JPH05506578A - Modified BACILLUS THURINGIENSIS insecticidal crystal protein genes and their expression in plant cells - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Modified BACILLUS THLIRINGIENSIS Insecticide 8 Protein -l insects 2911 or the modified Bt gene encoding the insecticidal portion (“modified Bt Plants transformed using the modified Bt ICP gene The product has a higher expression level of the engineered CP encoded by it and has excellent insect resistance. can be shown.

First five blood 1 sen Plant genetic engineering technology has made significant progress over the past 2210 years. Plant foreign genes It is now possible to stably introduce it into the interior. This is important for modern agriculture. It offers a great opportunity. 1m of plant pathogen N Derivatives of the T. faciens Ti plasmid allow foreign genes to be transferred into plants and plant cells. It has proven to be an effective and extremely flexible vehicle for introducing ing. Furthermore, electroporation, microinjection, pollen mediation Various release methods such as gene transfer and particle gun technology DNA delivery methods have been developed for this purpose.

The main purpose of plant transformation by genetic engineering is crop improvement. Initially, arc resistant Research focused on creating beneficial properties in plants, such as: this Creating arc tolerance in transgenic plants at the point that I from the Bt strain Advances were made by using the gene encoding CP (Vaeck et al., 1987). did. Bt strain is a strain made of crystalline protein that is specifically toxic to larvae. Sporulating grams that produce parasporal crystals Positive bacteria. Bt ICP has a specific insecticidal spectrum and is effective against other animals and It is not toxic to humans (Gasser and Fraley, 1989).

Therefore, the Bt ICP gene is useful for plant engineering. extremely suitable for

For over 20 years, Bt crystal spore preparations have been used as bioinsecticides.

However, the general use of Bt sprays is limited by high production costs and crystalline proteins. quality is limited by its instability when exposed to the field (Va eck et al., 1987), heterogeneity of Bt strains is also well documented, and lepidopteran (Lep. idoptera) (Dulmage et al., 1981), Diptera 1 (Diptera ) (Goldberg and Margal, 1977) and Coleoptera (Co 1 eoptera) (Krieg et al., 1983) have been described. There is.

Bt strains produce endogenous crystals during sporulation. When ingested by the larvae, These crystals dissolve in the alkaline environment of insect bovine intestines and produce toxin precursors. n), which is then proteolyzed to produce the toxic core fragment, i.e. 60 It is converted to a ~70 kDa toxin. The toxin causes lysis of bovine intestinal epithelial cells. Bt The specificity of ICP is due to its interaction with the high-affinity binding site present in the bovine intestinal epithelium of insects. It can be determined by

Identification of Bt ICP and cloning and sequencing of the Bt ICP gene were conducted by H. 25fte and Whiteley (1989). BtI CP genes have a number of common characteristics. They are usually 60±10kD 130 kDa to 140 kDa or about 70 kDa containing toxin fragments of A. encodes an insecticidal protein (H6fte and Whiteley, 1989) , BtICP genes are divided into four major groups according to structural similarity and insecticidal spectrum. Loops: Lepidoptera-specific genes (CryI), Lepidoptera- and Diptera-specific genes offspring (Cr y II), Coleopteran-specific gene (Cr y IN) and Diptera-specific (Cry IV) (H6fte and Whiteley .

(1989), all lepidoptera-specific genes (CryI) are 130-140k. Encodes the Da protein. These proteins are usually used as toxin precursors. be synthesized. The toxic region is located within the N-terminal half of the toxin precursor. II! burial mound Deletion analysis of the Cryl gene in It has been confirmed that CryII is not essential (Schnepf et al., 1989). The gene encodes a 65 kDa protein (W i d n e r and W HiteIey, 1985). Cr y IIA protein is present in Lepidoptera and Diptera Cr y IIB protein is toxic only to lepidopteran insects. Shows toxicity. The Coleoptera-specific gene (Cr y III) usually has a molecular weight of about 70 (Whiteley and H6fte, 1 989), the corresponding gene expressed in E. coli (Cry IIIA) ) is against the Colorado potato beetle. It induces the synthesis of a 72 kDa protein that is toxic. This 72kDa The protein is a spore-associated bacterial protea that cleaves off the first 57 N-terminal amino acids. McPher is processed into a 66kDa protein by son et al., 1988), deletion analysis shows that this type of gene abolishes toxicity. It was found that it was not possible to excise at the 3′ end without Hiteley, 1989); Insect strains have been reported (European Patent Application (“EPA”) No. 89400428.2), CryIV class crystal protein genes are heterologous Diptera-specific crystal proteins. consists of the gene group (H6fte and Whiteley, 198 8).

Arc-resistant transgenic crops can be produced by using Bt ICP The possibility has been shown (Vaeck et al., 1987; Fischoff et al. 1987; and Barton et al., 1987), transgenic plants are important Agriculture that provides alternatives, is safe, environmentally acceptable and cost efficient (Meeusen and Warren) , 1989), and insect control has been successful under field conditions (Delannay et al., 1989). 989; Meeusen and Warren, 1989).

In all cases, to express the chimeric Bt ICP gene in m. robacterium-mediated gene transfer has been used (V a e c K et al., 1987. Barton et al., 1987; Fischoff et al., 1987) , Bt ICP is a strong promoter that can induce gene expression in plant cells. be brought under control. However, truncated genes s), the expression level in plant cells is at the insect-killing level of the BtICP gene. It is important to note that it will be high enough to obtain genes (V a e c K et al., 1987; Barton et al.

(1987), transgenic plants containing the full-length Bt ICP gene can kill insects. Additionally, Barton et al. (1987) found that the entire Bt ICP code It was also shown that tobacco calli transformed with the coding sequence became necrotic. these The results indicate that the Bt ICP gene has a significant expression level in plants. It presents an unusual problem that must be solved. A focus on plant transformation Even if the Bt ICP gene is used, no results can be obtained in transgenic plants. Steady-state levels of Bt ICP mRNA are used as markers. Comparison with levels produced by adjacent NPTII genes and other chimeric genes and extremely low (Ba r t o n et al., 1987: Vaeck et al.

(1987), and Bt ICP mRNA was further detected by Northern blot analysis. A similar finding was also made by Fischoff et al. (1987). It has been found that Bt ICP mRNA levels are lower than those of CaMV35S. much lower than expected for chimeric genes expressed from promoters reported. That is, cytoplasmic accumulation of bt mRNA, that is, its accumulation in plant cells. The synthesis and accumulation of mRNA and the resulting expression of Bt ICP protein are extremely rare. Efficient. In contrast, in microorganisms, the truncated Bt ICP gene has been shown to be less preferable than whole genes (Adanag et al., 1 985>, this could be due to inefficient expression simply due to the harvest of the Bt ICP gene in plants. This indicates that it is only related to expression.

The problem of obtaining significant tICP expression levels in plant cells is due to the BtrcP gene. This is considered to be an essential problem unique to genes. Furthermore, expression levels in plant cells Relatively low levels seem to be a common phenomenon for all Bt ICP genes. .

It is known that there are six steps that can control gene expression in eukaryotic cells (D arne 11.1982): 1) Transfer thin; 2) RN A processing control; 3) RNA transport control; 4) mRN A degradation system 59 (mRNA degrada-tion con troll); 5) l! translation control; and 6) Protein activity control.

For all genes, transcriptional control is considered to be the most important (The Mo 1ecular Biology of the Ce 11.1989>.

European Patent Application Publications (“EP”) Nos. 385.962 and 359.472 , codon usage (c) of the Bt ICP gene to improve expression in plant cells. Attempts have been reported to change the odd onus age). However However, large-scale (i.e., non-selective) changes in codon usage provide regulatory signals to genetic cows. , thereby causing problems in one or more of the above six steps of gene expression. and inhibit or interfere with the transcription and/or translation of degenerated foreign genes in M-cells. obtain. For example, changes in codon usage can result in differences in mRNA production rates; (e.g. mRNA regions not protected by liposomes) destabilize (by exposing it to attack and degradation by cytoplasmic enzymes).

Changes in codon usage may also affect the RNA polymer structure in these modified genes. may inadvertently result in inhibition or termination ofase II elongation.

1 plate 5 J1 According to the invention, the expression of a foreign gene in a plant cell transformed with the the level and/or rate of nuclear production of mRNA encoded by the gene; Foreign genes, especially Bt ICP genes, limited by rate and/or level Provided is a method for denaturing mRNA, which directly inhibits mRNA transcription, nuclear accumulation, and/or nuclear export, especially transcription, especially RNA polymerase II of plant cells. direct or indirect nuclear events that repress (i.e. inhibit or prevent) transcription elongation by Adenine and thymine sequences in multiple translated codons of genes that are induced by changing to corresponding guanine and cytosine sequences encoding the same amino acids; The adenine and thymine sequences, which contain The relative proportion of RNA polymerase U compared to the upstream (i.e. 5'1ll) region Cytosine and guanine in translated codons in one or more regions of a gene that are low in Preferably, it is changed to an array.

Furthermore, according to the present invention, a modified Bt ICP gene obtained by the above method is provided. .

