA TTT GAA GTC GAA 528 Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gln Lys Phe Glu Val Glu 165 170 175 AAA TAC ATT GTC CAT AAG GAA TTC GAT GAT GAC ACT TAC GAC AAT GAC 576 Lys Tyr Ile Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asp Asn Asp 180 185 190 ATT GCG CTG CTG CAG CTG AAA TCG GAT TCG TCC CGC TGT GCC CAG GAG 624 Ile Ala Leu Leu Gln Leu Lys Ser Asp Ser Ser Arg Cys Ala Gln Glu 195 200 205 AGC AGC GTG GTC CGC ACT GTG TGC CTT CCC CCG GAG GAC CTG CAG CTG 672 Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Glu Asp Leu Gln Leu 210 215 220 CCG GAC TGG ACG GAG TGT GAG CTC TCC GGC TAC GGC AAG CAT GAG GCC 720 Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His Glu Ala 225 230 235 240 TTG TCT CCT TTC TAT TCG GAG CGG CTG AAG GAG GCT CAT GTC AGA CTG 768 Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val Arg Leu 245 250 255 TAC CCA TCC AGC CGC TGC ACA TCA CAA CAT TTA CTT AAC AGA ACA GTC 816 Tyr Pro Ser Ser Arg Cys Thr Ser Gln His Leu Leu Asn Arg Thr Val 260 265 270 ACC GAC AAC ATG CTG TGT GCT GGA GAC ACT CGG AGC GGC GGG CCC CAG 864 Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly Pro Gln 275 280 285 GCA AAC TTG CAC GAC GCC TGC CAG GGC GAT TCG GGA GGC CCC CTG GTG 912 Ala Asn Leu His Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Val 290 295 300 TGT CTG AAC GAT GGC CGC ATG ACT TTG GTG GGC ATC ATC AGC TGG GGC 960 Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly Ile Ile Ser Trp Gly 305 310 315 320 CTG GGC TGT GGA CAG AAG GAT GTC CCG GGT GTG TAC ACC AAG GTT ACC 1008 Leu Gly Cys Gly Gln Lys Asp Val Pro Gly Val Tyr Thr Lys Val Thr 325 330 335 AAC TAC CTA GAC TGG ATT CGT GAC AAC ATG CGA CCG TGA 1047 Asn Tyr Leu Asp Trp Ile Arg Asp Asn Met Arg Pro 340 345 348.

SEQ ID NO: 18 Sequence Length: 21 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence CCGCTCTCCT GGCGACCTCC T 21.

SEQ ID NO: 19 Sequence length: 24 Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence TGGCGACTTC TTGTGCTTGG CAAA 24.

SEQ ID NO: 20 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AAG AAG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Lys Lys Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 21 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGATAGT AGGTGCTTGG CAA
A 24.

SEQ ID NO: 22 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GAT GAT TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Asp Asp Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 23 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACTGC TGGTGCTTGG CAAA 24.

SEQ ID NO: 24 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC CAG CAG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Gln Gln Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 25 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACGCT GCGTGCTTGG CAAA 24.

SEQ ID NO: 26 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GCA GCG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Ala Ala Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 27 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACCTA TCGTGCTTGG CAAA 24.

SEQ ID NO: 28 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at position 298 Method to determine characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Lg Lg eu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GAT AGG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Asp Arg Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala AsnLeu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 29 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGAGTCC CTGTGCTTGG CAAA 24.

SEQ ID NO: 30 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at position 299 Method to determine the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Lg Lg eu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AGG GAC TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Arg Asp Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala AsnLeu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 31 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACTTC TCGTGCTTGG CAAA 24.

SEQ ID NO: 32 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: Other nucleic acid Modify SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GAG AAG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Glu Lys Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 33 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACTCC TTGTGCTTGG CAAA 24.

SEQ ID NO: 34 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at positions 298 and 299 Method for determining the characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AAG GAG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Lys Glu Ser 115 120 125 CCC GGA GAG CGG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Arg Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Va l His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Al a Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 35 Sequence Length: 21 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence GCACAGGAAC TCCTCTCCTG G 21.

SEQ ID NO: 36 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, substitution at position 304 Method to determine characteristics: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Lg Lg eu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC AGG AGG TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Arg Arg Ser 115 120 125 CCC GGA GAG GAG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Glu Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala AsnLeu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

SEQ ID NO: 37 Sequence Length: 24 Sequence Type: Nucleic Acid Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TGGCGACTCT TCGTGCTTGG CAAA 24.

