JPH05501201A - Non-infectious HIV-1 particles and their uses - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Background of non-infectious HIV-1 particles and their use Human immunodeficiency virus type 1 (HIV-1) causes acquired immunodeficiency syndrome (AIDS). ), which is associated with selective infection of T-helper cells and 0KT4,000 helper cells. characterized by immunosuppression resulting from death. Sarin, P. S Annual Review of Pharma)ology (Ann, Rev, Pha rmaco 1. ), 28: 411-428 (1988). of this disease Clinical manifestations include severe immune deficiencies, commonly associated with malignant and opportunistic infections. Ru.

Preventing infection by HIV and combating the destructive effects of the virus and already infected individuals. Wisdom in such individuals is due to the fact that the mortality rate between bodies is very high. There is particular interest in finding ways to counteract the effects of russ.

Prevents HIV infection and reduces the effects of the virus once infection occurs. A great deal of effort, time and money has been expended in developing means to eliminate or eliminate Despite the fact that limited progress has been made in its implementation to date. It's just that it's coming. HIV infection of T cells and virus in infected cells Various points in the replication of this disease have contributed to the development of chemotherapeutic agents useful in the prevention or treatment of this disease. It has been suggested that they should be targeted in the development of In the life cycle of HIV attachment to T cells, reverse transcription activity, transcription and/or translation of DNA and Points such as virus particle assembly and release should be effectively targeted. It is possible. Some drugs, such as D-penicillamine (DPA), which in the past have been used for the treatment of other diseases in Gonucleotide inhibitors, specifically designed to interfere with HIV, are Those in the prevention of HIV infection and/or inhibition of its action in infected cells has been evaluated for its effectiveness. Sarin, P, S, A Ann, Rev, Pharma col, ), 28:411-428 (1988): Norman , C, Science (Sc 1ence), 30: 1355-1358 ( 1985).

These efforts have produced promising results in some cases, but to date However, there are no effective means of interfering with HIV activity in infected cells. is clear.

Summary of the invention The present invention discloses that among the nucleotide sequences important in the packaging of HIV-1, containing the mutation and when expressed in susceptible mammalian cells, a non-infectious virus. HIV-1 mutant constructs that produce virus particles, as well as HIV-1 mutations Concerning expression products. When described here, HI that does not contain the viral genome V-1 particles are being produced. These mutant HIV-1 particles are completely Provides a means to produce vaccines based on immunogenic but non-infectious virus particles provide Such vaccines can be used to treat individuals prior to infection with HIV-1. or later induce an anti-HIV-1 response and generate resistance to the virus by the individual. can do. The invention further includes expression products of HIV-1 mutations. The present invention relates to vaccines and methods of immunizing individuals by administering the vaccines.

In particular, the present invention provides a method for constructing the corresponding wild-type DNA, which is important for viral packaging. within the nucleotide sequence of the region or fields important for viral packaging. Minor (at least one change (deletion)) in the amino acid sequence of the corresponding region of the biotype product , insertions or substitutions) that differ from wild-type HIV-1 Concerning packaging mutations.

In the HIV-1 gag sequence, for example, p7g''1 (separately referred to as p15''), and the sequence between the first HIV-1 splice donor site and the gag start codon, These are sequences homologous to the defined ma site of Ike's virus. The mutation blocks packaging of viral RNA and prevents noninfectious infections. It has been shown to cause the production of viruses.

Generating changes in the intervening sequence between the two Cys-His boxes in p15'' An insertional mutation within Zurp15'' was made and the mutated HIV-1 construct Adults specifically inhibit the packaging of viral genomic RNA into infectious particles. has been shown to cause harm. in one or both of the metal-binding motifs of p7 The substitution mutations also exist at the corresponding positions in wild-type HIV-1p7'"1. by replacing each of the two existing cysteine residues with a tyrosine residue. and also has a protein content identical to that of wild-type HIV-1. It has been shown to produce infectious virus particles. The deletion mutation is now HIV-1 is made in a sequence within the Hrv-i genome that identifies the F site and, similarly, a non-infectious virus particle whose protein content is identical to that of wild-type virus was shown to produce

Brief description of the drawing FIG. 1 shows the partial f4rV-1 nucleotide sequence (nucleotides 1351-19 80) and its partial sequence [Ratner (Ra tonar), L, et al., Neichi+-(Nature), 1V di 27 7-284 (1985), above which I (IV-) will be written here. The location of mutations within gag is indicated.

FIG. 2 is a schematic representation of mutations in HIV-4. Figure 2A HIV~1F Location and size of the deletion affecting the site. Figure 2B: Various point mutations Amino acid changes in the metal binding motif of HIV-1 gag produced by hmm The guanine in the second position of the codon specifies the genetic information for the stine (C) residue. The nucleotide is changed to an adenosine nucleotide, resulting in the inheritance of thyronone (Y). Generated codons that specify information.

