JPH0560918B2 - - Google Patents

Description

Detailed Description of the Invention [Background of the Invention] Technical Field The present invention relates to α-acetolactate decarboxylase (hereinafter referred to as α-ALDCase) such as that produced by Acetobacter aceti subsp. xylinum IFO3288.
DNA strands capable of biotechnological production of
and α-
The present invention relates to a yeast belonging to Satucharomyces cerevisiae that has the ability to produce ALDCase, and a method for producing alcoholic beverages using this yeast. Prior Art Alcoholic beverages such as beer, sake, and wine are generally produced by adding yeast belonging to Satucharomyces cerevisiae to a brewing raw material liquid such as wort or fruit juice, and subjecting the mixture to alcoholic fermentation. During this fermentation process, yeast produces α-acetolactic acid (hereinafter referred to as α-AL) as an intermediate in the biosynthesis of certain amino acids (valine, leucine, etc.) necessary for its own growth.
This inevitably leaks out of the cell, into the fermentation liquid. The α-AL thus present in the fermentation liquid is automatically converted to diacetyl (hereinafter referred to as DA) by a non-biological reaction in the fermentation liquid. DA is a substance that has a strong unpleasant odor, which is generally referred to as ``sue odor'', ``DA odor'', or ``morning sickness odor''. α in liquid
−AL and DA contents, even if all of the α−AL changes to DA, the total DA
It is necessary to reduce the content so that it does not exceed the discrimination threshold for DA odor in alcoholic beverages (for example, 0.05-0.1 mg/liter for beer). DA in the fermentation liquid is converted to acetoin, which is tasteless and odorless, relatively quickly when yeast coexists.
α-AL in the fermentation broth is not changed by yeast, and only when it is converted to DA by a non-biological chemical reaction is it converted to acetoin by yeast. However, since the change from α-AL to DA in the fermentation broth proceeds at a very slow rate, this reaction becomes rate-limiting, resulting in low α-AL and DA contents (i.e., DA
In order to produce odorless (odorless) alcoholic beverages, it has generally been necessary to age the fermentation liquor in the presence of yeast for a long period of time. α-ALDCase is an enzyme that has the property of converting α-AL into acetoin.
Bacteria with a positive Voges Proskauer reaction, such as Enterobacter aerogenes, Bacillus licheniformis, Lactobacillus casei, Bacillus brevis, Enterobacter cloacae,
It is known to be produced by Acetobacter bacteria (Acetobacter lancens, Acetobacter aceti, etc.). [Summary of the Invention] Summary The present invention is a biotechnological development of α-ALDCase, which is considered useful for producing alcoholic beverages with excellent flavor and no DA odor in a much shorter time than conventional methods. The object of the present invention is to provide a DNA strand capable of producing α-ALDCase and a yeast transformed with the DNA strand and capable of producing α-ALDCase. The present invention also provides a method for producing alcoholic beverages using this yeast. That is, the DNA chain capable of biotechnological production of α-ALDCase according to the present invention has α-acetolactate decarboxylase activity and has an amino acid sequence substantially as shown in FIG. It is characterized by having a base sequence encoding a polypeptide from A to B among these. Furthermore, the yeast belonging to Saccharomyces cerevisiae according to the present invention has α-acetolactate decarboxylase activity and has an amino acid sequence from A to B of the amino acid sequence substantially shown in FIG. α-
It is characterized by having the ability to produce ALDCase. Furthermore, the method for producing alcoholic beverages according to the present invention comprises α
- A DNA strand having acetolactate decarboxylase activity and having a base sequence encoding a polypeptide whose amino acid sequence is substantially from A to B of the amino acid sequences shown in Figure 1. The method is characterized in that the brewing raw material is fermented by transformed yeast that has the ability to produce α-ALDCase. Effects The DNA strand according to the present invention has α-
It can be used to impart the ability to produce ALDCase and suppress the ability to produce α-AL, or to be effectively used in the biotechnological production of α-ALDCase. In addition, the yeast according to the present invention has the ability to produce α-ALDCase,
If produced in yeast cells, it is generally yeast α-AL.
production capacity (more precisely, α-AL leakage to the outside of the cell)
Therefore, if the brewing raw material liquid is fermented with the yeast according to the present invention, the concentration of α-AL in the fermented liquid will be extremely low, and as a result, the aging period required for processing α-AL in the fermented liquid will be reduced. As a result, the period for brewing alcoholic beverages can be significantly shortened. The reason why the α-AL production ability of the yeast of the present invention is suppressed is that even if α-AL is produced within the cells during the fermentation process, α-ALDCase also produced within the cells suppresses α-AL. This is thought to be because it is converted to acetoin. The problem of unpleasant odors in fermented products is recognized not only in the production of alcoholic beverages, but also in the production of vinegar, for example, and the main body of the unpleasant odor of vinegar, the so-called "morning sickness aroma" or "stuffy aroma", is also caused by DA. It is said that there is. Therefore, if acetic acid bacteria is transformed with the DNA chain capable of biologically producing α-ALDCase according to the present invention and vinegar is produced using the transformant, vinegar with reduced unpleasant odor can be obtained. It also has the effect that it is possible. [Specific Description of the Invention] α-ALDCase Gene Definition The DNA chain capable of biotechnological production of α-ALDCase according to the present invention, that is, the α-ALDCase gene has α-ALDCase activity and the amino acid sequence is substantially It has a base sequence encoding a polypeptide having amino acid sequences A to B among the amino acid sequences shown in FIG. Here, the term "DNA strand" refers to a complementary double strand of polydeoxyribonucleic acid having a certain length. In the present invention, this "DNA chain" is specified by the amino acid sequence of the polypeptide it encodes, and since this polypeptide has a finite length as described above, this DNA chain is also of finite length. but,
This DNA strand contains the gene encoding α-ALDCase and is useful for the biotechnological production of this polypeptide. Not only can biotechnological production of this polypeptide be performed, but also biotechnological production of this polypeptide is possible with a DNA strand of an appropriate length attached to its 5'-upstream and/or 3'-downstream. That is why. Therefore, when referring to "DNA strand" in the present invention,
In addition to those of this specific length (lengths A to B in terms of the corresponding amino acid sequences in Figure 1), linear or circular DNA whose members are DNA chains of this specific length.
It shall include those in the form of chains. This is why the DNA strand according to the present invention is defined as "having a base sequence encoding a polypeptide." Representative forms of the DNA strand according to the present invention include the form of a plasmid in which the DNA strand is a part of its members, and microorganisms, especially Escherichia coli, as a plasmid or inserted into the genome.