Furthermore, according to the present invention, the plant cell genome is transformed into at least one modified Bt ICP gene. There is a method to improve the resistance of plants to pests by transforming them using offspring. provided.

The present invention further provides operably linked DNA fragments, namely: 1) Degenerated Bt ICP gene; 2) A suitable protein for inducing transcription of the degenerated Bt ICP gene in plant cells. motor; 3) Transcript suitable for expressing the modified Bt ICP gene in plant cells 3' end formation signal and polyadenylation signal chimeric genes that contain within the same transcriptional unit and can be used to transform plant cells It also concerns.

The present invention further relates to the following: - The nuclear genome preferably contains a stably integrated modified Bt ICP gene, especially a plant cell transformed to contain a chimeric gene; 4M cell culture consisting of the above plant cells; - Its genome is a modified Bt ICP gene , especially from the above-mentioned transformed plant cells containing chimeric genes and exhibiting improved insect resistance. a regenerated plant or a plant produced from M material thus regenerated; Seeds of one of the above plants; and The nuclear genome of a plant cell can be modified using a modified BtrcP gene, especially a chimeric gene. vector for constant transformation.

Mendou 5■1 In this specification, "Bt ICP" has insecticidal activity, B, thurin In the intact protein or a portion thereof that can actually be produced by S. 1ensis It should be understood that Bt ICP is a toxin precursor, and it does not need to be crystalline. an active toxin or other insecticidal truncated portion of a toxin precursor that need not be a natural protein; It can be. An example of a BtICP is the Bt2 insecticidal crystal protein (H8fte et al., 1 986), and at the C-terminus and/or N-terminus towards the trypsin cleavage site. The insecticidal moiety is truncated and preferably has a molecular weight of 60-80 kDa. Bt Other examples of ICP include PCT application publication No. WO90/15139 and W○9 No. 0109445, H6fte and Whiteley (1989) and European Patent Bt2, Bt3, Bt4, Bt13, described in issue number 90403724.9, Bt14, Bt15, Bt18, Bt21, Bt22, Bt73, Bt208, Mention may be made of Bt245, BtI260 and Bt1109P.

In this specification, "toxin precursor (protoxin)" refers to Bt ICP. It should be understood that it is the primary translation product of the full-length gene that encodes the gene.

As used herein, "toxin" or "active toxin" oxin)” or “toxic core” refers to protea toxins that can be obtained by enzyme (e.g. trypsin) cleavage and that have insecticidal power. It is to be understood that it is part of a precursor.

In this specification, “truncated Bt gene (t r u n c a t ed Bt “gene)” refers to at least the toxic portion of Bt ICP, preferably the toxin. It should be understood that it is a fragment of the full-length Bt gene coded for.

As used herein, the term "modified Bt ICP gene" encodes Bt ICP, and one or more of the DNA sequences without affecting the original amino acid sequence of Bt ICP. adenine (“A”) and thymine in the upper region, preferably in three or more codons. DNA in which ton (T) has been changed to guanine (G) and cytosine (“C”) It should be understood that it is an array.

three or more codons in two or more regions of a DNA sequence, especially in three or more regions Preferably, A and T in the DNA sequence are changed to G and C. In the region downstream of the site, there are about 10 or more codons, especially about 33 or more codons. Preferably, Don's AT is changed to GC.

The “region” of the modified Bt ICP gene is the region that affects the expression of the gene in plants. Any sequence that encodes three or more translation codons is meant.

According to the present invention, by studying the turnover of mRNA, The expression system of trCP genes such as 5 and bt18 is expressed at the nuclear level in plant cells. was found to be specifically inhibited. In another analysis, nuclear run-on assay (nuc 1ear run-on assay) using the nuclei of the N. tabacum plant, namely N23-220 (Vaeck et al., 1987); Chimeric BtICpH [RNA polymerase II conjugate that initiates transcription of the l gene The distribution and relative efficiency of In this regard, run-on assays Initially, the RNA polymerase II conjugate that initiates transcription of the Bt ICP gene used to measure relative efficiency and then RNA in the Bt ICP gene as used to determine the relative distribution and transfer efficiency of polymerase II conjugates. Became.

N23-220 is a chimeric gene that produces bt8 under the control of the TR2' promoter. Bt884, containing the 84 fragment, is derived from the bt2 gene (Hixi　fte　e et al., 1986) up to codon 610 (Va e c k et al. , 1987), the isolation of N23-220 was highly improved using nuclear run-on analysis. When incubated with a radioactive RNA precursor labeled with The extracted RNA transcripts were radiolabeled. RNA ports captured by intracellular transcription Eleven molecules of limerase continue to elongate the same RNA molecule in vitro.

Nuclear run-on assay of nuclei of N23-220 cultures (uninduced cells TR1'-neo and induced cells TR2'-bt884) are derived from TR1'' and TR2° promoters. revealed that their transcriptions were roughly equally effective. This is BtICP (i.e., Bt884), the low expression level is due to the transcriptional activity of the TR2' promoter. This suggests that it is not because it is low. However, regarding N23-220 nuclear Nuclear run-on analysis of nascent Bt ICP mRNA transcription Elongation is impaired somewhere between 700 and 1000 nucleotides downstream of the transcription start site. It was shown that This means that RNA polymerase II is Bt ICP-coding This means that the sequence cannot be transcribed with 100% efficiency. Signs spread throughout this area Using Bt DNA fragments and protein extracts prepared from tobacco nuclei. Filter binding assays show that this DNA region is associated with proteins present in the nucleus. It was revealed that these two species interact specifically. Such interactions occur between DNA polymers. This may prevent transcription by Rasase II from extending through this region or Denature the region of the first candidate event that affects specific protein binding and elimination. By doing so, the Bt ICP expression level increases. However, in this area Other mechanisms that act to hinder elongation in the cell cannot be excluded.

Furthermore, the present invention provides a code that is involved in suppressing the cytoplasmic Bt ICP mRNA level. Sequences within the coding region were identified by deletion analysis. For this purpose, deletion of pVE36 is necessary. Twenty-four lost derivatives were constructed. Three major types of deletion mutant strains were constructed (Fig. (See 3) -5' end deletion product -3° terminal deletion Ichichu dark part deletion body.

Mutant hybrid bt2-neo gene (Bt2 (Hdfte et al., 1 986) and one encoding a fusion protein of NPTII) was compared with the reference Transient expression experiments using the cat gene This study was conducted using a variety of experimental methods. For this purpose, SRI Measured in RNA extracts of protoplasts. The ratio of engineering and cat mRNA The transcript (i.e., mRNA) levels produced by the respective constructs using was relatively quantified. Such experiments revealed that the Bt ICP coding sequence sequential deletion of the carboxy-terminal (i.e., 3°) or amino-terminal (i.e., 5°) portions. It has been found that this results in a gradual increase in transcription levels. Change However, since the change in transcription level is not so rapid, these results suggest that BtI Low transcript levels produced by the CP gene are controlled by a single factor It turns out it's not something. However, individual modifications of the bt2 coding sequence Bt ICP in plant cells during transcript elongation, nuclear accumulation and nuclear export steps. Significantly reduces the interference and/or inhibition of the expression of mRNA encoded by the gene. Can be lowered. Furthermore, denaturation affects the cytoplasmic regulation and metabolism of such mRNAs and their translation. Can affect.

Deletion analysis revealed that several intermediate sites located within the Bt ICP coding region Here are six examples showing that sequences can be involved in suppressing Bt ICP expression: bt In 2 genes, nucleotide position M674 involved in suppression of Bt ICP expression a region of 326 bP located between nucleotide position 1000 and (Fig. 6), especially 268 bp located between nucleotide positions 733 and 1000, specifically In biological systems, it causes a decrease in transcription elongation efficiency and termination by DNA polymerase II. Two complete CCAAT boxes (Connelly and Manle3/.

1989), a 29 bp region located at nucleotide positions 765-794. area was identified. This intermediate gene fragment, i.e. the inhibition zone itself, is a Bt Other zones that reduce ICP expression levels or inhibit or interfere with expression This zone of inhibition includes multiple zones of inhibition that interact directly or indirectly with In the second step, the codon usage of the A- Modified by replacing T with GC. In this regard, 326b The intermediate fragment of p (Fig. 6b) was replaced with the modified B of the invention containing 59 modified codons. t Replaced with ICP fragment. The above inhibitory zone on Bt ICP expression The effects of this modification of the plant were evaluated in both transient and stable plant transformants. I valued it. The results show that such a change in codon usage has an effect on Bt ICP expression levels. shown to increase the number of insects and thus improve insect resistance.

Furthermore, by deleting the first 28 amino acids at the N-terminus, the N-terminal deletion mutants have been generated (Hi: 1fte et al., 1986), bt The first 28 codons in two genes can be deleted without loss of toxicity. It is known that (H6fte et al., 1986; Vaeck et al., 1987>, In addition, the usage of the three codons 29 to 31 is influenced by the amino acid sequence according to the present invention. The change was made by replacing A-T with G-C without any effect.

Additionally, the most recent version was constructed based on the Joshi (1987) consensus sequence shown in Figure 6a. An appropriate translation initiation (ATG) site was created.

Plants transformed using this modified BtICP gene have significantly higher BtI CP expression level is shown.