Figure 3: Evaluation of transcription and translation of HIV-1 mutations in cos-1 cells. The results are shown below. Figure 3A, transfection with wild-type or HIV-1 genomes. Comparison of viral transcription in RNA extracted from transduced cos-1 cells. The results of Northern plot analysis are shown. Figure 3B shows transfected 5DS-PAGE analysis of HIV-1 specific proteins in cos-1 cells Show the results.

Figure 4 shows the results of analysis of HIV-1 mutant particles by Western blot. shows.

FIG. The results of evaluation of the nucleic acid content of virus particles present are shown.

Figure 6A is a schematic representation of the replication-defective [V-1 virus pΔPAC-Hygro]. , in which the following changes from wild-type HIV-1 are present: a deletion in the ma site; , a guani in the second position of the codon that specifies the genetic information for the protein (C) residue. Change of nucleotide to adenosine residue, specify genetic information of thyronone (Y) and by the hygromine resistance gene of the nef gene. Replacement.

Figure 7 is a schematic representation of the gag coding region of HIV-1, with nucleotide numbers. The numbers indicate the start codon, the cleavage site between p17, p24 and p15, and the gag stop. Indicates a stop codon. Nucleotide differences between wild type and bcA20 are indicated . Below, two HIV-I Cys-HiS boxes and intervening sequences. The amino acid sequence is shown, where the bcA20 mutation has been introduced.

Figure 8 shows immunoplot of cytoplasmic extracts from WT4 (ΔE-dhfr) cells. The results are shown below.

Figure 9 shows the results of slot-plot analysis of WT4 (ΔE-dhfr) cells. Figure 2 shows the results of viral RNA hybridization studies.

Figure 10 shows WT4 (R7-dhf r), WT4 (WT-△E-dhf r) and WT4 (bcA20-△E-dhfr) by electron microscopy The results of the survey are shown below. Panel A: HT4 (R7-dhf r); Spring/L43: WT4 (WT-△E-dh f r): Hanel C: WT4 (bCA20- ΔE-dhfr).

The present invention provides the results of RNA studies and tags related to the packaging of HIV-1. Based on protein sequences. Evaluation of the effect of mutations of various point deletions or insertions The HIV-4 gag region that pancages genomic RNA into virus particles HIV exhibits important properties and is also important for virus packaging -I The occurrence and position of the RNA packaging (ma) site was demonstrated. For more information , p7, the cleavage product of the gag precursor, or both metal-binding motifs. A point mutation that changes the protein residue, two Cys-)Tis p15' In “p15” which changes the length and nature of the intervening sequence between p1 and Insertional mutations and the first HIV-1 sp. isdna site and gag initiation cod. Create a deletion mutation between the virus and the packaging of the virus. We demonstrated the effectiveness of these methods.

Based on our results, we now know that this is essential for virus pancasing. )iIV-I RNA sequence and create a mutation in the I(T For both types of V-1 mutations, HIV-I RN, ... packaging was shown to be inefficient. In particular, two types of mutations in HrV-1 Their lack of ability to assemble and package viral RNA and were shown to be: 1) changes or mutations in the gag coding sequence and 2) other The HIV-1 genome is homologous to the defined sequence of the virus. A mutation of I-TTV-1 in which there is a change or mutation in the sequence of Different. The two types of HIV-1 mutations produced are, respectively, HTV-1ga g mutation and HIV-1 ma mutation. thyronone in the corresponding position in wild-type HIV-1 to generate a nucleotide sequence encoding Mutations in the form of substitutions of selected nucleotides encoding protein residues of the nucleotide sequence encoding the metal binding motif of HIV-1 gag. It was introduced inside. This type of HIV-1, gag mutation is This is called genus-binding motif mutation.

Type 2 of HIV-1, gag mutation (referred to as HIV-1, gag insertion mutation) ) of the intervening sequence between the two HIV-1 gagCys-His boxes. Nucleotide insertions were made that resulted in changes in nature and length. three parts Commitment to American Thailand on October 13, 1989 and October 16, 1989 Pu Culture Collection (the American Type Cu1 ture Co11ection) Rockville, Maryland, USA, filed this application. Mutations of the HIV-1 gag metal binding motif carried out to support pA Displayed as 14-15HXB (ATCC receipt number 68123); HIV-1 gag insertion mutation, designated as plasmid bcA20-dhfr (the recipient is number 40682), and HIV-1 mutation (reception number 68). 122). These deposits are made pursuant to the provisions of the Budapest Treaty and When permitted, all restrictions on their availability will eventually be removed. Dew.