SEQ ID NO: 38 Sequence length: 1068 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: Other nucleic acid Modified SEQ ID NO: 7 Sequence features Location: 1 to Amino acid deletion up to 173, 298, 299, 304
Substitution at position Method for determining features: P sequence ATG TCT GAG GGA AAC AGT GAC TGC TAC TTT GGG AAT GGG TCA GCC TAC 48 Met Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr 1 5 10 15 CGT GGC ACG CAC AGC CTC ACC GAG TCG GGT GCC TCC TGC CTC CCG TGG 96 Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp 20 25 30 AAT TCC ATG ATC CTG ATA GGC AAG GTT TAC ACA GCA CAG AAC CCC AGT 144 Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser 35 40 45 GCC CAG GCA CTG GGC CTG GGC AAA CAT AAT TAC TGC CGG AAT CCT GAT 192 Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp 50 55 60 GGG GAT GCC AAG CCC TGG TGC CAC GTG CTG AAG AAC CGC AGG CTG ACG 240 Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr 65 70 75 80 TGG GAG TAC TGT GAT GTG CCC TCC TGC TCC ACC TGC GGC CTG AGA CAG 288 Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln 85 90 95 TAC AGC CAG CCT CAG TTT CGC ATC AAA GGA GGG CTC TTC GCC GAC ATC 336 Tyr Ser Gln Pro Gln Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile 100 105 110 GCC TCC CAC CCC TGG CAG GCT GCC ATC TTT GCC AAG CAC GAA GAA TCG 384 Ala Ser His Pro Trp Gln Ala Ala Ile Phe Ala Lys His Glu Glu Ser 115 120 125 CCC GGA GAG GAG TTC CTG TGC GGG GGC ATA CTC ATC AGC TCC TGC TGG 432 Pro Gly Glu Glu Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp 130 135 140 ATT CTC TCT GCC GCC CAC TGC TTC CAG GAG AGG TTT CCG CCC CAC CAC 480 Ile Leu Ser Ala Ala His Cys Phe Gln Glu Arg Phe Pro Pro His His 145 150 155 160 CTG ACG GTG ATC TTG GGC AGA ACA TAC CGG GTG GTC CCT GGC GAG GAG 528 Leu Thr Val Ile Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu 165 170 175 GAG CAG AAA TTT GAA GTC GAA AAA TAC ATT GTC CAT AAG GAA TTC GAT 576 Glu Gln Lys Phe Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp 180 185 190 GAT GAC ACT TAC GAC AAT GAC ATT GCG CTG CTG CAG CTG AAA TCG GAT 624 Asp Asp Thr Tyr Asp Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp 195 200 205 TCG TCC CGC TGT GCC CAG GAG AGC AGC GTG GTC CGC ACT GTG TGC CTT 672 Ser Ser Arg Cys Ala Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu 210 215 220 CCC CCG GAG GAC CTG CAG CTG CCG GAC TGG ACG GAG TGT GAG CTC TCC 720 Pro Pro Glu Asp Leu Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser 225 230 235 240 GGC TAC GGC AAG CAT GAG GCC TTG TCT CCT TTC TAT TCG GAG CGG CTG 768 Gly Tyr Gly Lys His Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu 245 250 255 AAG GAG GCT CAT GTC AGA CTG TAC CCA TCC AGC CGC TGC ACA TCA CAA 816 Lys Glu Ala His Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln 260 265 270 CAT TTA CTT AAC AGA ACA GTC ACC GAC AAC ATG CTG TGT GCT GGA GAC 864 His Leu Leu Asn Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp 275 280 285 ACT CGG AGC GGC GGG CCC CAG GCA AAC TTG CAC GAC GCC TGC CAG GGC 912 Thr Arg Ser Gly Gly Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly 290 295 300 GAT TCG GGA GGC CCC CTG GTG TGT CTG AAC GAT GGC CGC ATG ACT TTG 960 Asp Ser Gly Gly Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu 305 310 315 320 GTG GGC ATC ATC AGC TGG GGC CTG GGC TGT GGA CAG AAG GAT GTC CCG 1008 Val Gly Ile Ile Ser Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro 325 330 335 GGT GTG TAC ACC AAG GTT ACC AAC TAC CTA GAC TGG ATT CGT GAC AAC 1056 Gly Val Tyr Thr Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn 340 345 350 ATG CGA CCG TGA 1068 Met Arg Pro 355.

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of the human tPA cDNA obtained in Example 1 and the amino acid sequence deduced therefrom.