According to the present invention, all or part of the modified Bt ICP gene of the present invention can be used in plant cells. can be stably inserted into the nuclear genome in the usual manner and thus transformed Transgenic plants with improved expression of the Bt ICP gene were created using It is possible to produce a variety of plants. Regarding this point, Arobacte The degenerated Bt ICP gene in B. rium (e.g. A. tumefaciens) Using a defunct (dfsarmed) Ti plasmid containing, e.g. Published European Patent Application No. 116,718 and European Patent Application No. 270.822, published by PCT Application Publication No. 84102913, European Patent Application No. 87400544.0 and Go Plant cells can be transformed by the method described in Uld et al. (1991). (the above documents are hereby incorporated by reference), preferred The Ti plasmid vector is inserted between the border sequences of the T-DNA of the Ti plasmid or between It contains a foreign DNA sequence at least to the left of the right border sequence.

Of course, other types of vectors can be used for direct gene transfer (e.g. European patent applications). 233.247, pollen-mediated transformation (e.g. Application Publication No. 270,356, PCT Application Publication! WO85101856 and U.S. Pat. No. 4,684,611), plant RNA virus-mediated transformation ( For example, European Patent Application No. 67.553 and U.S. Patent No. 4,407,956. ), liposome-mediated transformation (e.g., as described in U.S. Pat. No. 4,536,47), No. 5), and recent descriptions for transforming certain maize lines. methods (Fromm et al., 1990; Gordon-Kamm et al., 1990 ) can also transform plant cells.

The modified Bt ICP gene is in the plant genome and controls gene expression in plant cells. inserted downstream of an inducible promoter, that is, under the control of this promoter is preferable.

Preferred promoters include, but are not limited to, cauliflower mosaic The strong constitutive 35S promoter of Rus (Odell et al., 1985) The 35S promoter has been obtained from various isolates (Hul) and and Howell, Virology 86.482-493 (1987)), Other preferred promoters include the TRI' promoter and the TR2° promoter. (Velten et al., 1984). Or even compositional. Use promoters specific for one or more tissues or organs rather than For example, the modified Bt ICP gene is described in European Patent Application No. 8630029 Ribulose-1,5-phosphate-carboxylase as described in No. 1.1 under the control of light-inducible promoters such as the promoters of the small subunit genes of By placing the gene in the plant, it is possible to selectively express it in the green tissue of the plant. Wear. Alternatively, its expression can be induced by temperature or chemical factors. The modified Bt ICP gene may use an octobin synthase promoter. gene (Gielen et al., 1984) or T-DNA gene 7 (Velt a suitable 3° inversion, such as the 3' untranslated end of Transcriptional regulatory signals (i.e. transcriptional 3′ end formation signals and polyadenylation signals) Preferably, it is inserted upstream of.

The resulting transformed plants of the present invention have improved expression of the modified Bt ICP gene, It is therefore characterized by the production of high levels of Bt ICP. Such plants are normal Breeding scheme to produce more transformed plants with the same excellent insect resistance produce or introduce modified Bt ICP genes into other varieties of the same or closely related plant species. can be entered. Seeds obtained from transformed plants contain modified Bt ICP. Contains it as a permanent genomic insert.

Additionally, two non-competitively binding, anti-lepidopteran or anti-coleopteran Bt ICPs are encoded. Cloning at least two modified Bt ICP genes into a plant expression vector. European Patent Application No. 89401499.2 Plants transformed using vectors contain two or more identical degenerated BtrcP genes. It is characterized by the onset of time. The resulting transgenic plants contain plant-feeding insects B. t Particularly effective in preventing or delaying the development of ICP resistance.

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. The drawings referred to in the examples are as follows.

Figure 1 - Transcription initiation frequency of RNA polymerase II conjugates in the nucleus of N23-220 Comparison of labeled 1L1 mRNA and Bt ICP mRNA and satemp Compare the hybridization efficiency with their complementary DNA present on the lot. compared. The DNA fragment was obtained by digesting plasmid pGSH163. I was able to get it. A schematic diagram of this area is given. Plot on Hybond-N filter The fragment length was 1), the homologous gene on plasmid pGsH163 (2) ) and densitometer values (3) are as follows: Digestion = 1 2 3 BamHI/HindIII 2358 neo 12386154Uヱ- Figure 2a--RNA port on the BtICP:I-ding sequence in the nucleus of N23-220. Measurement of distribution of limerase II conjugates. Labeled RNA prepared by nuclear run-on and Hybridization of Bt ICP coding sequence with DNA fragment quantified. Restriction fragments and scan values are given in the table and figures. The scan value is “X”, DNA fragment size, and RNA fragment hybridization proportional to the number of UTPs per ring. “X” is RNA passing through DNA fragment Directly proportional to the number of polymerases. “X” is proportional to the scan value divided by the number of UTPs In this regard, the X values of various restriction fragments are shown in the figure. Number of dATP complementary to hybridized RNA or present in the NA fragment Relative hybridization of various densitometer values by normalizing the values The value "X" was obtained by converting it into sorption efficiency. “X” is the number of transcripts and length of elongation. It is a relative scale. “x” is the RNA polymerase that transcribes a specific DNA sequence. reflected in the number and their growth rate. Plasmid of plant vector pGs8163 Each of the DNA fragments present in the Southern digest of DNA was The length of the fragment plotted on the ybond-N filter is 1), plus Homologous gene (2) on Mido pGSH163 and densitometer (i! (3)) have

Digested product: 1 2 3 Bas+Hr/EcoRI 8877 neo 15333726 River (Z) 2926 583　■罎3)　635 271 Gum (1)- BamHI/EeoRV 8887 neo 1518284 Tadashi 2466 729 square 110l 102Ba/HindllI 6250--2358 neo 12386 1695 field 6565 BamHI/5acI 8053 neo 141941353 anus 1) 4 572 1051 ■ 2) 615 Xsn+ 4973 neo 13219628Iyu (2) 1817 Figure 2b--Polylinker of M1B vector, MP18 and MP19 (Yanis nine bt884 DNA flags inserted into ch-Perron et al., 1985) Schematic diagram of the ment. Bt ICP coding sequence is 1600 nucleotides from AUG It shows up to the downstream side. Also shown are the relevant restriction sites and sizes of the DNA fragments. It is. Nucleotide numbers are relative to AUG. Subclones are shown in the figure. Named as pJD71, pJD72, pJD73, etc. (up to pJD79) as shown. I got it. The insert is - a fragment of the heavy chain M13 Bt ICP coding sequence into the M13 vector in an antisense orientation.

Figure 2cm - As described by Cox and Go Idberd (1988) Schematic diagram of three types of nuclear run-on analysis using the N23-220 nucleus. The experiment was carried out for 30 minutes. Label-like RNA was immobilized on a nylon membrane in a single 5 μg sample. It was hybridized with pJD71 to pJD79 and MP18 DNA. Turn on the membrane The density is determined by autoradiography and scanning the autoradiogram. tometer value was obtained. The horizontal axis represents the AUG of the Bt (i.e. rule 1) coding sequence. Relative nucleotide positions are indicated.

The center of each heavy chain Bt DNA fragment is shown in the graph. The vertical axis is The number of dATP in the fragment at each of the three incubation times For each fragment, the value of pJD71 was adjusted as 100%. gives a relative hybridization signal. All values are - heavy MM Corrected for non-specific hybridization to P18 DNA.

Relative values are indicators of reactivation of bt mRNA synthesis by RNA polymerase II becomes. The assay does not distinguish between the number of mRNA stretches and the length of mRNA stretches. Ta.

Figure 3-1 For measuring the effect on cytoplasmic Bt ICP mRNA level Construction of deletion mutant of bt860-neo gene. Parent vector pVE36 is shown. vinegar. The following deletion mutants were generated.

1. PJD50: pJD50 can be digested using BamHI and 5PhI. was derived from pVE36 by The protruding ends of 5' and 3' are Frenow DN. Filled using A polymerase ■ enzyme. Ligate the treated DNA and then was used to transform MC1061#lI cells. The transformant has an amp” phenotype. selected about.

2. PJD51: pJD51 can be digested using 5peI and sphI. was derived from pVE36 by The protruding ends of 5' and 3' are Flenow DN. Filled using A polymerase I enzyme. Ligate the treated DNA and then was used to transform MC1061 cells. The transformants were given an amp' phenotype. I chose it.

3. PJD52: PJD51 can be digested using EcoRV and 5phI. was derived from pVE36 by 5° and 3” protruding ends are Flenow DN Filled using A polymerase I enzyme. Ligate the treated DNA and then was used to transform MC1061 cells. The transformants were given an amp” phenotype. I chose it.

4. PJD53: pJD53 can be digested using XcaI and sphI. was derived from pVE36 by The 3′ protruding end is made of Klenow DNA polymer. Filled using Lasae enzyme. Ligate the treated DNA and then use it MC1061 cells were transformed. Transformants were selected for the amp” phenotype. did.

5. PJD54: pJD54 is erased using Af II I and sph I. It was derived from pVE36 by The protruding ends of 5' and 3' are cleated. It was filled in using the DNA polymerase enzyme. The treated DNA is ligated and then It was used to transform MC1061 cells. transformants I selected the current model.