It is the form present in yeast and acetic acid bacteria. A preferred form of existence of the DNA strand according to the present invention is:
In order for the α-ALDCase gene to be stably expressed in microorganisms, the DNA strand of the present invention as a foreign gene is combined with a promoter and a terminator, and this is inserted into microorganisms as a plasmid or inserted into the genome. It exists. As the promoter and terminator, known promoters and terminators can be used in appropriate combination. Polypeptide encoded by this gene As mentioned above, the DNA chain according to the present invention is specified by the amino acid sequence of the polypeptide encoded by the DNA chain. This polypeptide is α-
Among the amino acid sequences that have ALDCase activity and whose amino acid sequences are substantially shown in Figure 1, A
to B. Here, "the amino acid sequence is substantially the one from A to B of the amino acid sequences shown in Figure 1" means that as long as this polypeptide has α-ALDCase activity, it lacks some of the amino acids. This indicates that there may be deletions, substitutions, additions, etc. A typical polypeptide having α-ALDCase activity according to the present invention is A of the amino acid sequence shown in FIG.
~B, consists of 235 amino acids, and its amino acid sequence was previously unknown. In the present invention, "the amino acid sequence is substantially from A to B among the amino acid sequences shown in Figure 1" means that there may be deletions, substitutions, additions, etc. of some of the amino acids. As mentioned above, an example of a peptide with a change in amino acid is A of the amino acid sequence shown in Figure 1.
69 amino acid residues upstream of the point (amino acids corresponding to bases 212 to 418 in Figure 1)
(amino acid number 304)
), that is, those from A ₁ to B in Figure 1. This is because this peptide has α-ALDCase activity, although the amino acid sequence is about 1/10 that of those of A to B. Similarly, A ₂ to B of the amino acid sequence in Figure 1,
Peptides corresponding to A ₃ -B, A ₄ -B, A ₅ -B and A ₆ -B (only A ₃ -B, A ₅ -B and A ₆
~The peptide corresponding to B has an N-terminus starting from Val.
(which has changed to Met) also has α-ALDCase activity as shown in the examples below, so
It falls within the category of peptides in the present invention. The present invention basically relates to a DNA chain, and as mentioned above, the addition of amino acids is carried out from A to B.
The fact that a peptide occurring outside the amino acid sequence of the present invention is a peptide in the sense of the present invention indicates that a DNA chain having a base sequence encoding such a peptide also falls within the scope of the DNA chain of the present invention. be. This is because such a base sequence that encodes a peptide longer than A to B "has" the base sequence that encodes peptide A to B. Base sequence of DNA strand The DNA strand encoding α-ALDCase has the base sequence A to B in Figure 1, its degenerate isomers, and the above-mentioned changes in the amino acid sequence of α-ALDCase. It has a base sequence or its degenerate isomer. Here, "degenerate isomers" are those that differ only in the degenerate codon and can code for the same polypeptide.
means DNA strand. For example, for a DNA strand with the base sequence A to B in Figure 1, a codon corresponding to one of its amino acids, such as a C-terminal
In the present invention, a coden (GGC) corresponding to Gly that has a degenerate relationship with GGT, for example, is called a degenerate isomer. Preferred embodiments of the DNA strand according to the invention are:
It has at least one stop codon (for example, TGA) adjacent to the 3'-end. Furthermore, the 5'-upstream and/or 3'-downstream of the DNA strand of the present invention contains an untranslated region.
DNA strand (the first part of the 3'-downstream is usually a stop codon such as TGA)
may continue for a certain length. The base sequence of the DNA strand shown in Figure 1 is
The gene encoding α-ALDCase obtained from Acetobacter aceti subsp. xylinum IFO 3288 was determined by the dideoxy method. Obtaining a DNA strand One way to obtain a DNA strand having a base sequence encoding the amino acid sequence of α-ALDCase described above is to chemically synthesize at least a portion of the chain length according to a method of nucleic acid synthesis. . However, in terms of experimental procedures, methods commonly used in the field of genetic engineering, such as hybridization using appropriate probes, are preferred from the chromosomal gene library of Acetobacter aceti subsp. It can be said that it is preferable to obtain it by law. In addition, the present inventors have confirmed that Acetobacter aceti
α− of subspecies xylinum IFO3288
Since the nucleotide sequence and amino acid sequence encoding ALDCase were unknown, the DNA of the present invention was extracted from the above gene library using the shot gun method.
A chain was obtained (see Examples below for details). Yeast Having the Ability to Produce α-ALDCase Since the DNA strand of the present invention obtained as described above contains the genetic information for producing α-ALDCase, it is processed using biotechnological techniques to produce yeast that is generally used for brewing alcoholic beverages. By introducing the enzyme into a yeast (Saccharomyces cerevisiae) used as a yeast and transforming it, it is possible to obtain a brewing yeast having an α-ALDCase-producing ability and, therefore, a suppressed α-AL-producing ability. Yeast The yeast to be transformed in the present invention is
"The yeasts, a taxonomic study" (3rd)
Ed. (Yarrow, D., ed. by NJWKreger−Van
Rij.Elsevier Science Publishers BV,
Amsterdam (1984), p. 379), yeast belonging to Satucharomyces cerevisiae and its synonyms or mutant strains, but for the purposes of the present invention, yeast for brewing alcoholic beverages belonging to Satucharomyces cerevisiae, specifically brewer's yeast. , wine yeast, sake yeast, etc. are preferred. Specifically, for example, wine yeast: ATCC 38637, ATCC 38638,
IFO2260 (wine yeast OC2), beer yeast: ATCC
26292, ATCC 2704, ATCC 32634, Sake yeast:
There are ATCC 4134, ATCC 26421, and IFO2347 (Sake Yeast Association No. 7). In addition, I would like to add that these yeasts have been developed over many years to have characteristics that are suitable for brewing, such as the ability to efficiently ferment brewing raw materials, the ability to produce alcoholic beverages with good flavor, and genetic characteristics. As a result of repeated selection and pure cultivation using stability as an indicator, beer yeast, for example, has become a high-order polyploid that is genetically extremely difficult to cross and separate, and has no ability to form viable spores. is almost completely lost. Incidentally, if we look at practical brewer's yeast, while its ability to assimilate maltose and maltotriose, which are sugar components in wort, has increased, it has lost its wild flavor, such as sensitivity to crystal violet. Transformation The procedure or method itself for creating a transformant can be one that is commonly used in the fields of molecular biology, bioengineering, or genetic engineering, so the present invention does not include procedures or methods other than those described below. It may be carried out according to these commonly used techniques. In order to express the gene of the DNA strand of the present invention in yeast, it is first necessary to connect this gene to a plasmid vector that stably exists in yeast. As the plasmid vector used in this case, all known vectors such as YRp system, YEp system, YCp system, YIp system, etc. can be used. These plasmid vectors are not only known in the literature, but can also be easily created. On the other hand, in order to express the gene of the DNA strand of the present invention in yeast, it is necessary to transcribe and transcribe the genetic information it has.