FIG. 2 is a construction diagram of plasmid pTB920.

FIG. 3 is a construction diagram of plasmid pTB927.

FIG. 4. Human tPA mutein tPA-1 and human tP.
It is a schematic diagram of the specific site mutation performed in obtaining A mutein tPA-2.

FIG. 5 shows the nucleotide sequence of human tPA mutein tPA-1 and the amino acid sequence deduced therefrom.

FIG. 6 shows the nucleotide sequence of human tPA mutein tPA-2 and the amino acid sequence deduced therefrom.

FIG. 7: Plasmids pTB1128,1132,113
3 is a construction drawing of 3 and 1134. FIG.

FIG. 8 is a graph showing the optimum pH for the enzymatic activity of tPA.

FIG. 9 is a graph showing optimum concentrations of reduced glutathione and oxidized glutathione.

FIG. 10 is a graph showing the relationship between heat retention time and tPA-1 enzyme activity during activation.

FIG. 11 is an electrophoretogram of tPA-1 and tPA-2.

FIG. 12: PAI for tPA-1 and tPA-2
It is a graph which looked at the inhibitory action of -1.

FIG. 13 is a construction diagram of plasmids pTB1038 and 1277.

FIG. 14 shows the nucleotide sequence of human tPA mutein tPA-6 and the amino acid sequence deduced therefrom.

FIG. 15 is a construction diagram of plasmids pTB1158 and 1160.

FIG. 16 shows the nucleotide sequence of human tPA mutein tPA-7 and the amino acid sequence deduced therefrom.

FIG. 17 shows the nucleotide sequence of human tPA mutein tPA-8 and the amino acid sequence deduced therefrom.

FIG. 18 is an electrophoretogram of tPA-6 '.

FIG. 19 is an electrophoretogram of tPA-7.

FIG. 20 is an electrophoretogram of tPA-8.

FIG. 21 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-11.

FIG. 22 shows the nucleotide sequence of human tPA mutein tPA-11 and the amino acid sequence deduced therefrom.

FIG. 23 is a construction diagram of plasmids pTB1334 and 1335.

FIG. 24 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-12.

FIG. 25 shows the nucleotide sequence of human tPA mutein tPA-12 and the amino acid sequence deduced therefrom.

FIG. 26 is a construction diagram of plasmids pTB1353 and 1354.

FIG. 27 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-13.

FIG. 28 shows the nucleotide sequence of human tPA mutein tPA-13 and the amino acid sequence deduced therefrom.

FIG. 29 is a construction diagram of plasmids pTB1356 and 1357.

FIG. 30 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-14.

FIG. 31 shows the nucleotide sequence of human tPA mutein tPA-14 and the amino acid sequence deduced therefrom.

FIG. 32 is a construction diagram of plasmids pTB1359 and 1360.

FIG. 33 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-15.

FIG. 34 shows the nucleotide sequence of human tPA mutein tPA-15 and the amino acid sequence deduced therefrom.

FIG. 35 is a construction diagram of plasmids pTB1362 and 1363.

FIG. 36 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-16.

FIG. 37 shows the nucleotide sequence of human tPA mutein tPA-16 and the amino acid sequence deduced therefrom.

FIG. 38 is a construction diagram of plasmids pTB1345 and 1346.

FIG. 39 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-17.

FIG. 40 shows the nucleotide sequence of human tPA mutein tPA-17 and the amino acid sequence deduced therefrom.

FIG. 41 is a construction diagram of plasmids pTB1365 and 1366.

FIG. 42 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-18.

FIG. 43 shows the nucleotide sequence of human tPA mutein tPA-18 and the amino acid sequence deduced therefrom.

FIG. 44 is a construction diagram of plasmids pTB1368 and 1369.

FIG. 45 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-5.

FIG. 46 shows the nucleotide sequence of human tPA mutein tPA-5 and the amino acid sequence deduced therefrom.

FIG. 47 is a construction diagram of plasmids pTB1271 and 1272.

FIG. 48 is a schematic diagram of specific site mutation performed in obtaining human tPA mutein tPA-6.

FIG. 49 shows the nucleotide sequence of human tPA mutein tPA-6 and the amino acid sequence deduced therefrom.

FIG. 50 is a construction diagram of plasmids pTB1325 and 1326.

FIG. 51 is a graph showing an increase in blood half-life of tPA-2.