6. PJD55: pJD55 can be digested using C1aI and 5phI was derived from pVE36 by. The 5″ and 3′ protruding ends are Frenow DNA. Filled using Polymerase I enzyme. The treated DNA is ligated and then it is was used to transform MC1061 cells. The transformants were tested for the amp' phenotype. I selected it.

7. PJD56: pJD56 can be digested using XhoI and sphI. was derived from pVE36 by 5° and 3' protruding ends are Flenow DN Filled using A polymerase I enzyme. Ligate the treated DNA and then was used to transform MC1061 cells. The transformants were given an amp' phenotype. I chose it.

8. PJD57: pJD57 was erased using AfII and BamHI. It was derived from pVE36 by The 5° and 3' protruding ends are cleated. It was filled in using the DNA polymerase enzyme. The treated DNA is ligated and then It was used to transform MC1061 cells. transformants I selected the current model.

9. PJD58: pJD58 can be digested using XcaI and BamHI. was derived from pVE36 by The 5″ protruding end is made of Flenow DNA polymer. Filled using Rase I enzyme. Ligate the treated DNA and then use it MC1064 cells were transformed. Transformants were selected for the amp” phenotype. did.

10. PJD59: pJD59 was digested using EcoRV and BamHI. pV by It was derived from E36. 5' protrusion Flenow DNA polymerase I at the end Filled with enzyme. Processed DN concatenate A and then use it to M C1061 cells were transformed. trait Transformants were selected for the amp” phenotype. did.

11. PJD60: pJD60 is digested using 5peI and BamHI Possibly pVE It was derived from 36. End of 5゛ protrusion The ends are Flenow DNA polymerase I enzyme. It was filled using the base material. processed DNA concatenate and then use it to MC 1061 cells were transformed. transformation Select for the amp” phenotype Ta.

12. PJD61: pJD61 was derived from PJD50.

PVE36 was digested with XbaI and filled in with Klenow Bolimerase I. did. PJD50 using BamHI Linearize with Klenow Bolimerase T It was filled using. PVE 36 of 37 Ligation of the 5bp Xba'I fragment into the BamHI filler of pJD50 did.

MC1061 fines using ligation mixture cells were transformed. Transformants am Selected for ρ゛phenotype.

13. PJD62: pJD62 was derived from PJD50.

PVE36 with XcaI and EcoRV Digested using PJD50 to Ba Linearize using mHI and Filled using limerase. P■ E36 375bp XcaI-Ec oRV fragment of pJD50B Connected to amHI packing. Concatenated mixture Transfect MC1061 cells using I decided to convert. Transformants amp” Selected for phenotype.

14. PJD63: pJD63 was derived from PJD50.

PVE36 as Xcal and EcoRV Digested using PJD50 to Ba Linearize using mHI and Filled using Limerase I. PV The XcaI-EcoRV fragment of pJD50 (474bz of E36) was B Connected to amHI packing. Concatenated mixture Transfect MC1061 cells using Converted. amp” expression of the transformant I chose the type.

15. PJD64: pJD64 was derived from PJD50.

PVE36 as EcoRI and EcoR Digested using V and Klenowbolimella The mixture was filled using *zee*. PJD50 was linearized using BamHI and Filled using Novolimerase I.

458bp EcoRI of pVE36 −EcoRV fragment to pJD5 0 BamHI loading. Communicating MC1061 cells using ligation mixture was transformed. Transformants are amp ゛Selected for phenotype.

16. PJD65: pJD65 was derived from PJD50.

PVE36 with EcoRI and Xbal Digested using a Klenow Borimeller It was filled using ZeI. PJD50 Linearize using BamHI and It was filled using Ubolimerase.

327bp EcoRI of PVE36 -XbaI fragment to pJD50 BamHI packing. Linking MC1061 cells using the mixture Transformed. Transformants amp” Selected for phenotype.

17. PJD66: pJD66 was induced from PJD5o.

PVE36 with 5peI and XcaI Digested using Klenow Bolimerase Fill it using I? ’, :, PJD50f: Straighten using BamHI and cleave Know It was filled using polymerase. P VE36 1021bp 5pel- XcaI fragment of pJD50 Connected to BamHI packing. Connected mix Shape MC1061 cells using compound It was transformed. transformants I selected the current model.

18. PP556D1: PP556D1 is digested with EcoRV. PJD56 was induced. The processed DNA is linked and then use it to MC 1061 cells were transformed. shape amp” phenotype of the transformant. I selected it.

19, PP556D2: PP556D2 has XcaI and Af I PJD56 was induced by digestion. 5' The protruding end is Klenowborimera. - Filled with Zee. processed ligate the DNA and then combine it with Transfect MC1061 cells using Converted. Transformants amp” Selected for phenotype.

20, PP556D3: PP556D3i, t, Spe I and EcoRV to digest using PJD56 was induced by.

The protruding end of 5′ is a klenouppo Filled using Limerase I.

The treated DNA is ligated and then MC1061 cells using it The transformant was transformed into a Selected for mp6 phenotype.

21, PP556D4: PPF; 56D4 is X c a r "C" groove" and partially digested with EcoRV. derived from PJD56 by ligated the treated DNA, Then use it to create MC106 1 cell was transformed. transformation Select for the ``amp'' phenotype 22, PP556D6: PP556D6 is digested with 5pel and EcoRV Partially digested with derived from PJD56 by The 5° protruding end is flared. Filled with polymerase ligated the treated DNA, Then use it to create MCLO6 1IIM cells were transformed. transformation Select for the ``amp'' phenotype did.

23. PP556D7: PP556D7 is digested with 5peI and XcaI Possibly P It was derived from JD56. 5° protrusion The exit end is a Klenow Boli Meller. It was filled using zeolite. processed Connect the DNA and then use it Transform MC1061 cells using I changed it. transformants I selected the current model.

24, PP556D8: PP556D8 was digested with SpeI and EcoR Partially digested with V From PP556D2 by guided. The protruding end of 5° is using Klenow Bolimerase I Filled. Connect the processed DNA and then use it to 061 cells were transformed. trait About the amp” phenotype of the transformant Selected.

Figure 4-1 Effect of Bt ICP code on cytoplasmic Bt ICP mRNA level Effects of deletions in the coding sequences, the invariant DNA 11 reference genes and the various Bts described in Figure 3. The cytoplasmic mRNA levels identified by the ICP deletion mutants are shown in the table. Note that the measured values were converted to relative Bt ICP mRNA counts. Bt Quantification of ICP and cat mRNA was described by Cornet Lssen (1989). So I did it as described. Slot plot total RNA and neo and radioactive quantification complementary to the cat coding sequence.

Figure 5--Relative transcript levels produced by deletion derivatives of pVE36.

Figure 6a - N-terminal deletion of bt2 coding sequence and codons 29,30 and 3 Schematic representation of the synthetic NA sequences used to introduce the changes in Figure 1. Engler et al. (1 Oligonucleotide 3 was annealed according to 988) and plasmid pVE36 1177b of pVE36. The plasmid pPsO28 was obtained by ligation with the C1aI restriction fragment of p.p. pP S028 is identical to PVE36 except for the N-terminal modification.

Figure 6b-1. Synthesis used to introduce an intermediate degeneration into the bt2 coding sequence. Schematic diagram of the NA sequence, as described by Engler et al. (1988). The sea urchin oligonucleotides were annealed and ligated, and the resulting concatemers (c oncatemeric) DNA fragment with restriction enzymes XbaI and ECOR The 327 bp denatured Xbal-EcoRI restriction fragment was cut with I cut it out. This fragment was added to pUc19 Hi n fi Ba A 1533 bp AflI engineered BamHI fragment of pVE36 was inserted into the mH1 site. pUC19 derivatives (Yani 5ch-Perron et al., 19 85) 3530 bp EcoRI-XbaI fragment of pPSO23 The plasmid pPS○24 was obtained. Plasmid pPsO24, restricted It was linearized by digestion with the enzyme XbaI and pPS 023-3 75bpf) XbaI restriction fragment was introduced to obtain pPsO25. Ta. The 1177 bp C1aI fragment of pPSO25 was converted to the 73 bp C1aI fragment of pPSO27. It was introduced into a 60 bp C1aI restriction fragment, yielding pps○29. pPs O29 is identical to pVE36, except for the accession of the Bt ICP coding sequence. Contains a min-terminal modification and an intermediate modification.

Figure 6cm - Nucleotide sequences of plasmids PVE36 and pPSO29 from 800 to 4000. “X” indicates that the nucleotide is unknown.

Figure 7--Graph of the effect of mutations on the AT content of Bt ICP plant genes. centre.

Figure 8a-1 Schematic diagram of the plasmid construct used in the transient expression assay, related components genes are shown.

Figure sb-1 CAT in a typical temporal expression assay (Neumann et al. 1987) and modified Bt ICP (Engvall and Pe5ce, 1978) Changes in the amount of accumulation.

In the following examples, all procedures for producing and manipulating recombinant DNA were performed, unless otherwise specified. These steps are available at Sambrooking Harbor Laboratory ( It was carried out according to the standard method described in (1989).