It needs to be translated. For this purpose, a promoter, which is a unit that controls transcription and translation, may be incorporated into the 5'-end upstream of the DNA strand of the present invention, and a terminator may be integrated into the 3'-end downstream of the DNA strand. The promoter and terminator are
Already ADH, GAPDH (also known as GPD), PHO,
GAL, PGK, ENO, TRP, HIP, etc. are known, and any of these can be used in the present invention. These are not only known in the literature, but also easily produced. Markers for selecting transformants to be obtained by the present invention include G418, hygromycin B, a combination of methotrexate and sulfanilamide, tunicamycin, ethionine,
Genes resistant to compactin, copper ions, etc. can be used. In order to more stably retain the DNA strand of the present invention in yeast, it can also be inserted into the yeast genome. In this case, it is desirable to separately introduce DNA with high homology to the genomic DNA into the plasmid vector in order to facilitate insertion of the DNA strand of the present invention incorporated into the plasmid vector into the genomic DNA. , for this
As the DNA, rRNA gene, HO gene, etc. can be used. Among these, it has been revealed that rRNA genes are repeated in tandem approximately 140 times in the haploid yeast genome (Journal of Molecular Science).
Biology, 40−261−277 (1969)). Due to this feature, when this sequence is used as a target sequence for recombination, there are the following advantages compared to when other gene sequences are used. (1) It is expected that the transformation frequency will increase.
(2) Changes in the corresponding traits of the target sequence due to integration are thought to be negligible. (3) By repeating a series of operations such as plasmid integration and vector sequence deletion, it becomes possible to integrate multiple foreign genes into the genome. In addition, the DNA strand that can be used for yeast transformation in the present invention can be used as long as the polypeptide encoded by it has α-ALDCase activity.
As mentioned above, it may encode a polypeptide different from the polypeptides A to B shown in FIG. Transformation of yeast with the plasmid thus created can be carried out by any suitable method commonly used in the field of genetic engineering or bioengineering, such as the spheroplast method [Proceedings of the National Academy of Sciences].・Sciences of the United States of America
USA (Proc.Natl.Sci.USA), 75 , 1929
(1978)], lithium acetate method [Journal.
Of Bacteriology (J.Bacteriol.), 153 ,
163 (1983)] etc. The yeast of the present invention thus obtained has a new trait (namely, the ability to produce α-ALDCase) due to the genetic information introduced by the DNA strand of the present invention.
As a result, intracellular α-AL is degraded and α-
This will reduce the amount of AL leaking out of the cells)
and the same xenotype or phenotype as the yeast before transformation, except for the traits derived from the vector used and the lack of corresponding traits due to the loss of some genetic information during genetic recombination that may have occurred in some cases. It is. Furthermore, if the DNA strand of the present invention is introduced into yeast chromosomes using a YIp type plasmid and then unnecessary vector sequences are deleted, the resulting brewer's yeast will not have the traits derived from the vector used. Therefore, the yeast according to the present invention can be used under essentially the same fermentation conditions as conventional brewing yeast, while suppressing the production ability of α-AL in the fermentation liquid. Therefore, as a result, the α-AL content of the fermented liquor is low, and therefore the maturation period of the fermented liquor required for the treatment can be significantly shortened. Production of alcoholic beverages When brewing raw materials are fermented using the yeast according to the present invention as described above, alcoholic beverages can be produced with the effects described above. It goes without saying that the raw materials for brewing are determined by the alcoholic beverage to be produced; for example, wort is used in the production of beer, and fruit juice, especially grape juice, is used in the production of wine. Yeast may be used in any suitable form, such as in a slurry form or in a fixed form. Brewing conditions are also the same as when using normal yeast. The yeast used in the alcoholic beverages produced is α-
Since it has the ability to produce ALDCase, α-AL
As mentioned above, it is possible to shorten the maturation period of the fermentation liquor required for its treatment for the production of alcoholic beverages with a low content and therefore a reduced DA odor. Example (1) Preparation of α-ALDCase gene (i) Purification of chromosomal DNA of α-ALDCase producing strain Acetobacter aceti subsp. % yeast extract, 2% peptone, 2% glucose) overnight to obtain 0.7 g of wet bacterial cells. Add this to 30ml of buffer (50mM Tris-
HCl (pH 8.0), 50mM EDTA).
Next, it was treated with 400 μg/ml lysozyme (manufactured by Seikagaku Corporation) and 10 μg/ml ribonuclease A (manufactured by Sigma) at 37° C. for 15 minutes. For this, 70
ml buffer (50mM Tris-HCl (pH 8.0),
50mM EDTA) was added. Then 0.5% sodium dodecyl sulfate (SDS) and 50 μg/ml
Proteinase K (manufactured by Sigma) at 65℃ for 30 minutes.
Processed for minutes. Next, phenol extraction was carried out twice.
Phenol:chloroform (1:1) extraction
I went around. After precipitating this with ethanol, 5 ml of
TE buffer (10mM Tris-HCl (pH8.0),
1mM EDTA). Then 100μg/ml
After treatment with ribonuclease A at 37° C. for 1 hour, phenol extraction and phenol:chloroform (1:1) extraction were performed once. After precipitating this with ethanol, it was dissolved in 2 ml of TE buffer and dialyzed against 1 liter of TE buffer to obtain 360 μg of chromosomal DNA. (ii) Preparation of cosmid library 11μg of chromosomal DNA obtained in (i) was treated with restriction enzymes.
I partially disassembled it to about 40kb using Sau3AI.
This was ligated to 4.2 μg of cosmid pJB8 arm (manufactured by Amersyam) using T4 ligase. This DNA was in vitro packaged using a λDNA in vitro packaging kit (manufactured by Amersyam) to produce Escherichia coli (E.coli).
DH1(F- ^, gyrA96, recAl, relAl?, endAl,
thi-1, hsdR17, supE44, λ ^- ) [Journal of Molecular Biology (J.
Mol.Biol.), 166 , 557−580 (1983): ATCC
33849] to obtain a cosmid library. (iii) Screening for α-ALDCase gene-carrying strains From the cosmid library obtained in (ii), α-
A strain carrying the α-ALDCase gene was obtained by selecting a strain exhibiting ALDCase activity. Specifically, from the Cosmid Library
600 strains were inoculated one by one into L-medium containing 50 μg/ml ampicillin and 0.5% glucose.