Introducing both gag and ma mutations into appropriate cells in which they are expressed. I entered. As described below, the mutations introduced into the gag coding sequence are It has been shown to block packaging of RNA. HIV-4gag gold Viral products resulting from mutation of the genus binding motif or expression of the V mutation is normal in protein content (i.e. protein content is lower than wild type f lV-1), lacks genomic RNA, and non- It was shown to be infectious. Changes in HIV-1 gag insertion mutations Virus particles that have been shown to be lethal for virus replication and generated was shown to be non-infectious. The products of such viruses are proteins Essentially identical in content to wild-type HIV-1, but not infectious and anti-HIV-1 1 can be used as a vaccine.

The following is a description of: Evaluation of HIV-1 packaging sequences, [V-1gag Evaluation of metal binding motifs and HIV-I Cys-H1s box and Evaluation of surrounding sequences; mutational composition of HIV-1, HIV-1 mutant constructs and Its expression in the host cell is called a mutant of non-infectious HrV-1 (mutant HI V-1 particles): and mutant particles of HIV-1 or mutant particles of HIV-1. a mutant expression product, or one or more mutant particles or mutant expressions Use of a composition containing the product as a vaccine. of the nucleotides mentioned. Locations are as indicated by Ratner and co-workers; The relevant parts of the HIV-1 genome are represented in FIG. Ratner ne r), L, et al., Nature +- (Nature) 313:277-284 (1985).

Evaluation of HIV-1 packaging sequences and deletion of packaging signals Constituent packaging of two HIV~1 mutant constructs, i.e., viral proteins. The process by which proteins and RNA come together to form infectious particles It is an essential step in the virus life cycle. Non-spliced genomic RNA is It is an essential component of the virus particle and the retrovirus package. The process of splicing and unsplicing viral RNA can be distinguished from viral or cellular mRNA. This identification is is the result of interactions between foreign viral RNA sequences and viral proteins Very likely. Vermus, H. Science ence), λ Yo 6:812-820 (1982); and Wejs (1982); s) et al., RNA tumor virus, Cold Spring Harbor Laboratory. (Cold Spring Harbor Laboratory), D-Lold ・Cold Spring Harbor, New York (1984). For avian and murine retroviruses, packaging The RNA sequence essential for virus detection is located at a site near the 5° end of the virus genome. Googled. Shank, P, R, and M.

Linial, Virology (J, Virology), 36:4 50-456 (1980) Ma n n, R, and D Balch More (Baltimore), Virol (J, Virol).

Koyamat, Harada F, and S.

Kawai (Kawa i), Virus jizume (J, Viro Iogy), 5 1:154-162 (1984);'7 Watanabe S, O and H.M., Temin, Bros. Deindus of National. Academy of Sciences (Proc, Nat 1. Aca Man (Ma) nn), R and Ri, Baltimore (BaItmore), Virus Jizume (J, Virology), 54: 401-407 (1985 )). This site is removed during splicing and the non-packaging RN Occurs within the intervening sequence that produces A.

Defined pSi sites in murine leukemia, pancreatic necrosis and avian sarcoma viruses Using f as a guide, the deletion mutation is This region serves as a packaging signal for human viruses. We investigated whether it works. In particular, using oligo-mediated mutagenesis , constructed two deletion mutations: nucleotides 293-331ga deleted , which created the mutant pA3-HXB, and nucleotides 293-313 was deleted to produce mutant pA4-HXB (Figure 2A). these The deletion occurs between the first splice donor site and the gag initiation codon; Leave one part of the rice dona completely intact. Other deletions within the HIV-1 region also include I can come. Those shown to be packaging defective mutations (e.g. e.g., by the methods described herein) for pA3-HXB and pA4-HXB mutants. For example, use as an anti-HIV-1 vaccine, as described for natural mutations. be able to.

Construction of the HrV-1gag mutation Contains changes in the metal binding motif of HIV-1 and the viral RNA recognition site. Construction of an HIV-1 mutant construct with one or more sequences encoded by the 3' end of the gag gene Deletion mutations at this position cause the protein to lack viral RNA (particles It is thought that this is related to the recognition of viral RNA. F Henderson, L.

E. et al., Journal of Biological Chemistry (J, Bio 1. Chem, ), 256: 8400-8406 (1981); :/ (Orsoz I an), S, and T, D, Co peland), Curr, Top, Microbiol, Immunol, 11 and: 221-233 (1985); and Collabey (C.

Vex), S, M, Nucleic Accid Res, 1 4:623-633 (1986), form CysX2CysX3GIyHisX The 4Cys metal-binding motif is the gag precursor in all retroviruses. is a common feature of the carboxyl terminus of Berg, J., Scien Science, 232:485-486 (1986). This motif once in a murine retrovirus, and most others studied so far. occurs twice in retroviruses.