1. Chimeric Bt of RNA polymerase II conjugate ICP transcription in plant genes The relative efficiency of starting, as described by Vaeck et al. (1987), Transgenic plant N2 containing a copy of the T-DNA of Sumid pGSH163 The investigation was conducted using 3-220. This T-DNA is the chimeric plant gene pTR2b It has t8843°g7 and Pr*1neo3'ocs. N23-220 Nuclei from 25 g of induced leaves were prepared according to Cox and Goldberg (1988). The nuclei were then stored at a temperature of -70°C. By this method, the nascent mRNA precursor strand and The RNA polymerase II conjugate is stopped, while the conjugate remains attached to the DNA. Be unified.

Incorporating radiolabeled UTP from such nuclear batches as an indicator for the transcriptional potential of the nuclei. (Cox & Goldberg, 1988). This was successfully suppressed by adding α-amanitin to a final concentration of 2 μg/ml. can do. This is because UTP incorporation is involved in transcription by RNA polymerase II. a protein that is elongated and controlled by RNA polymerase II RNA synthesis in coding genes can be reactivated under appropriate experimental conditions It is shown that.

Using a batch of N23-220 nuclei, Cox and Go I dbe rg ( Radiolabeled RNA was synthesized as described by (1988). The radioactive RNA was used to determine the distribution of RNA polymerase II conjugates in DNA in the nucleus. directly represents. The DNA of N23-220 has two genes that can be assayed. Since it contains offspring, i.e., a chimeric plant gene and a chimeric Bt ICP gene, To compare the distribution of RNA polymerase II conjugates in two genes with Can be done. For this purpose, radioactive RNA was prepared by Cox and Goldberg (1988). > Extract from nuclei according to It was used as a bu. Southern blot shows the presence of neo and radioactive probes. Bt ICP and neo code in molar excess compared to the RNA species It contained a DNA fragment carrying the coding sequence. Southern plot details An explanation is given in FIG. Hybridization experiments were conducted using Mitate and Bt ICP codes. (Figure 1) , densitometer scans were performed on high to neo and Bt ICP coding regions. It showed that the intensities of the hybridization signals were almost the same. As a result shows that the number of transcripts starting from the TR dual promoter is approximately equal in both directions. Suggests. In plant N23-220, the neo mRNA level in the cytoplasm is several times larger than Bt ICP, which means that Bt ICP coding sequence actually suppresses the accumulation of Bt ICP mRNA in the cytoplasm. However, this phenomenon is mainly due to suppression of transcription initiation of the chimeric BtrcP plant gene. It is not caused by

2゜ The transgenic plant N2 described by Vaeck et al. (1987) RNA polymerase I in the Bt ICP plant gene present in 3-220 The relative distribution of I conjugates was investigated. For this, the N23-220 described in Example 1 A second experiment was carried out using a batch of nuclei.

Nuclei were prepared as described by Cox and Goldberg (1988). After incubation, radiolabeled RNA was synthesized. Radioactive RNA as described above After extraction, a probe for Southern hybridization was obtained. for this experiment A prepared Southern blot shows the molar ratio compared to the complementary RNA present in the probe. It contained an excess of several fragments of the Bt ICP coding sequence. fruit Experiments should confirm that the RNA polymerase II conjugate is Bt ICP-encoding. If the area is uniformly distributed, the various Bt ICs present on the Sachin plot Hybridization with P DNA fragments leads to It will be proportional to size and dATP content. on sachin plot Details of the DNA fragments present are shown in Figure 2a. Extracted from the nucleus of N23-220 From the hybridization of released radioactive RNA and Southern blot, N2 A complete tICP coding sequence such as that present in 3-220 is an RNA port. It was revealed that it is transcribed by limerase II.

Hybridization was performed by scanning the autoradiogram with a densitometer. Quantification of the Bt ICP coding sequence showed that According to the Bt ICP sequence, there is a position 1 at the 5' end of the Bt ICP coding sequence. The DNA fragment representing the Bt ICP sequence contains more radioactive 1[1 1 RNA was found to have hybridized. Actual values are given in Table 2a. this In the in vitro experiment, in vtvo''?-RNA polymerase is BtI It is shown that the CP coding sequence sequences are not uniformly distributed.

We determined more precisely the sites involved in inhibiting RNA polymerase II elongation. . The Bt2 code extends from the AUG to 1584 nucleotides downstream. Nine M13 derivatives containing partially overlapping fragments of the Ng sequence were generated.

The insert is inserted into the vector such that the Bt sequence is complementary to the Bt transcript in the heavy gM13 derivative. I inserted it in such a direction that it would look like this. A schematic diagram of the M13 clone is shown in Figure 2b.

N2 as described by Cox and Go Idberg (1988) Hives with labeled RNA prepared from nuclear run-on assays for 3-220 nuclei. a molar excess of each to act as a DNA target for redization. - Multi-layered anti-Bt DNA was bound to a nylon filter. incubation Three nuclear run-on assays were performed simultaneously, varying only in time. Incubusi The length of elongation of the nascent mRNA chain is determined by the extension time. during incubation The shorter the distance, the greater the position of the RNA polymerase II conjugate relative to the substrate DNA. Their elongation capacity at the start of incubation can be more accurately determined. That is, inv The results are shown in Figure 20. The data for the 5 minute incubation are shown in Figure 20. In vivo, in distinct zones of inhibition along the One or more factors interfere with transcription elongation in This indicates that the protein continues to exist within the inhibition zone during the mRNA elongation reaction. Ru. As the incubation time increases, in a subset of the DNA templates, Although inhibition in the inhibition zone itself is not significantly removed, in this assay RNA synthesis resumed downstream of this zone of inhibition. In this regard, data indicates the following.

1. The zone of inhibition pauses RNA polymerase, but does not stop it. 2. This pause is temporary for a small fraction of the Bt DNA template used. There is no other choice.

3. Continued RNA polymerase elongation downstream of the inhibition zone carried out by multiple polymerases in a relatively small fraction of the types.

Therefore, low levels of Bt mRNA in the cytoplasm may be at least partially due to neonatal metastasis. RNA polymerase 11 in the zone of inefficient elongation and/or inhibition of transcripts Due to inefficient production of pre-mRNA caused by termination of transcription of the conjugate It is thought that then.

Ability of the zone of inhibition to interact with proteins present in the nucleus of tobacco protoplasts was evaluated. Leaf protoplasts of tobacco SRI Luthe and Quatra (1980) and substantially according to Diffley and S. The filter binding app described by T.I.L.1man (1986) Used for Sei. 1100n protein extract sample from 0 to 1670 pmol 532 bp Xbar-Accl bt884D radiolabeled with various amounts of NA fragment and a final volume of 0.150 ml of binding buffer (10 mM Tri s pH 7, 5, 50mM NaCl, 1mM DTT, 1mM EDTA and and 5% glycerol). After incubating for 45 minutes at room temperature, The sample was filtered through an alkali-washed nitrocellulose membrane, and 10mM Tris pH 0.150ml water cooling containing 7,5,50mM NaCl and 1mM EDTA Washed twice with solution. The retention of DNA-protein complexes is measured using a scintillation counter. The binding has a dissociation constant in the 100100 p range, as quantified by became clear. Binding involves brazing the nuclear extract with a molar excess of specific competitor DNA. It was not affected by incubation.

3. The above two examples show that the Bt ICP coding sequence in the chimeric plant gene is Cytoplasmic Bt ICP mRNA levels induced by chimeric plant genes was shown to suppress This repression occurs not at the transcription initiation stage, but at least In part, BtICP mRNA precursor of RNA polymerase II is generated. It has become clear that this is due to a decline in the ability to Poor transfer elongation is B In order to identify whether the t1CP sequence is the only mechanism that interferes with gene expression, a key Deletion analysis of the Mela Bt ICP plant gene was performed. What I want to find out through the experiment is , the introduction of specific deletions in the Bt ICP coding region acts to inhibit Whether a sequence element can be removed or inactivated. As a result, this Such a mutant gene would increase the mRNA level in the cytoplasm, This method can be used to map and identify sequences involved in repression. Ru.

To perform this analysis, we used the bt860-neo gene (vaeck et al., 1987). A schematic diagram of the generation of a series of deletions is given in Figure 3. The deletion derivative obtained was Bt Does not specify ICP and is therefore evaluated only at the RNA level. Accurate IC To obtain P mRNA concentration values, deletion mutants were isolated from SRI tobacco leaf protoplasm. Transient expression system using the human body (Cornelissen and Van A comparison was made in d e w i ele, 1989). Mutant Bt ICP identified by the cat reference gene present on the same plasmid as the gene Relative mRNA numbers were calculated using the correction factor provided by mRNA. Legacy Four hours after gene transfer, tobacco leaf protoplasts were collected, and total RNA was prepared and analyzed. Figure 4).