α-
ALDCase activity was measured. That is, each of the collected bacterial cells was suspended in 30mM potassium phosphate buffer (pH 6.2), 10μ of toluene was added, and the suspension was vigorously stirred for 30 seconds. The α-ALDCase activity of this cell suspension was determined by the method of Godfredsen et al. [Carlsberg Research Communication (Carlsberg.Res.
Commun.), 47 , 93 (1982)]. As a result, two strains retaining α-ALDCase activity were obtained. The resulting cloned plasmids were named pAX1 and pAX2, respectively. (iv) α-ALDCase gene DNA sequence determination The α-ALDCase gene was subcloned by the method outlined in FIG. first,
Obtained by partial decomposition of pAX1 with Sau3AI
Sau3AI fragment was added to pUC12 (Pharmacia).
inserted into the BamHI breakpoint. The plasmid thus obtained contained α-
A plasmid exhibiting ALDCase activity was found, which contained a 3.6 kb chromosomal DNA fragment (this plasmid was named pAXS11).
A plasmid containing an approximately 1260 bp fragment excised from pALS11 by KpnI and SacI.
A plasmid (named pAX6) was created by inserting pUC19 (manufactured by Takara Shuzo Co., Ltd.) between the KpnI and SacI cleavage points. E. coli carrying pAX6 is α-
It showed ALDCase activity. The KpnI-Sau3AI fragment contained in pAX6 was analyzed using the dideoxy method [Procedures of the National Academy of Sciences of the United States of America Proc.Natl.Acad.Sci.USA .
74, 5463 (1977)], the DNA base sequence was determined (from the 1st base to the 1252nd base in Figure 1). As a result of analyzing this, amino acid 304
There was an open reading frame of 912 bp that could encode a protein with a molecular weight of 33,747. (2) Introduction of α-ALDCase gene into yeast (Part 1) (i) Obtaining GPD promoter Satucharomyces cerevisiae S288C
[(α, suc2, mal, ga12, CUP1): Biochemical and Biophysical Research Communications (Biochem.
Biophys.Res.Commun.), 50 . 186 (1973):
[ATCC26108], chromosomal DNA was extracted according to the conventional method.
was prepared. After partially digesting this DNA using the restriction enzyme Sau3AI under conditions that generate many fragments of approximately 10 kb in size, the plasmid
A library was created by inserting it into the restriction enzyme BamHI cleavage point of pBR322 (manufactured by Takara Shuzo Co., Ltd.). GPD gene [J.Biol.Chem., 254 ,
9839 (1979)] from the 7th coding area
Synthetic oligomer corresponding to base 36 is ^32P
Using this as a probe, a clone containing the GPD gene was obtained from the library.
The plasmid DNA obtained from this clone was cut with the restriction enzyme Hind, and the approximately 2.1 kb Hind
Take the fragment and insert it into the Hind break point of plasmid pUC18 (manufactured by Pharmacia) to create a plasmid.
pGPD181 was created. Thereafter, the GPD promoter (Sal
−Bgl) was obtained. First, pGPD181 was cut with restriction enzymes Hind and Xba to contain the promoter region of the GPD gene (indicated by diagonal lines in Figure 4) and part of the coding region.
Hind-Xba fragment was obtained. Hind of this fragment
Synthetic double strand with the following base sequence at the end
Added DNA. This synthetic double-stranded DNA has
Contains the break points of Pst and Sph and the cohesive ends of Sal and Hind. [Table] TCGACCTGCAGGCATGCA
GGACGTCCGTACGTTCGA
Hind by addition of this synthetic double-stranded DNA
We were able to convert the ends to Sal ends. Next, we inserted this fragment into the Sal breakpoint of pUC19.
Inserted between the Xba break points. After cutting the plasmid pGPl thus obtained with Xba,
After completely deleting the coating region by treatment with Bal31 nuclease, blunt ends were made using Klenow fragment (manufactured by Takara Shuzo Co., Ltd.). A synthetic double-stranded DNA having the following base sequence was added to this blunt end (this synthetic double-stranded DNA has a Bgl cohesive end at one end). [Table] CAAGCTGGGCA
GTTCGACCCGTCTAG
By adding this synthetic double-stranded DNA, we were able to convert blunt ends to Bgl ends. After this, GPD obtained by cutting with Sal
The Sal-Bgl fragment containing the promoter was
We decided to call it GPD promoter (Sal-Bgl). (ii) Obtaining the PGK terminator PGK gene [Nucl.Acids Res., 10 , 7791 (1982)]
was cloned from the library prepared in Example 2-(i) using the same method as in Example 2-(i). As a probe, a synthetic oligonucleotide corresponding to the 1st to 28th bases of the coding region of the PGK gene and end-labeled with ³² P was used. The plasmid DNA obtained from this clone was cut with the restriction enzyme Hind to obtain a 2.9 kb fragment containing the PGK gene. This fragment was further cut with the restriction enzyme Bgl to create a 375bp Bgl-
Hind fragment was obtained. A PGK terminator was created from this fragment according to the method outlined in FIG. First, a synthetic double-stranded DNA having the following base sequence was added to the Bgl end of this fragment.
This synthetic double-stranded DNA contains the Sma cleavage site and
Contains sticky ends of Sac and Bgl. [Table] CGCCCGGG
TCGAGCGGGCCCCTAG
This Sac-Hind fragment was then transferred to pUC12
was inserted between the Hind and Sac cut points to create plasmid pPG1. Next, pPG1
was cut with Hind and treated with Klenow fragment to make blunt ends. A synthetic double-stranded DNA having the following base sequence was added to this blunt end.
This synthetic double-stranded DNA contains Sal cohesive ends. [Table] CTAGAG
GATCTCAGCT
Plasmids by recombining after addition
pPG2 was created. By cutting Sac and Sal,
Sac− containing the terminator part from pPG2
You can get Sal fragments. This fragment,
I decided to call it PGK Terminator (Sac-Sal). (iii) Preparation of expression plasmid and introduction into yeast α-
Plasmid pAX43 was created to express the ALDCase gene in yeast. First, the plasmid pAX6 prepared in Example 1-(iv) was cut with Kpn and Sac, and the approximately 1260 bp containing the α-ALDCase gene was extracted.
A Kpn-Sac fragment was obtained. By partially digesting this fragment with the regulatory enzyme Rsa, a 1.02kb fragment containing the α-ALDCase gene shown in Figure 1 was created.