Nucleic acid binding properties were ascribed to preparations containing zinc finger motifs [Evan Evans, R, M, and S, M, Hollen Barb berg), Cells (Ce I 1), 52: 1 (1986), so RN Rous sarcoma shows a direct role for the metal binding domain in A binding. (RSV) and Moo=-(MoIloneY) virus has been studied. Karpe I, R.

Ll, Journal of Biological Chemistry (J, Bi.

In the first deletion of the two zinc finger motifs, the RNA package ing and infectivity. Deletion of the second motif reduces virus activity to approximately 1 00 times decrease. Both zinc fingers are for the formation of 70SRNA2J1 body. [Merrick, C.

and P-F, Spahr, Virolc (J, Virolc) gy), Maydan・450-459 (1986) + and Merrick (Mer i c), C, et al., Virology (J, Virology), 62: 332 8-3333 (1988)]. Similar results are observed for Ml,■, where The lack of genomic RNA binding in splicing and limiting viruses Correlation with nonspecific packaging of nucleases and cellular metsengers It seems that there is. Meric, C and S, P Gossoff ( Goff), Virus jizume (JVirology), Dan:j: 1.558-1 568 (1989): Prats, A, C et al., J, EMB O17: 1777-1783 (1988): and Gore ] 1ck), R, J et al., Prondinges of National Academy Me of Sciences (Proc, Nat 1. Acad, Sci,) US A, 85:8420-8424 (1988)]. One other feature is the gag sub-function. They were assigned lead fingers; Required for correct positioning of the tRNA primer on the start site. Plink (Pr a　t　s) A, C et al., J. EMBO, et al.: 1777-1783 (1988).

To study the role of the gag zinc finger in virus assembly , the first two seven steps of the second metal-binding motif were modified using oligo-mediated mutagenesis. Mutant pA15-HXB was generated by replacing the in with thyronone (Fig. 2B). and Example 1). pA15-HXB was further mutated to create the first metal binding motif. By tyrononating the first two cysteines of the carbon fiber, the metal binding mode of both A second mutant pAL4-15-HXB was constructed in which the chief was changed. same These 7 stain residues can be removed in various ways using the procedure described here. Any or all of the groups can be replaced with amino acids.

The gag gene of retroviruses is responsible for virus assembly and release. stabilization of on, uncoating of viral RNA, initiation of reverse transcription and possibly encodes a protein that is important for integration. Bolognen (Bol) ognesi), D. P. et al., Sc1ence, 199 : 183-186 (1978):Crawford, S and SP, Goff, J, Viro l og y), ↓9: 909-917 (1984), Hus (Hs u), H, W. et al., Virology ↓ 42:211-214 (1985 ); Merrick, C.

and P, -F, Spahr, Virol J, Virol ogy), Ranryu: 450-459 (1986); and Merrick ), C and s, p, Goff, Wills Jizume 783 (1988); Schutz, A, M, and A.

Rein, Virology, 63: 2370 2373 (1989); N, Alsenberg (Schwart z enbe rg), P et al., Virology (J, Virology), 49: 918-92.4 (1984). Similar to the pond retrovirus, HIV-1 3 expressing its gag gene as a precursor of the repeptide, p r55 t”1 , this precursor is subsequently (phosphorylated and nyl-lylated), possibly deposited under the plasma membrane. self-assembly link' and then virally encoded protease 1 Blot from this to mature viral proteins, pl7, l) 2, 4 and p. Generate l5. We believe that the latter is further cleaved into p9 and p7 borivebzad species. I get teased. Mervjs, R, J et al., Virus Jizume (J, Vir olc, +gy), 62:3933-4002 (1988): Veronese (V eronese), F, d, M et al., Virology' , 62 Near 95-801 (1988). pl7 is located at leaflet 1 inside the lipid membrane. p2,1 probably constitutes the outer shell of the tubular core of HIV2, and The overly basic character of pl-5 indicates that it is associated with viral RNA. 1, Gelderblom, H.R. et al., Virology ( Virology')], 5fj: 171-176 (1,987). here As described in Two methods were discovered that specifically block the packaging of A.

HIV-1pl5"" is a 123 amino acid long protein that contains the gag gene. encoded by the 3' end of It is a nucleocabzine protein ( NC) has striking similarities. These similarities suggest that in the p9 region, the 3' A conserved motif of two instein and one histidine residues, Cys - Two tandem copies, separated by 7 amino acids, called the His box. (see Figures 1 and 7). Covy, S, N, nucleic acid (Nucleic Ac1ds Res,) 14:137-145). child motif, when the nostein near the N-terminus is expressed as n, two other Instein residues are located at n+3 and n+13, while histidine residues are located at r1+ It exists in 8. The Cys-His box of the NC of Shilovirus is found in a wide range of species. Specific 1) Zinc related to recognition of NA sequence by transcription factors of eukaryotic species The similarity to the protein sequence of ``fincar'' suggests that it forms a gold-dust-binding domain. The U barb (B e r g) assumed to be 1. Science ce), 232: 485-4871. Recently, the avian medulloblastosis virus ( A~1V) p12'□1 is ``Zn　(I　I) in the zinc plotting technique [Sehiff, L. A., et al., Bron. Dinges of National Academy of Sciences (Proc. , Natl, , Acad, Sci.