Calculation of the Bt ICP coding sequence from mutant numbers 50-60 (Figure 3) Sequential deletion of boxy-terminal or amine-terminal moieties results in neo transcript levels It can be seen that the result is a gradual increase in . Changes in transcript levels are less rapid. Therefore, from the above results, the transcript produced by the full-length Bt ICP gene It can be seen that the low level is controlled by multiple signals. In fact, Bt. Deletion within the ICP coding sequence results in BtICP mRNA itself The specific sequence elements responsible for the low levels were not identified. Similarly, Cloning of a fragment of the Bt ICP coding sequence in pJD50 (Figure 3) It was also not possible to identify such regions by scanning.

Relative transcript levels to the length of the Bt ICP sequence present in the various deletion derivatives. Figure 5 shows that as the length of the Bt ICP sequence increases, the hybridization rate increases. The results show that BtICp-neo transcript levels are reduced. This point smells Mutant numbers 61 to 66 (Fig. 3) show that the transcription of Bt ICP sequence length is It is an exception because the average level of materiality is low.

From the above results, the low transcript level of the Bt ICP plant gene in tobacco is , chimerism is not only caused by defective elongation of nascent transcripts, but also by a number of signals. It can be seen that the expression ability of the Bt ICP gene is reduced.

E tribe 1 Cytoplasmic events contribute to inefficient bt2 gene expression in plants. In order to determine whether this is important, we conducted the following test. N23-220 Tran Steady-state levels of bt2 mRNA in the cytoplasm of subgenic leaf protoplasts are normally It has been found that there is usually less than one transcript per cell. The steady state level is , the number of bt2 transcripts entering the cytoplasm per unit time and the cytoplasmic half of the transcripts. Determined by and proportional to the shelf life. Once steady state levels are reached, the cells The number of transcripts entering and exiting the bt2 mRNA pool in the plasma will be equal.

Therefore, the cytoplasmic half-life and cytoplasmic steady-state levels of bt2 transcripts indicate that cells Are intraplasmic steady-state levels due to relatively low influx of bt2 transcripts? , whether this is due to a relatively high turnover (i.e., conversion to protein) rate, or It will become clear whether this is caused by a combination of both.

Cytoplasmic turnover of bt884 transcripts was measured according to Gallie et al. (1989). Established. Promega Corporation (Medison, Wisc. onsin.

Synthesis capped and polyadenylated according to the protocol of USA) t884 mRNA was produced in vitro, and synthesized by ar(DeBloc). K et al., 1987) were simultaneously introduced into tobacco leaf protoplasts using mRNA.

The two synthetic transcripts differed only in the coding sequence. Various times after RNA delivery Samples were taken at points and total RNA was isolated. By Northern analysis, synthetic t884 The half-lives (TI/2) of the and bar transcripts are approximately 8 ± 3 hours and 5 ± 2 hours, respectively. It became clear that it was between. See Table 1 below, from these data, bt8 84 coding sequence, especially the t884 codon usage and bt884 coding The AU-rich motif in the sequence makes bt884 approximately 10 per tobacco leaf protoplast. 00 transcripts accumulate in the cytoplasm (Cornelissen, 1989). does not make it more unstable than bar mRNA, which is known to be That is clear. That is, the low cytoplasmic steady-state level of bt884 transcript , which is caused by insufficient influx of transcripts into the cytoplasm. That is, bt8 Defective expression of the 84 gene causes a modification of the bt884 code that improves the expression system in vegetation. It must be restored by introducing it into the switching array.

The expression of bt14, bt15 and bt18 genes in tobacco It was also revealed that the protein induced low steady-state levels of cytoplasmic mRNA.

Therefore, whether the defective expression is cytoplasm-dependent or nuclear-dependent. A similar procedure was performed using synthetic t14, bt15 and bt18 transcripts to identify An analysis was conducted. Table 1 below shows that all three transcripts are present in tobacco leaf protoplast cells. This indicates that the mRNA behaves as a stable mRNA in the cells. That is, bt884 gene Similar to the offspring, bt14, bt15 and anti-' genes also produce high levels of bt transcripts. It must have a defect in efflux into the cytoplasm, and the expression of such a gene must be defective. To improve gene expression, these coding sequences must be modified to prevent efficient gene expression. It must be modified to avoid or alleviate harmful nuclear events.

Table 1 Nieotiana tabacum cv, Petite Havanna Example 1 of half-life measurement of synthetic round and bar mRNA in SRI leaf protoplasts °tmRNA Tl/2 2”+eRNA Tl/Z (time) (time) c bt length 124/-5 sin 2N/-12D bt18 10+/-5 bar 　12+/-5■Tom The synthetic ar transcript has a length of 783 bases and includes a cap and a TMV leader. - (77 bases, Danth i nne and Van Emmelo, 1990) and bar coding sequence (552 bases; De Block et al., 1987) , base GAUCA CGCGA AUU and pGEM-3Z (Promega) Polylinker (KpnI (T4 DNA Po1.)-HindlII (T4 A 52 nucleotide trailer consisting of 39 bases derived from DNA pop,)) , poly(A) of composition (A) ssG (A) 32G (A) az and subsequent nulls It contained cleotide GCU.

The synthetic t884 transcript has a length of 2066 bases and includes a cap, TM V leader (77 bases), bt884 coding sequence and subsequent Flenow treatment. Contains a trailer (1843 nucleotides in total) up to the PstI site, After the trailer, AAUUCCGGGGG AUCAA UU, 39 bases. pGEM-3Z polylinker, (A).

3G (A) 32G (A) 21 poly(A>, and subsequent nucleotide CG continued.

The synthetic t14 transcript has a length of 2289 bases, with a cap and a TMV leader (77 bases) and bt14 coding up to the Flenow-treated BclI site. sequence (2023 bases) and 26 complementary nucleotides CG UCG ACC UGCAGCCAA GCU UGCUGA and UUGAU UGACCGGA UCCGGCU Trailer starting with CUAGAAUU and the following 39 base p OEM-32 polylinker and (A)33G(A)32G(A)21 poly(A) and the following nucleotide CGGUA CCC.

The synthetic t15 transcript has a length of 2198 bases and is similar to caffe, TMV, etc. (77 bases) and pVE35 (PCT Application Publication No. W090/15139) bt15 coding sequence such as and a subsequent Flenow-treated BamHI site or Trailer (1989 bases in total), followed by AAUU, 3 bases pGEM -32 polylinker and (A) 33G (A) 32G (A) 21 poly(A) and the following nucleotide CG.

The synthetic t18 transcript has a length of 2184 bases and contains a cap and a TMV region. (77 bases) and bt18 coding up to the Flenow-treated BclI site. Sequence (1918 bases) and the following 26 nucleotides CG until the end of translation UCG ACCUGCAGCCAA GCU UGCUGA and UUGAU U Trailers starting with GACCGGAUCGAUCCGGCUCAGAUCAAUU -, 39-base pGEM-3Z polylinker, (A), 3G (A)) 2G ( A) Contained 21 poly(A) followed by the nucleotide CG.

5. Bt ICP Examples 1 to 4 show that the expression of the Bt ICP gene in plants is controlled by the Bt ICP code. It is suppressed at both transcriptional and post-transcriptional stages by It was shown that this was due to the event. These Examples further provide that inhibition of expression is achieved by BtICP It has also been shown that it is not limited to specific DNA sequences within the coding sequence. rather , suppression of gene expression is an inherent property of the Bt ICP coding sequence. this By changing the DNA sequence of the Bt ICP coding region based on the This is thought to improve gene expression. Bt ICP coding area The inhibitory effect is spread throughout the coding sequence, so the improvement is cumulative. be. Similarly, gene expression reduces the length of the Bt ICP coding sequence. It can also be improved by

This improvement is cumulative when used in combination with modification of the Bt ICP coding region. Gives a product effect.

Therefore, two types of modification are possible in Bt ICP (i.e. bt2>coding sequence). When introduced, Bt ICP caused a significant increase in plant gene expression, as described below. Brought. First, transcription elongation occurs in the central region of the toxin core fragment of Bt ICP. Since the DNA sequence is changed in this region, the corresponding Since the inhibitory effect is proportional to the length of the Bt ICP coding sequence, Bt IC The length of the P coding sequence was reduced. Details of the mutations are shown in Figure 6a, Figure 6b and As shown in Figure 60 and Figure 7, the chimeric Bt ICP residue is The AT content of the genes changed significantly. Also, by degenerating, of the BtICP coding sequence without affecting the amino acid sequence of the protein. The primary DNA structure has changed. Bt ICP code for more DNA mutagenesis It is clear that gene expression will be further improved if it is introduced into the coding sequence. It is.

To measure the effect of degeneration, the degenerated Bt ICP gene and the parental bt860-ne The expression characteristics of the o gene were determined by Cornelissen and Vandewi. (1989) and Denecke et al. (1989). Comparisons were made in a transient expression system. Essentially, the accumulation profile of the gene under investigation by correlating it with the profile of a reference gene that was present in the same experiment. Figure 8a shows the vectors used in this assay, and Figure 8b shows the vectors used in this assay. It shows that the accumulation of the reference cat protein is approximately equal in re-experiments. parent To measure the accumulation of Bt ICP encoded by the bt860-neo gene of However, the degenerate Bt fcP gene clearly has more Bt IC P synthesis was induced.

The above results indicate that mutations in the Bt ICP coding sequence It was shown that the suppressive effect of the Bt ICP coding sequence on the expression of offspring was alleviated. It shows.