Rsa-Sac fragment was obtained. This is a plasmid
Restriction enzyme Sma of PUC12 (manufactured by Pharmacia)
Plasmid pAX31 was created by inserting between the cut point and the restriction enzyme Sac cut point. By cutting this plasmid with the restriction enzymes Sac and BamH, a BamH-Sac fragment containing the above-mentioned α-ALDCase gene (from nucleotides 243 to 1252 of the base sequence shown in Figure 1 and part of the vector) was obtained. ) with an array of
This fragment and the three fragments of the GPD promoter (Sal-Bgl) obtained in 2-(i) and the PGK terminator (Sac-Sal) obtained in 2-(ii) were
Restriction enzyme of plasmid YEp13K [details below]
It was inserted between the Xho cleavage point and the restriction enzyme Sal cleavage point to create an expression plasmid pAX43 (Fig. 2). This plasmid pAX43 was transformed into yeast [Satucharomyces cerevisiae S288C] by the lithium acetate method [J. Bacteriol., 153 , 163 (1983)].
TD4 (a, his, ura, leu, trp), a mutant strain of
stock] was introduced. pAX43 obtained in this way
The TD4 strain containing this will be referred to as YAL2. The above plasmid YEp13K is a plasmid YEp13 that can be replicated in yeast [Gene, 8 ,
121 (1979): ATCC 37115],
It was created using the following steps. First, the two ends of the LEU2 gene of YEp13
The Sal-Sac and Xho-Sma fragments were deleted. As a result, this plasmid had no cleavage sites for the restriction enzymes Xho, Sac, Sma, and Bgl, but only one cleavage site for the restriction enzyme Sal. next,
Restriction enzyme from pBR322 in this plasmid
Hind breakpoint and restriction elements derived from 2 μm DNA
A synthetic oligonucleotide 41mer was inserted between the Hind cleavage point. This synthetic oligonucleotide has restriction enzymes Sac, Sma, Bgl, and Xho cleavage points, and has the following base sequence. In the present invention, the plasmid was named YEp13K. [Table] (iv) Expression of α-ALDCase gene in yeast.
), 2% glucose, 20mg/histidine,
20mg/tryptophan, 20mg/uracil]
After culturing overnight, α-ALDCase activity was measured. The results were as shown in the table below. The α-ALDCase activity of yeast was measured using the method of Godfredsen et al., in which bacterial cells were ground using glass beads and an enzyme solution was prepared. 1U of activity is per hour
The amount of enzyme that produces 1 μmmole of acetoin is shown. In addition, the amount of protein in the enzyme solution is
It was measured using a kit (manufactured by Bio-Rad). In the measurement results of yeast α-ALDCase activity in the table below, the activity is expressed as the number of units per protein amount in the enzyme solution (U/mg protein). [Table] (3) Introduction of α-ALDCase gene into yeast (Part 2) (i) Obtaining ADH1 promoter From the library prepared in Example 2-(i),
ADH1 gene [Journal of Biological Chemistry (JBC) 257 , 3018 (1982)]
A clone containing the AEH1 gene was obtained using a synthetic oligomer corresponding to the 7th to 36th bases of the coding region, end-labeled with ³² P, as a probe. The plasmid DNA obtained from this clone was partially digested with the restriction enzyme Sau3A to obtain a 1.5 Kb DNA fragment containing the promoter and part of the coding region of the ADH1 gene. This fragment was inserted between the restriction enzyme BamH cleavage sites of plasmid pUC18 (manufactured by Pharmacia), and the resulting plasmid was named pADHS1. The cleavage point of pUC18 by BamH is located between the cleavage point of restriction enzyme Xba and the cleavage point of restriction enzyme Sma, so BamH
The DNA fragment inserted at the break point is
They can be separated again by cutting with Sma. After cutting pADHS1 with Xba and treating it with endonuclease Bal31 to completely delete the coding region of the ADH1 gene,
A Hind linker (manufactured by Takara Shuzo Co., Ltd.) was added.
Next, after cutting this with Sma, a BmaH linker was added. This BamH-Hind fragment was used as the ADH1 promoter. The ADH1 promoter was inserted between the restriction enzyme BamH cleavage point and the restriction enzyme Hind cleavage point of plasmid YEp13K to create plasmid pYADH. (ii) Expression of α-ALDCase gene After cutting plasmid pAX6 with restriction enzyme Xba, it was treated with Klenow fragment to make blunt ends, then Bgl linker (manufactured by Takara Shuzo Co., Ltd.) was added, and ligated again to generate plasmid pAX6B. was created. A Hae-Bgl fragment (containing the 180th to 1252nd base sequence of the base sequence shown in FIG. 1 and part of the vector) containing the α-ALDCase gene was obtained from pAX6Bg (hereinafter referred to as fragment 1). Furthermore, the Sac end of the Rsa-Sac fragment obtained in Example 2-(iii) was treated with Klenow fragment to change it to a blunt end, and then a Bg1 linker was added. This Rsa-Bgl fragment (including the base sequence from 243rd to 1252nd of the base sequence shown in FIG. 1 and a part of the vector) will be referred to as fragment 2. Also, α-ALDCase from pAX6Bg
Hind-Bgl fragment containing part of the gene (first
1252 from position 345 of the base sequence shown in the figure
(hereinafter referred to as fragment 3) was obtained (hereinafter referred to as fragment 3). Plasmid pYADH was cleaved with restriction enzyme Hind, blunt-ended using Klenow fragment, and then cleaved with restriction enzyme Bgl. This fragment and the aforementioned fragment 1 or 2 were ligated to produce plasmids pAX39 (in the case of fragment 1) and pAX40 (in the case of fragment 2), respectively. In addition, fragment 3 was inserted between the restriction enzyme Hind cleavage point and Bgl cleavage point of pYADH to create a plasmid.
pAX41 was created. Plasmids pAX39, pAX40, and pAX41 can produce polypeptides encoded by fragment 1, fragment 2, and fragment 3, respectively, in yeast using the ADH1 promoter. plasmid
pAX39, pAX40, and pAX41 were each transformed into TD4 strain, and the resulting transformants were
ALDCase activity was measured. The results are shown in the table below. [Table] The polypeptide encoded by fragment 2 is shown in Figure 1.
These are the polypeptides shown from _A2 to B.
The polypeptide encoded by fragment 1 is shown in Figure 1.
A polypeptide from ₁ to B. Note that α-ALDCase activity could not be confirmed in the polypeptide obtained by expressing fragment 3. This means that when fragment 3 is expressed,
It is assumed that a short peptide consisting of amino acids corresponding to the base sequence from 352nd to 372nd in Figure 1 is produced (352nd to 354th).