FIG. 52 is a graph showing the thrombolytic activity of tPA-6 ′.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] May 23, 1991

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0031

[Correction method] Change

[Correction content]

The deposit numbers and deposit dates of the respective transformants obtained in the following Examples to the Institute for Fermentation Research (IFO) and the Institute of Microbial Technology (FRI) of the Ministry of International Trade and Industry are shown below. It is as follows. Microorganism name IFO deposit number FRI deposit number Escherichia coli MM294 (DE3) / pLysS, pTB1133 IFO 15031 FERM BP-2882 April 17, 1990 May 1, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1134 IFO 15032 FERM BP-2883 April 17, 1990 May 1, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1277 IFO 15116 FERM BP-3199 December 6, 1990 December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1159 IFO 15117 FERM BP-3200 December 6, 1990 December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTB1161 IFO 15118 FERM BP-3201 December 6, 1990 Date December 13, 1990 Escherichia coli MM294 (DE3) / pLysS, pTG1360 IFO 15166 FERM BP-3365 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1363 IFO 15167 FERM BP-3366 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1346 IFO 15168 FERM BP-3367 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTG1366 IFO 15169 FERM BP-3368 April 10, 1991 April, 1991 17th Esherichia coli MM294 (DE3) / pLysS, pTG1369 IFO 15170 FERM BP-3369 April 10, 1991 April 17, 1991 Esherichia coli MM294 (DE3) / pLysS, pTB1272 IFO 15172 FERM P-12243 Heisei 3 May 6, 1991 May 13, 1991 Esherichia coli MM294 (DE3) / pLysS, pTB1326 IFO 15173 FERM P-12244 May 6 , 1991 May 13, 1991 Esherichia coli MM294 (DE3) / pLysS , pTB1335 IFO 15174 FERM P-12246, 1991 May 6, 1991 May 13, Esherichia coli MM294 (DE3) / pLysS , pTB1354 IFO 15175 FERM P-12245 , 1991 May 6, 1993 May 3 years 13th Esherichia coli MM294 (DE3) / pLysS, pTB1357 IFO 15176 FERM P-12247 May 6, 1991 May 13, 1991

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display area // (C12N 9/64 C12R 1:19) (C12N 1/21 C12R 1:19)

Claims (12)

[Claims] 1. A tissue plasminogen activator (tPA) mutein characterized by deletion of a finger (F) domain, a growth factor (E) domain and a kringle (K) 1 domain. 2. The tPA mutein according to claim 1, wherein a part or all of the region of amino acid residue numbers 296 to 302 is deleted. 3. The tPA mutein according to claim 1, wherein some or all of the amino acid residues between amino acid residue numbers 296 to 304 are replaced with another amino acid residue. 4. A part or all of the region of amino acid residue numbers 296 to 302 is deleted, and amino acid residue numbers 296 to 3 are deleted.
The tPA mutein according to claim 1, which is obtained by substituting a part of amino acid residues in region 04 with another amino acid residue. 5. The tPA mutein according to claim 3 or 4, wherein the another amino acid residue is an acidic amino acid. 6. A recombinant DNA having a nucleotide sequence encoding the mutein according to claim 1, 2, 3, 4 or 5. 7. A transformant transformed with the vector containing the recombinant DNA according to claim 6. 8. The transformant according to claim 7, which is obtained by transforming Escherichia coli, yeast, Bacillus subtilis and mammalian cells. 9. A method for producing the mutein, which comprises culturing the transformant according to claim 7 or 8 in a medium, allowing the mutein according to claim 1 to be produced and accumulated in the culture, and collecting the mutein. . 10. A method obtained by transforming Escherichia coli.
A method for producing the mutein, which comprises culturing the transformant according to claim 1 in a medium, allowing the mutein according to claim 1 to be produced and accumulated in E. coli cells, and separating and purifying the mutein. 11. The method for producing the mutein according to claim 10, wherein the mutein according to claim 1 is produced and accumulated in an E. coli cell as an insoluble inclusion body, and the mutein is separated and purified. 12. Escherichia coli cells in which the mutein according to claim 1 is produced and accumulated in the cells as an insoluble inclusion body (a) are separated and precipitated, (b) the cells are dissolved, and (c) the insoluble inclusion body. The body is collected by precipitation, (d) solubilized in a buffer containing a denaturant, (e) diluted with a redox buffer and then kept warm to activate the mutein, and (f) a number including affinity chromatography. 12. The method for producing the mutein according to claim 11, wherein the mutein is purified by step chromatography.