) USA, May 7246-7250 (1,988). However, significant A large amount of metal has been detected in virion, and the bound Z~ ion It is not certain whether this is important for NC functionality. in oncovirus Studies show that NC is closely related to the gene RNAi, and that purified NC Trial IV! It was shown that it binds to nucleic acids within the tube, but in a non-specific manner [Dys. Dav is, J, M, et al, Virus jizume (J, Vi rolo gY), 18: 709-718 (1976); ssen-Meyer), J and A, K, x Abraham am), Journal of Molecular Biology (J, Mo 1. Bio 1. ), 142:19-28 (1980)]. Also Moloney white Both hematosis virus (M-MuLV) and Rous sarcoma virus (RSV) , RNA packaging containing lesions in the NC region of the gag gene Gore I1ck was shown to represent a major defect in ), R, J et al., Proceedings of the National Academy of Sciences ・Sciences (Proc, Nat 1. Acad, Sci,) USA, 8 5: 8420-8424 (1988): Merrick , C, and P, -F, Spahr, Virus Jizume (J, Vir (1986): and Meri. c), C1 and s, p Goff, Virolo gyL Dandan: 1558-1568 (1989)] 0HIV-1p15'"1 To study the role of wild-type HrV, mutations were carried out as described in Example 3. was introduced into the DNA of the provirus. Briefly, HrV-HXB2- Plasmid W13, containing an infectious copy of the D provirus, was It was modified by insertion of a C1ar linker of length. This linker is located at 2009 into the unique Apa1 site present in At the end, the gag reading frame was corrected. As a result, wild-type HIV -2 according to the first Cys-His box (arginine-alanine) in 1 Replace the residue with four amino acids: serine-isoleucine-alanine-methio Nin (Figure 7). Thus, the insertion of the property and the two C Change the length between the ys-His boxes.

Mutation of the HIV-1 gag metal binding motif in cos-1 cells and H[ Analysis of V-4 ma mutations Expression of viral RNA and proteins Biologically active HIV-I DNA and a plasmid with a 5V4Q origin of replication. a Green M.

When transfected with the kidney cell line cos-1 of The sexually transmitted HIV-1 virus is recovered. Viral transcription, translation, assembly and Germination and budding normally occur in these cells, and the recovered virus is susceptible to can infect cells. Feinberg, M.B. et al., Cell (Cel I), 46: 807-817 (1986). HI To produce virus from wild type and mutated molecular clones of V-1 , cos-1 cells were infected with wild-type pHXB2gpt plasmid and and four mutated plasmids. these four The mutated plasmids are as shown in Figure 2: pA3- HXB, where nucleotides 293-331 are present in wild-type HIV-1 pA4-HXB, where nucleotides 293-313 are deleted when , ζpA15-) [XB, which is deleted when present in wild-type HIV-1 Here, the 12th cysteine of the second metal-binding motif of p7 is monochanged with tyrosine. and pA14-15-HXB, where both the metal-binding motifs of p7 The first two cysteines of are replaced with tyrosines. Additional mutation, p△ A device designated PAC-Hygro (see FIG. 6) was also constructed. p△PA C-Hygro contains a 39bp deletion present in pA3HXB and pA14 - Cysti in both zinc finger motifs present in 15HXB. including changes in Transfection with one of the four mutated plasmids 48 hours after infection, cos-1 cells were examined for evidence of viral gene expression. did. African green monkey kidney cell line cos-1 transformed with SV40 Gluzman, Y, Cell (Ce1+), 23:17 5-182 (1981)] by G. Koury (Kh.

(NIH) and supplemented with 10% fetal bovine serum. maintained within. The genome of wild-type HIV-1 or mutant HIV-1 Transcription of virus in RNA extracted from transfected cos-1 cells Northern plot analysis was performed to compare the 32p random primed full-length virus D. It was performed using an HIV-1 specific probe that is NA. 15 μg of total Cellular RNA was loaded into each lane. As the results (Fig. 3A) show, the mutation The pattern of RNA transcripts in cells transfected with the plasmid is indistinguishable from cells obtained from cells transfected with the wild-type plasmid. I can't do it. In each case, all three classes of HIV-1 mRNA Exist: 9.2 Genomic mRNA, encoding the env and vif genes 4, 3 kd spliced mRNA, and tat-11I, rev, o A heterogeneous collection of messages in the 2 kd range encompassing the and nef mRNAs. like this Therefore, these HIV-1 mutations may affect viral RNA expression. It doesn't look like a sea urchin.