It is presumed that ATG is the translation initiation codon and TGA at positions 373 to 375 is the translation codon.) Since this is a completely different peptide from α-ALDCase, it was thought that it did not exhibit α-ALDCase activity. (4) Introduction of the α-ALDCase gene into yeast (Part 3) Encodes a polypeptide with several amino acids added to the α-ALDCase polypeptide whose amino acid sequence is from A to B in Figure 1.
Expression of DNA strand (i) Overview A detailed examination of the nucleotide sequence shown in Figure 1 shows that upstream of the nucleotide sequence encoding the α-ALDCase polypeptide, whose amino acid sequence is from A to B, there are ATG or GTG that can be used as a starting point for translation in the leading frame
There are several. They are shown underlined and numbered 1-7 in FIG.
After selecting one of these ATG or GTG and performing an operation to initiate translation into a protein from that position, the amino acid sequence is changed from A to B in Figure 1 by expressing it in yeast. A polypeptide with several amino acids added to the N-terminus of the α-ALDCase polypeptide can be produced in yeast. However, if GTG is selected, it must be converted to ATG because GTG is not recognized as a translation initiation codon in yeast. The number of amino acids added changes depending on which ATG or GTG is selected. By the methods shown in (ii) to (v) below, these amino acid-added α-ALDCase polypeptides were produced, and they were shown to have α-ALDCase activity. (ii) Introduction of a new restriction enzyme cleavage site into pAX6 by site-directed mutagenesis (preparation of pALDC1-5) Oligonucleotides A to E shown in Table 1 were synthesized. [Table] Table 1 shows five sets of base sequences.
In each set, the bottom row is the base sequence of the synthesized oligonucleotide. The upper row shows the sequence of the site of pAX6 into which mutations are introduced using these oligonucleotides, that is, the base sequence before mutation, and includes any of the underlined parts 1 to 5 shown in FIG. The base sequence of the oligonucleotide (lower row) is the same as the changed base sequence obtained after mutation, and the changed bases are indicated with black dots (•) at the top. Due to the mutation, a new Dra cleavage site is generated immediately before the underlined parts 1 to 5 in FIG. Also, if the underlined part is GTG, it is converted to ATG. Mutation introduction into pAX6 using these oligonucleotides was performed using the site-directed mutagenesis method outlined in Figure 7 (Morinaga, Y. et al., Bio/Technology, 2) .
636-639 (1984)). The names of the mutant plasmids obtained and the expression plasmids produced from these mutants (details are described in (iv)) are shown in Table 1. By cleaving the mutant plasmid with Dra and Sac,
A Dra-Sac fragment containing the α-ALDCase gene is obtained. (iii) Introduction of a new restriction enzyme cleavage site into pAX6 using synthetic double-stranded DNA (creation of pALDC6 and 7) Synthetic double-stranded DNAs F and G shown in Table 2 were synthesized. [Table] These synthetic DNAs have a base sequence from either underlined part 6 or underlined part 7 shown in Figure 1 to the Nco cleavage site located downstream thereof, and also have a base sequence that extends from either underlined part 6 or underlined part 7 shown in Fig. 1 to the Nco cleavage site located downstream thereof. just before 7
Contains Dra and Hind cleavage sites.
After cutting pAX6 with Hind and Nco and removing the fragment from the Hind cleavage site derived from pUC19 to the Nco cleavage site in the α-ALDCase gene, synthetic DNA F or G was inserted to create plasmids pALDC6 and pALDC7, respectively. did.
Dra-Sac fragments containing the α-ALDCase gene are obtained from pALDC6 and pALDC7 by cutting Dra and Sac, respectively. (iv) Obtaining GPD promoter The GPD promoter (BamH-Hind) was obtained according to the method outlined in Figure 8.
First, pGPD181 prepared in Example 2-(i) was
The coding region was completely deleted by treatment with Bal31 nuclease, and the ends were made blunt using Klenow fragment. A Hind linker (manufactured by Takara Shuzo Co., Ltd.) was added to this blunt end and then cut with Hind to obtain a Hind fragment containing the promoter region. This fragment was inserted into the Hind breakpoint of pUC18.
In the plasmid obtained in this way, Hind
There are two ways to insert the fragment, one of which is
The pUC18 multiple cloning site located upstream of the GPD promoter was designated pST18. pST18 was partially digested with Hind, treated with the Klenow fragment, and then religated. Of the plasmids thus obtained, upstream of the GPD promoter
The plasmid in which only the Hind breakpoint was deleted was called plasmid pST18H. pST18H
The BamH + Hind fragment containing the GPD promoter obtained by cutting with BamH and Hind,
We decided to call it GPD promoter (BamH-Hind). (v) Obtaining PGK terminator A PGK terminator (Hind-Sal) was obtained according to the method outlined in FIG. First, EcoR of pPG2 prepared in Example 2-(ii)
A synthetic double-stranded DNA having the following base sequence was inserted between the cut point and the Sac cut point to create plasmid pPG3. This synthetic double-stranded DNA
It has Hind and Sph break points, and has EcoR and Sac cohesive ends at both ends, respectively. [Table] AATTCAAGCTTGCATGCGAGCT
GTTCGAACGTACGC
Contains the pGK terminator part excised from pPG3 by cleavage of Hind and Sal.
We decided to call the Hind-Sal fragment the PGK terminator (Hind-Sal). (vi) Preparation of expression plasmid An outline of the preparation method is shown in FIG. 10. First, the GPD promoter (BamH-Hind) obtained in Example 4-(iv) and the PGK terminator (Hind-Sal) obtained in Example 4-(v) were combined with the plasmid YEp13K prepared in Example 2-(iii). of
Insert between Bgl cutting point and Sal cutting point,
Plasmid pSY114P was constructed. pSY114P contains a gene inserted in a fixed direction between the Hind breakpoint and the Sac breakpoint.
It can be expressed in yeast using the GPD promoter and PGK terminator. pALDC1, pALD2, pALDC3 obtained in Example 4-(ii),
From each of pALDC4 and pALDC5, α-
Five types of Dra-Sac containing ALDCase gene
I cut out the pieces. After cleaving pSY114P with Hind, the single-stranded DNA portion was removed using mung bean nuclease (manufactured by Takara Shuzo). Furthermore, the ends were made blunt using Klenow fragment and then cut with Sac. Five types of Dra- containing this fragment and the above-mentioned α-ALDCase gene
Each of the Sac fragments was ligated to form α in yeast.