6. Cronin and Btrcp in tobacco and potato U.S. Patent Application No. 821,582, European Patent Application No. 8, dated January 22, 1986. 6300291.1, European Patent Application No. 88402115.5 and European Patent Application No. Using the method described in Application No. 89400428.2, the modified Bt shown in FIGS. 6 and 7 The ICP (i.e. bt2) gene was transferred to an intermediate T-DNA vector, pGsH1160 (D Do not insert between the T-DNA terminal border repeats in Eblaere et al., 1988).

For significant expression in plants, the modified Bt ICP gene has a strong TR2' protein. under the control of the T-DNA gene 7 (Velten et al., 1984). fused to the transcript 3' end formation signal and polyadenylation signal (Velt en and 5che I, 1985).

Furthermore, in order to optimize translation initiation in plant cells, translation initiation-related parts (co n t e x t ) t or site as Joshi consensus sequence i, 1987). For this, a double oligo [(o　l　i　 go dup l ex) (Figures 6a and 6b) to insert the sequence at the translation start site. ; generated AAAACCATGGCT. In this way, we code alanine. An additional codon (i.e. GCT) was introduced.

Furthermore, upstream of the ATG translation start codon, we placed the entire "21"- and BstX engineering site. .

Using standard methods (Deblaere et al., 1985), the modified Bt ICP gene An intermediate plant expression vector containing the expired Ti plasmid pGV2260 (Vaec A robacterium strain C58CI Rif' (K et al., 1987) U.S. Patent Application No. 821.582; European Patent Application No. 86300291゜1) It was imported into. Selected for spectinomycin resistance, pGV2260 and individual A co-integration plasmid consisting of an intermediate plant expression vector was obtained. These recombinations Each of the Arobacterium strains was used to grow various tobacco plant cells (Nic otiania tabacum) and potato plant cells (Solanum tuberosum> in which the modified Bt ICP gene is derived from various tobacco and potato plants. It was transformed to be contained and expressed in plant cells.

Transgenic tobacco plants containing the modified Bt ICP gene were analyzed by ELISA assay. Analyzed by Say. Such test plants have non-denatured Bt ICP (bt2) genes. Compared to transgenic tobacco plants containing offspring, Bt (Bt2) It was characterized by a significant increase in the level of

of the modified BtICP (bt2) gene in leaves of transformed tobacco and potato plants. The insecticidal power of the expression product was determined by the presence of hawk moths (t.o. b　a　c　c　oh　.

rnworm) (Manduca 5exta), Tobacco budworm) (Heliotis vi). The fruit was transformed using the native or parental Bt ICP (bt2) gene. Leaves of tanoko and potato plants and untransformed potato and tobacco plants The growth rate was compared with that of larvae placed on top of the larvae. l! Gender analysis is European Patent Application No. 8840 No. 2115.5 and European Patent Application No. 86300291.1. did.

Young plants placed on the leaves of transformed plants that contain and express the modified Bt ICP gene. A significantly high mortality rate was obtained for insects. Taba containing modified Bt ICP gene The tobacco and potato plants contain the native Bt ICP gene. It showed a significantly higher Bt ICP expression level compared to potato plants.

Investigating the insecticidal power of three types of transgenic tobacco plants containing the modified Bt ICP gene. , evaluated on second and third instar larvae of He1iothis virescens. did. Control plants were not transformed. The results are summarized in Table 2 below.

Table of contents Control plant pest mortality rate (%) (recorded after 5 days) Control 11 No, 1 100 No, 2 88.5 No, 3 100 Needless to say, the present invention also applies to transgenic plants transformed using the modified Bt ICP gene. 6 The present invention, which is not limited to bacon and potato plants, includes tomatoes, alfalfa, Sunflower, corn, cotton, soybean, sugar beet, rapeseed, rapeseed 1 (b rassicas) and other vegetables. Includes any plant transformed using the gene.

The present invention also provides a method for transforming plant cells using a modified Bt ICP gene. Using Arobacterium tumefaciens Ti plasmid Liposomes, electroporation or plant Other known plant transformations such as virus- or pollen-based vector systems technology to transform monocots and dicots using such modified BtCP genes. It can be used to.

Furthermore, the present invention is not limited to the bt2 gene, but also includes CryI, CryII, C Includes all Bt Icp genes, ryIII and CryIV.

To the missing piece of begging for $100; Tech e141vr↓Su125/H Tozamoto Sei 4 How many 3 people danq at al,, Gene 36. 289-300 (1'15).

-Person 5 salin at al, Oncogena 4. 549-558 (1989).

-Barton at al, Plant Physiol, 85.11 03-1109 (19B?).

-Connely and Manley, Ca1l 57. 567-57 1 (1989) - Connely and Manley, Molecula r and Ce1lular Biology.

Dan, 5254-5259 (1989) - Cornelis+! Ien, Nu cl, Incids Res, l, 720 Cor 7209 (1989).

-Cornelissen and Vandewiele, Nucl, Ac1 ds Res, 17゜8 here-84:I ('[91!91゜-Cox and Goldberg, in: Plant Molecular Biolo gy, practical approach, edited by C,S haw, IRL Press.

pp. 1-35 (1988).

-Danthinna and Van Emmalo, Me, Fac, La naouvw.

Rljksuniv, cent 55 (Coa), 10'37-1045 (1 990).

- Darnall, Hasure 29ヱ, Colo 5-371 (1982).

-Debla@r@@t al,, Methods in Enzymolog y 15], 277-292 (198 g).

-Debltxer@at al,, Theleic Ac1ds Re5e arch 1, 4777-4787 (191i15).

-Da Block at al, EMBOJ, 6. 2513-2518 (1987).

- Delannay at al, Bio/Technology, 126 5-1269 (1989).

-Denacka et al, Meth-Mob, Ca1- Biol, 1 ．． 19-27 (19B9).

-Diffley and Stillman, Mo1. and Ca11. Biol, 6°1co6co1373 (1986).

-Dulmage H, T, “Production of Bacaria for Biological Control of engineering 11 Biologic & 1Control in CropProducti on'' Ed, Paparizas D, C-, osmum Publicis hers.

Totowa, N. Y., USA, pp. 129-141 (1981).

-Engler et al, J, Biol, Chew, 2 mutually, 1 2ko84-12ko9° (1988).

-Engvall and Pa5ce, 5cand, Eng mz*no1.5u pp1.7 (1978).

-Fischoff at al,, Bio/Technology 5.　 a07-1112 (1987).

-Fromn @t al,, Bio/Technology, 8 here atsaq, (1990).

-Ga1li@at al,, Plant C@ll A, Ko01-31!　 (19519).

-Gasgar and Fraley, 5cianca 244. 129 pieces -1299 (1989).

- Gielen at al, BP J2 to E. 8 pieces 5-845 (19 84).

-Goldberg L, and Margaret J, Mo5q, Hay s Yu2. Ko 55-358 (1977).

-Gordon-Kaw e Ce al,, The Plant Ce1l 2. 603 et seq.

(1990).

-Gould at al,, Plant Physiol, 9-mutual, 426- 434 (1991).

-Hoffmann et al, Proc, Natl, Acad, Sci , USA and mutually.

7844-7848 (1988).

-H6fte @hi al,, Eur, J, Biochem 161. 27 pieces -280 (1986).

-H6fte H, and Thieley H, R,, Microbiol ogical Reviews, 242-255 (1989).

- Joshi, (1987) Nucl, in aids Res, 15. 664 Ko6653゜-Krieg et al, Z, Inq, Ense 96. 5 00-508 (19fl).

-LuSe and Quatrano, Plant and Physi ology 65. Ko05 (1980).

-Mc Pherson at al, Bio/Technology 6. 61-66 (1988).

-Meeusen and Warren, Enter nn, Rev, Entom ol, 34. 373-381 (19g9).

-Miller et al, Mo1ecular and Ce1lula r Biology 9゜5340-5349 (1989).

-”The Molecular Biology of the Ce1l, 5econd Edition”.

Eds, 1 berts e se al,, Garlanc!　Publish ng Co, N, Y, and T Andon (1989).

-Neumann et al, Biotechniques 5. 144 (1987).

-0dell et al,, Nature 313. 810-812 ( 1985).

-5chnepf et al, J, Biol, Chew, 260.626 4-6272 (1985).

-Vaeck aL aL, Nature Yuel, Coco-37 (1987 ).

-Velten and 5chell, Nuclaic Ac1ds Re 5earch 13°6981-6998 (1985).

-Valten at al,, EMBOJ! , 272-27 (198 4).

-Widner and Whiteley, J. Bacterial 171 ．． 965-974 (1989).

-Yanigch-Parron @t al,, Gana 33.　10 ko 109 (1985).

Rib = 1 rib ↓ See 4th back ~ Jig bend 11 near Measure NΔ polymera t” two + y kalpa Nucleotide zufLIL r+aRE3 1) VE 36,', 1 item OO bottle base in SE; 4vx,? ′*r= PVE 36, SEQ I: gl:, o.