Transfected cos-1 cells were metabolically targeted with 3fi5-methionine. human and monoclonal mice with defined specificities for HrV antigens. HI by immunoprecipitating viral proteins using virus serum. The expression of structural proteins of V-1 was studied. Veronese , F., D. et al., Proceedings of the National Academy of Sciences. Sciences (Proc, Natl, Acad, Sci,) USA, 82: 5199-5202 (1985): Veronese, F , D. et al., AIDS Research and Human Retroviruses (AIDS Re5ear ch and Human Retroviruses), 3:'253-26 4 (1987). Using 10% or 15% polyacrylamide gel, 5 DS-PAGE analysis was performed. Plasmid pHXB2BAMp3 as negative control Included as. Because it does not produce virus due to post-transcriptional defects It is from. The results are shown in Figure 3B. As this analysis reveals, viruses All of the major proteins in the HIV-1 wild-type or mutant plasmid present in cells transfected with These transfections gp160, gp120, gp41, gp41, gp21, P Due to the presence of I3 and PI3, mutations in HIV-1 are caused by gag and PI3. produced major changes in the synthesis and processing of envelope precursors. It is shown that there is no

The relative expression of one of the regulatory proteins, ta't, was also determined by these mutations. I researched about it. The CAT gene is under the control of the HIV-I LTR, Co-incubation of plasmid PCl5 with wild-type and mutant HIV-1 plasmids. Transfection [Feinberg, M.B., et al. : 807-817 (1986)], each of the mutations has a normal level of tat. It was shown that it was produced. Thus, as the results show, suddenly four HIV-1 The mutations show no substantial changes in viral RNA and protein expression. stomach.

Biological activities of Phiphilus mutations pHX82gr)t (wild type) and four mutated plasmids, pA3H cos in XB, pA14HXB, pA15HXB, and pAI115HXB2 -1 cells produced by transfection of HIV-1 particles. To assess biological activity, culture supernatants were harvested, filtered, and inverted. Transcriptase activity and the presence of p24 were tested. of supernatant liquid All are substantial but vary [Novel Reverse Transcriptase (RT) and p24. Contains comparable levels of p24 (15ng) Infection using the supernatant liquid adjusted to sea urchin? Both susceptible and infected with HIV Permissive for replication, )-(9T leukemia cell lines were infected. pHXB2g From cos-1 cells transfected with pt (wild type HIV-1) In H9 cells infected with clear solution, percentage of cells positive for HIV-1 antigen and Both reverse transcriptase activities increased with time (Table 1). in contrast , derived from c-os-1 cells transfected with the mutant virus. H9 cultures exposed to the treated supernatant showed no significant changes in cellular p24 immunofluorescence, RT activity or were not positive in particle-associated p24 assays. These assays for at least 30 days after exposing H9 cells to mutant virus particles. It was negative.

These data indicate that all four HIV-1 in cos-1 cells The virus particles produced by this mutation become susceptible when transferred to susceptible cell lines. lacks dyeability.

Table 1 pHXB2gpt >20 >20 >20 >20 >20 >20 1co Mutant virus particle proteins from transfection of s-1 cells and nucleic acid content, it was determined that the lack of productive infection of H9 cells indicates a defective virus. Decided whether it could be for on. In these different assays, cos-1 cells transfected with mutant HIV-1 plasmids The amount of HIV-1 protein present in the supernatant was determined using the wild-type plasmid. similar to the amount obtained. Centrifuge virus particles in the supernatant at CO5-1° and quantitative analysis of the amount of p24 present in the precipitate. Performed by ELISA. p24 values ranged from 15 to 20 ng for each sample. There was (Table 2).

Table 2 Content of p24 and construct of reverse transcriptase activity plasmid Virus-related p24 reverse transcriptase activity (ng/ml) (32p dGTP cpm/drunk/min) pHXB2gpt 1, 90 5060p^3H XB 1.70 3133 pA41 (XB 1, 60 2718 pAI5HXB 1, 75 3436 pA14-15HXB 1.65 2949pHXB2Bamp3 0.00 74.0 Reverse transcriptase assay performed on precipitated virus particles. Sei revealed a 2-fold reduction in the level of mutations with respect to the wild type (Table 2) . ! After l, in Western blot analysis, each of the wild type and mutant was shown to produce particles containing comparable amounts of gag and env proteins. (Figure 4).

The frequency of transfection was different for wild type and mutant transfectants in cos-1 cells. Immunofluorescence assay to determine whether sfections are similar between For CO5-1 cells fixed 48 hours after transfection, anti-p24 It was performed using specific mouse monoclonal antibodies. Veronese (Vero) nesc), F, D, et al., Publishing House of National Academy - of Sciences (Proc, Nat 1., Acad, Sci,) USA, 82.5199-5202 (1985). produces a positive signal The fraction of cells between different transfections ranged from 17 to 20%. were almost the same. - Together, these data show that HJV-1 mutations The number and protein composition of virus particles produced by the variant was higher than that of the wild type. similar to those of particles produced by.