-Five types of plasmids (pAX50A to E) expressing the ALDCase gene were created.
pAX50A, pAX50B, pAX50C, pAX50D,
pAX50E is pALDC1, pALDC2, and
α- derived from pALDC3, pALDC4, pALDC5
Contains the ALDCase gene. It also contains the α-ALDCase gene excised from each of pALDC6 and pALDC7 obtained in Example 4-(iii).
Expression plasmids (pAX50F2 and pAX50G2) were created by inserting the Hind-Sac fragment between the Hind and Sac cleavage points of pSY114P, respectively. pAX50F2 and pAX50G2 are each
α-ALDCase derived from pALDC6, pALDC7
Contains genes. When the α-ALDCase gene is expressed in yeast using the above expression plasmid, the initiation site for protein translation and the encoded polypeptide are considered to be as shown in the table below. [Table] (vii) Expression in yeast Seven types of expression plasmids (pAX50A to E, pAX50F2, pAX50G2) prepared in Example 4-(vi)
The experimental yeast TD4 was transformed with The α-ALDCase activity of these transformants was determined in Example 2-
It was measured using the same method as (iv). The results are shown in the table below, and the transformants carrying any of the expression plasmids produced polypeptides having α-ALDCase activity. [Table] (5) Confirmation of reduction in diacetyl production by fermentation test (i) Production of brewer's yeast expression vector pAX43KL Figure 11 shows an outline of the production method. First, ADH1 promoter + lacZ that can express β-galactosidase in yeast
The gene was created. First, the plasmid
The lacZ gene (E. coli β-galactosidase gene) was obtained as a BamH fragment from pMC1871 (manufactured by Pharmacia). However, since this fragment lacks the promoter region and ATG, which serves as a translation start point, the BamH1 fragment of this lacZ gene was
inserted at the cutting point. Since there is a sequence of several dozen bases including ATG between the Hind breakpoint and the Bgl breakpoint of YEp13K, if the lacZ gene is inserted in the direction shown in Figure 11, the lacZ gene will be present in YEp13K. This ATG can be used as a translation initiation codon. Therefore, plasmid placZ1 in which the lacZ gene was inserted in such an orientation was selected. Next, the ADH1 promoter (BamH-Hind fragment) created in Example 3-(i) was added to the Hind fragment of placZ1.
Plasmid pADH1-lacZ was created by inserting into the BamH1 cleavage point. The plasmid is β-translated in yeast by the ADH1 promoter.
Galactosidase can be expressed.
After cutting pADH1-lacZ with Xho, it was made blunt-ended by Klenow fragment treatment, and
A linker (manufactured by Takara Shuzo) was added. After that, ADH1 promoter + lacZ gene
It was excised as a BamH-Sal fragment. On the other hand, the G418 resistance gene was excised from pUC4K (manufactured by Pharmacia) as a Sal-BamH fragment by Sal partial digestion and BamH cleavage. Contains the fragment containing this G418 resistance gene and the above ADH1 promoter + lacZ gene
The BamH-Sal fragment was inserted into the Sal cleavage point of pAX43 prepared in Example 2-(iii) to produce plasmid pAX43KL (Figure 12). (ii) Introduction of pAX43KL into brewer's yeast Using the pAX43KL produced above, commonly used brewer's yeast was transformed by the lithium acetate method. The transformant is G418
Among the strains primarily selected using resistance as an index, β
- Obtained by secondary selection using galactosidase activity as an indicator. When the α-ALDCase activity of the obtained transformant was measured, it was 3.2 to 3.2.
It showed an activity of 7.0U/mg protein. Among these transformants, two independent clones were selected and designated as YAL3-1 and YAL3-2, respectively. (iii) Fermentation test The transformant obtained above was treated with G418 10ppm.
The whole amount was added to 1 liter of wort (containing 10 ppm of G418) and statically cultured at 8°C for 10 days. The grown bacterial cells were collected by centrifugation (5000 rpm x 10 minutes). The obtained yeast cells were added to wort at 11°P (plateau degree) at a concentration of 0.5% (wet w/v). After stirring and sufficiently aerating the mixture, it was left to ferment at 8° C. for 8 days. After fermentation, the TDA (total diacetyl amount) of the fermented liquid from which bacterial cells were removed by centrifugation and paper filtration
and the degree of external fermentation was measured. The results were as shown in the following table. It was revealed that in fermentation using the yeast of the present invention, the amount of TDA produced was significantly reduced compared to when using the control strain. Note that TDA consists of vicinal digent and acetohydroxy acid, mainly DA and its precursor α-AL. In addition, the appearance fermentation degree is
It is defined as below. Appearance fermentation degree (%) = Original wort extract ( ⁰ P) -
Appearance of fermented liquid extract ( ⁰ P) / Raw wort extract ( ⁰ P) x 100 [Table] (6) Introduction of α-ALDCase gene into yeast (Part 4) Integration of α-ALDCase gene into yeast chromosome, Expression and fermentation test (i) Outline of the method for integrating the α-ALDCase gene into the yeast chromosome. It was inserted into the rRNA gene to create a fragment as shown in Figure 13. G418 this fragment
YEp type plasmid (pAS5, see Figure 14) having a resistance gene was used to transform yeast, and transformants were obtained using G418 resistance as an indicator. Among the obtained transformants, due to homologous recombination, the above-mentioned α-
We were able to obtain a transformant in which the ALDCase gene was integrated into the rRNA gene site of the yeast chromosome. (ii) Preparation of integrating plasmid (pAX60G2) Plasmid pAX60G2, which does not have the ability to autonomously reproduce in yeast and can only be retained in yeast by being integrated into the chromosome, was prepared using the method outlined in Figure 15. It was prepared as follows. First, the EcoR cleavage site of plasmid pUC12 (manufactured by Pharmacia) was treated with Klenow fragment, and after adding an Xho linker (manufactured by Takara Shuzo), ligation was performed again. This plasmid has a new Xho cleavage site, and at the same time EcoR on both sides of the Xho cleavage site.
The cut site is regenerating. This plasmid
After cutting with Xba and Klenow fragment treatment, ligation was performed again. The plasmid pUC12EX thus obtained no longer contains
Xba cut point not included. In addition, the rRNA gene was extracted from the library prepared in Example 2-(i) and the 5.8S rRNA gene (J.
Biol. Chem. 252, 8118-8125 (1977)) was obtained using a 5' end-labeled oligomer corresponding to the 4th to 32nd bases at the 5' end as a probe. Among these, 5.8SrRNA gene and
Approximately 3 kb each containing part of the 25S rRNA gene
The EcoR fragment was excised, treated with Klenow fragment, and then an Xho linker was added. This fragment was added to the previously prepared pUC12EX.