FIGURE 3 (Latitude: ri Touuuuuuuuuuuuuuuuu ■hip JD50 320 (-150) [ ) 112-----1-----------Carved D^pJD5S 430... [ 31ElO--1------------ Group ρJDS1 500..." Cooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo Dish: ”pJD52 1047...[=TE]-1- −−−−−− [HipJD53 1521 ... “=Koro==Bottom−−−−−− [”pJDS4 1as3...2055--one volume code-pJDS6 2375 ・・1----- 1---------Ichiro I "Kooo Zro pJDS8 1173...5- --1-1328--1 course> pJDs9 1648. .

Low 7==]K2221---Otsu D^pJD60 2195..., 262-15 0 ＼～Nohe■Rororo's noro 0 sun-~■C's Kuro 0 Tororo Transcription:;4;Sho' ;4'4;'4:cU32;::2birth2;■Lr) -ycDcQ~t The -1~ size of the 11~Yuzo bribery completed in Kumomachi Ko? Dankyo room Murowara archery police department Good! cC/)v-1000cm Rorororo OC') to-~-〇〇〇~Ro0RoroC! ″ ) - Dim ■ To sun low CO to one lie ~ ri's 2 pages property property book north mi ε; - History of history 艷艷曽 9 扷 艷曽 9 扷 - 9 - 9 艷adansa 88 郎 切泪 && 連dan ♀ It's cold q$ Insanzatsugo δ zero CO ('IJ ro ro + 5 0 Oh ω ro ■ -'s -0 mouth's ■Hyakuro zero cause of the mouth, 5 dishes = Hamamisaki Goyame Odomisha; Meal skewer 1F rate zero gg ---oi ci low 6d Rororo's 1 ~ -〇〇〇 口 00 ε 0 - Isushi So - 9-9 So's 111-q History Ishi 9〔Wataru♀♀8;Saei♀8mashi=Enki=♀=2article8&Kotomi 8♀Mukogo' resistant y view 0LIGOPS15 GTACCAAAACCATGGCTλτCGAG entered CCGGT’rAC8cc ccA included CG included TCGOL! To the GOP 6 λdingCGATTCGGGτGTAACCGGTCTCGATAGCCATGI; TTTT GGT entered CCG entered Fiaure 6a f, Q W) Reciprocal i　J+τ　-52 310L1GOP51G', 41 01JGOPS15゜CON I ATC GGTACCA jlAAccATGGc Ding^teCG^GACCGC, Tding A C-in CCCCAA-CGA Te-in CGOL Engineering 002 ATCGTGTCCCTA”rTCCCQAACTACGACAOCAOOAC Cj dingACCCAATCCGAACCGTQTCCCAOTsAACCAGGQ A LIGO3 OATC Ding ACACCA^CCCAQTGTTAOOAOAACTTCGAC00 TAOCTTCCQAQGCTCOQCTCAOOGCATb0 OLIGO Shun ^Caa^^GCA ding CAOOAGCCCCACACTTG ^ding 0QAC ^ding CC Ding Ding＾＾CAOCATCACC＾DingCTACACCGACObT LIGO5 CACA(iGGGAGAG ding^CTAC dingGCTCCOGGGCACCAO^ding C＾Ding acc”nccccDingGτacaaTTeDingCGGGfCCAG8ATT to G LXGO6 G^DingCCG^^DingdingCTGOCCCCOA(+^^CCCCACAGGGG^ ^GCCA Ding0ATCτaCτ0CCCOGACCAGDingAfDingAC LIGO7 DingCTCCCCTGTOAGCCiTCCGDingGTAOADingacrc＾DingGCDing G ding ding ^ AOG ding GTC CATCA ^ σTGt ding GGGCsCCT LIGO8 G^DingGCTTCCCTCOATGCCCTGAOCCGAGCCTCGG^^ (iCTACCG Ding CG ^^ GTTCTC Ding ^ 80 ACTG ■ Weir B 14GO9 Clove aC Ding GTAC ＾ Ding CTCCCTGO 7 Ding ^^ C Ding GGGACACGG Ding T CGGATTCG(iding^C0TCCTGCdingaTcGtAmosTcccc^^ SYN’T)In-9 synth-9JLA Ai table, j-343 mortar = 1S PVE36. SEO Nu n<Nato 800-4000A place M-Suga Futon zT (iA 4 kodon l 2 l n T ho sail 1 da) - teme 3゜yu san' rainbow y view ppso2q, sto nucle ffd 1100-4000ATCr I'+Fl r codon hTeAN mocodon l: IJ Shimoki Tate uJ noi 7,9jF+GLRE8A FI Inhongpay (class) 10-i1! % CAT / W#K 7>/:rit (10-4% 8t2 / Possible outside 7 > 71'7 ¥.

New contract A DNA fragment encoding the entire or insecticidal portion of the Bt crystal protein , A and T sequences to corresponding G and C sequences encoding the same amino acids. Degenerates due to

International Search Report ρCT/EP 91100733ρCT/Eρ 9110073 3

Claims (17)

[Claims] 1. Expression of the gene in plant cells transformed using the Bt ICP gene A method for modifying the Bt ICP gene in order to improve transcription of the gene into mRNA, nuclear accumulation of mRNA and/or multiple translated codons of the gene to improve nuclear export, particularly gene transcription. by changing the A and T sequences to the corresponding G and C sequences encoding the same amino acids. A method that includes the steps of: 2. The plurality of translated codons are compared to another adjacent upstream region of the gene during transcription. One of the genes that has a relatively low proportion of RNA polymerase II in plant cells compared to In plant cells transformed using the modified Bt ICP gene located in the above region. Claim for modifying the Bt ICP gene to improve transcription of said gene of The method described in Section 1. 3. The Bt ICP gene is directed towards the trypsin cleavage site, preferably towards the trypsin cleavage site. encodes a Bt insecticidal crystal protein truncated at both the C-terminus and the N-terminus of Preferably a portion of a protein of about 60-80 kDa, especially a toxin of said protein. 3. The method according to claim 1 or 2, wherein the method encodes: 4. The A and T sequences of three or more codons in the translation start site of the gene are replaced by G and T sequences. C sequence, downstream of the translation initiation site and preferably for transcription elongation. about 3 or more, preferably about 10, in the second region of the gene that affects In particular, the A and T sequences of about 33 or more codons have been changed to G and C sequences. 4. A method according to any one of claims 1 to 3. 5. Preferably in a third region of said gene that affects cytoplasmic RNA concentration. , about 3 or more, preferably about 10 or more, especially about 33 or more codons A and T The person according to any one of claims 1 to 4, wherein the arrangement is changed to G and C arrangements. Law. 6. The A and T sequences of about three or more codons at the translation termination end of the gene are replaced by G and T sequences. The method according to claim 4 or 5, wherein the method is changed to a C arrangement. 7. The gene is a bt2, bt14, bt15 or bt18 gene, preferably Cry1 gene such as bt2 gene, or a sequence substantially homologous thereto. The method according to any one of claims 4 to 6, which is a gene having the following. 8. The gene is the bt2 gene, and the second region is approximately nucleotide sequence. between 674 and 1000, with A and T sequences of about 59 or more codons. 2, especially between approximately nucleotides 733 and 1000, especially approximately A claim in which the sequence is changed to G and C between nucleotides 765 and 794. The method described in 7. 9. The gene further has its ATG translation start site at AAAACCATGGCT. The method according to any one of claims 1 to 8, wherein the method is modified by substitution. . 10. Modified Bt obtained by the method according to any one of claims 1 to 9 ICP gene. 11. Chimeric genes for transforming plant cells, which are contained within the same transcriptional unit. A DNA fragment operably linked to: a) the modified Bt ICP gene according to claim 10; b) the modified Bt ICP gene according to claim 10; a promoter capable of inducing expression of the sexual Bt ICP gene; and c) A transfectant suitable for expressing the modified Bt ICP gene in plant cells. Transcript 3' end formation signal and polyadenylation signal Chimeric genes containing. 12. The plant according to claim 11, which is transformed using the chimeric gene according to claim 11. plant cells. 13. A plant, plant tissue or plant cell culture comprising the plant cell according to claim 12. body. 14. Seeds of the plant according to claim 13. 15. Stable transformation of a nuclear genome of a plant containing the chimeric gene according to claim 11 vector, preferably a Ti plasmid. 16. A step for transforming a plant genome using the chimeric gene according to claim 11. 11. The method of protecting plants from pests according to claim 10, comprising: teps. 17. Expression rate of the gene in plant cells transformed using the foreign gene and/or or the expression level is substantially attributable to nuclear incorporation of the mRNA encoded by the gene. A method of modifying a foreign gene that is limited by growth rate and/or level. , a plurality of translated codons of said gene, in particular another adjacent upstream region of said gene during transcription. This gene has a relatively low proportion of RNA polymerase II in plant cells compared to the A step that changes the A and T sequences at multiple translation codons in one or more regions of The A and T sequences are included in the mRNA of the gene in plant cells. transcription, nuclear accumulation of mRNA and/or nuclear export of mRNA, especially the gene transcription of the gene into mRNA, especially the transcription by RNA polymerase II on the gene. Changes to corresponding G and C sequences encoding the same amino acids to improve transcriptional elongation how to.