RNA is directly extracted from the virions present in the supernatant, and nitrocellulose Nucleic acids were immobilized on the slot plot of the base and labeled C1ar/Ec. By probing with the 3.8 gag-po1 fraction of oRI, these One of the viral RNAs present in virions was studied. The results are shown in Figure 5. . At least a 100-fold decrease in RNA content with respect to the wild type of both! and observed for mutations in the metal binding motif of ga. In this way, both V and For mutations in the metal-binding motifs of ga and ga, HIV-I RNA is are not efficiently packaged within particles. in mutant virus particles. The lack of genomic RNA associated with packaging, rather than the absence of intracellular genomic RNA This reflects a defect in transfection of those transcripts in the mutant genome. (Fig. 3A). ).

The morphology of wild-type and HIV-1 particles was examined by electron microscopy. section Careful evaluation of was shown to be low. Empty mutant virions contain RNA and protein components. Consistent with the analysis, this indicates that the mutant virion lacks genomic RNA.

Role of HrV-1 and metal binding motifs in viral packaging These data indicate that the HIV-1 marker site is located at the 5th point of the viral RNA in the genome. ' The donor region of the splice is located in the leader region and is as small as 21 base pairs. Deletions located immediately 3° to the site can produce packaging defects. can. As the results described here show, mutations in the flV-1 region It shows the normal pattern of gene expression in the transfected cells and viruses produced by these mutations, but which lack detectable RNA. The particles appear to have normal protein composition.

HIV-1 mutant viruses with defects in the gag metal-binding motif are non- have been shown to produce infectious virus particles, and these virus particles are identical If not,! Similar to those produced by deletion mutations. HIV-1p7 Both the Y and M mutations produce virus particles that lack genomic RNA. The fact is that packaging of HIV-1 inhibits the interaction between p7 and genomic RNA. Consistent with the idea of inclusion. When p7 interacts with genomic RNA, it A binding motif could play a direct role in binding. Also, The gag dust-binding motif can be linked to other nucleic acids (e.g., tRNA primers) or other suitable can interact with other proteins that are important for the packaging of RNA. Wear.

Analysis of packaging mutations reveals that viral capsid assembly is This clearly occurs in the absence of RNA packaging. that protein Particles whose quality composition is similar to that of wild-type virions are those in which genomic RNA is packaged. assembled even when it cannot be assembled. RNA packaging Mutations in the metal-binding motif of p7, a protein probably directly related to does not affect capsid assembly, and the p7 motif does not affect capsid assembly. indicates that it plays no role in

The described HIV-1 packaging mutations enhance the anti-HIV-1 immune response. provides a means to produce non-infectious antigenic particles that are useful for provocation. Stable integration These non-infectious particles can be I got the source. Potential reversion of point mutations in the provirus is due to Al4-15H Identification of the deletion of the M site present in XB and the mutation of the four gag cysteines. It should be minimized when present. Mutant viral genomes sometimes Although the possibility of being packaged can be ruled out, Accidental packaging of nom is caused by packaging defects and the t required for reverse transcription. The role of the gag metal-binding motif in correctly positioning RNA primers. For both reasons, it cannot lead to productive infection. Packaging as required The HIV-1 genome containing multiple mutations stably integrates in some cell lines. can be split into two independent constructs, and the rescued genome is highly It will be incomplete at times.

Analysis of the p151“1 mutation of HIV-1. Biological activity of viral mutations. COS cells were cultured with bcA20 (mutated construct) as described in Evaluation Example 3. p24 antigen and the produced p24 antigen in the supernatant. To record the generation of virus particles by measuring the reverse transcriptase activity. Therefore, the phenotypic results of the p151'' mutation (Figure 7) were evaluated. Table 3 (actual As shown in Example 3), bcA20-induced p2-induced 24 transcriptase activity The activity was approximately 40% and 30%, respectively, of the corresponding wild type activity. like this Therefore, mutations in bcA20 moderately and mildly interfere with viral particle release. Only.

The COS cell supernatant was used to infect H9 cells. HIV as a detection antibody Indirect immunofluorescence assays were performed using serum from infected individuals to detect H9 Cells were monitored. After 3 weeks, no positive particles were detected and transfection The virus particles subsequently generated were demonstrated to be non-infectious.

Further assay of the effect of the p15π'' mutation contained in bcA20 in a cell line constitutively expressing the mutant Env-variant (WT4 (bcA20 -ΔE-dhfr)).