Plasmid pIRxho was created by inserting into the Xho cut point. Furthermore, the plasmid prepared in 4-(vi)
pAX50G2 was digested with Sal to obtain a fragment (shaded area in FIG. 15) containing the GPD promoter, α-ALDCase gene, and PGK promoter.
After processing this fragment with Klenow fragment
An Xba linker (manufactured by Pharmacia) was added and inserted into the Xba cleavage point of pIRxho obtained previously to create plasmid pAX60G2. (iii) YEp type plasmid containing G418 resistance gene
Production of pAS5 pAS5 was produced as follows according to the method outlined in Figure 16. First, pUC4K (manufactured by Pharmacia) was transferred to BamH.
The BamH fragment containing the G418 resistance gene (G418r) was cut out by cutting with
- It was inserted into the BamH cleavage point of pADH1-lacZ obtained in (i). Among the obtained plasmids, G418
We decided to call the product with two resistance genes inserted pAS5. pAS5 has one G418 resistance gene.
higher than that of a plasmid with no insertion.
Endowed yeast with G418 resistance. (iv) Integration of the α-ALDCase gene into the yeast chromosome The fragment obtained by digesting pAX60G2 obtained in (ii) with EcoR (i.e. the fragment shown in Figure 13) and the pAS5 obtained in (iii) (Fig. 14) ) was used to transform (co-transformation) brewer's yeast strain IF00751 by the lithium acetate method. The transformant is
G418 resistance and β-galactosidase activity were selected as indicators. The obtained transformant
After overnight shaking culture at 30°C in YPD medium, α-
By measuring ALDC activity, α-
A strain containing the ALDCase gene was obtained. After non-selectively culturing these strains in YPD medium for 12 to 13 generations, appropriate dilutions were made to prepare Ruby containing X-gal (5'-bromo4'-chloro-3'-indoyl-β-D-galactoside). [Method in Enzymology, vol.101, p253 (1983)]
was inoculated. This plate was cultured at 30°C for 3 to 5 days, and strains that did not develop blue color (i.e., β-
A strain showing no galactosidase activity was obtained.
These strains have lost pAS5 and the α-ALDCase gene and the GPD promoter necessary for its expression.
It is thought that only the PGK terminator was integrated onto the chromosome. YPD these stocks
After overnight shaking culture at 30℃ in culture medium, α-
ALDCase activity was measured. Of these stocks,
The strain that showed α-ALDCase activity of 1.0 U/mg protein was designated as YAL4. YAL4 to YPD
When cultured in medium for 47 generations, α-ALDCase
Activity was maintained at more than 75%. (v) Fermentation test YAL4 obtained in (iv) was statically cultured in 50 ml of wort at 20°C for 3 days, and the entire amount was added to 1 liter of wort and statically cultured at 10°C for 10 days. The grown bacterial cells were collected by centrifugation (5000 rpm x 10 minutes). The obtained yeast cells were heated to 11°P (plateau degree).
was added to the wort at a concentration of 0.6% (wet w/t). After stirring and thoroughly aerating this, 10
The fermentation was allowed to stand for 10 days at ℃. After completion of fermentation, TDA (total diacetyl content) and external degree of fermentation were measured for the fermented liquid from which bacterial cells were removed by centrifugation and paper filtration. The results were as shown in the following table. It was revealed that in fermentation using the yeast of the present invention, the amount of TDA produced decreased compared to when using the control strain. [Table] Deposit of microorganisms The microorganism YAL2 related to the present invention was deposited in April 1988.
It was deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry on April 7th, and has been given the accession number No. 1844 of the Institute of Industrial Science and Technology. Furthermore, the microorganism YAL4 related to the present invention was deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry on April 7, 1989, and has been given the accession number No. 2374 of the Ministry of International Trade and Industry. Furthermore, a plasmid containing the DNA strand of the present invention
pAX6 was introduced into Escherichia coli E.coli JM109 (manufactured by Takara Shudan Co., Ltd.) and transformed into E.coli JM109 (containing pAX6).
It was deposited with the FEIKEN on December 14, 1988, and has been given the accession number FEIKEN Article No. 2187.

[Brief explanation of the drawing]

FIG. 1 is an explanatory diagram showing an example of a DNA chain and an amino acid sequence according to the present invention. Figure 2 shows
FIG. 2 is an explanatory diagram showing the structure of pAX43. Figure 3 shows
This is a flowchart of subcloning of the α-ALDCase gene. FIG. 4 is a flowchart for obtaining the GPD promoter (Sal-Bgl). Figure 5 shows the PGK terminator (Sac-
This is a flowchart for acquiring Sal. FIG. 6 is a flowchart for the production of pAX43. FIG. 7 is an explanatory diagram showing the site-directed mutagenesis method. Figure 8 shows the GPD promoter (BamH-
This is a flowchart for acquiring Hind). 9th
The diagram shows the PGK terminator (Hind−Sal
(This is a flowchart of the acquisition of
Flowchart of acquisition of pAX50A-E.
FIG. 11 is a flowchart for the production of pAX43KL. FIG. 12 is an explanatory diagram showing the structure of pAX43KL. Figure 13 shows the GPD promoter and
FIG. 2 is an explanatory diagram showing the structure of a DNA fragment in which an α-ALDCase gene with a PGK terminator added is inserted inside a cloned yeast rRNA gene. FIG. 14 is an explanatory diagram showing the structure of PAS5. FIG. 15 is a flowchart for the production of PAX60G2. FIG. 16 is a flowchart for the production of PAS5.

Claims (1)

[Scope of Claims] 1 Encoding a polypeptide having α-acetolactate decarboxylase activity and whose amino acid sequence is substantially from A to B among the amino acid sequences shown in FIG. 1. A DNA strand capable of biotechnological production of α-acetolactate decarboxylase, characterized by having a base sequence that 2 DNA having a base sequence encoding a polypeptide having α-acetolactate decarboxylase activity and having an amino acid sequence substantially consisting of A to B of the amino acid sequences shown in FIG. 1. A yeast belonging to Satucharomyces cerevisiae, which is characterized by being transformed by a yeast chain and having the ability to produce α-acetolactate decarboxylase. 3 DNA having a base sequence encoding a polypeptide having α-acetolactate decarboxylase activity and having an amino acid sequence substantially consisting of A to B of the amino acid sequences shown in FIG. 1. A method for producing alcoholic beverages, which comprises fermenting a brewing raw material by yeast belonging to Satucharomyces cerevisiae that has been transformed by a saccharomyces cerevisiae and has the ability to produce α-acetolactate decarboxylase.