The construction of the cell line is described in Example 3. Click on selected cells based on appropriate resistance. the presence of viral components by polymerase chain reaction. It was analyzed. The analysis described in Example 3 shows that mutations present in bcA20 It was demonstrated that the synthesis, cleavage or stability of the gag precursor was not affected.

WT4 (bcA20-ΔE-dhfr) cells expressing wild-type gag sequence and and WT4 (WT-ΔE-dhfr) cells (control cell line). By plot-plot analysis, mutant virus R contained in bcA20 The effect of NA on packaging was also evaluated. As the results show, WT4 Viral RNA I in the supernatant from (bcA20-ΔE-dhfr) was dramatically reduced in contrast to the amount present in the supernatant of the control cell line.

Examination of the two cell lines by electron microscopy was also performed to determine the presence of viral RNA. whether defects in the packaging of I decided to do it. Morphology of WT4 (WT-ΔE-dhfr) and WT4 (bcA 20-ΔE-dhfr), i.e., a replication-competent variant of the same virus, Env. Comparison of the morphology of cell lines infected with (see Figure 10, Panel A and Figure 10, Panel B and Example 3) . However, particles released from WT4 (bcA20-ΔE-dhfr) When compared morphologically with those from WT4 (R7-dhfr), the two Dramatic differences were seen in the diameters of the two particles containing the mutation than in the control. approximately 50% larger, and the electron-dense region in the latter is tightly attached to the membrane. The center of the particle was noticeably electronically transparent (Fig. 10, panel C).

Use of the mutant constructs and mutant expression products of the invention Thus, wild-type H.I. HI containing mutations in the nucleotides present in the gag sequence of V~1 A V-1 mutant construct was constructed. This is because there is a sudden change in HIV-I RNA. Mutant constructs containing differences in viral packaging (HIV-1 site) This is because it has been shown that this is essential. In addition, virus pancage Mutations in the HrV-1gag sequence shown to be essential for An HIV-1 mutant construct containing both mutations in rV-I RNA I made it. Using virus particles produced by cells to introduce the mutant construct As well as mutant expression products (e.g., mutant gag products), HT can protect individuals against infection with V-1. For example, mutant expression production A substance, e.g. g a, g mutation, is introduced into an individual and the anti-mutant HiV-1 An immune response and production of gag antibodies can occur. Or maybe a mutation proteins produced in cells that have been introduced (e.g., by L. Mutant HIV-1 virus particles can be used as vaccines. this in some cases, virus particles produced using one (or more) mutations. Progeny are made from the cells that produce them, and if necessary add additional components (e.g. suitable Vaccine compositions in combination with suitable biocytological buffers or carriers, adjuvants) and then administered to an individual (e.g., by injection) before or after infection with HIV. )do. In immunized individuals, the mutant HIV'-1 particles are similar to wild-type HIV'-1 particles. very similar to that of V-1 and elicited an immune response similar to that elicited by the wild type. induce, but unlike wild-type viruses they are unable to do so. , does not infect the receptor.

The invention is further illustrated by the following examples. ,: These examples may be used by any person. It is not intended to be limited in law.

Example 1 Part temporary violence da 2 table sentence! Block the μ-bran stamp! Confused for these studies The parental DNA used was described by Fishcr and co-workers. The biological activity listed is Lorne pHX82gt, p. Fin’yya ( Fisher), A, G Nature 5). Sac l-3a l I (bp 39-5366) [Ratner, I=et al., Nature (N ature’)3↓3: 277-284 (1985)] 5. :3 kg salt The base-paired (kb') fragment was cloned into Ml, 3mpl-8 and Go-mediated site-directed mutagenesis (following the protocol of Kukel et al. Single-stranded DNA ligation was carried out in N.

Kuke T, A et al., Mesons in Engineering thods in Enzymology), 1-54:367-382 (1 987). 7A3・TGACGCTC using the following oligomers for mutagenesis TCGCACCCATCTCTCACCAGTCGCCGCCCCTC.

Dilute nucleotides 293-331 [Ratner, L et al. Nature 3: 277-284 (1985)].

A4: CTCTCTCCTTCTAGCCTCCGCTCACCAGTC GCCGCCCCTC.

Deleting nucleotides 293-313: A, 14: TGCCCTTCT TTGCCATAATTGA^^TACTTAACAATCTTTTC.

Guanosine (G) 1508 and 1517 are exchanged for adenone (A).

A15TGTCCTTCCTTTTCGATATTTCCAATAGCCCTT TTCCTAG.

Replace G in positions flF1571 and 1580 with A. Two specific ori Gomer A5/CCATCGATCTAA, TTCTC and A16: GGCCA Different Ml 3mp 18 recombinant DNA using GATCTTCCCCTAA The introduction of mutations was assessed by sequencing A. Ausbel (Ausbel), F, M et al., Current Protocols in Molecular Bioprisons (C current Protocol inMolecular Bir)logy ), Gree/Tsukufuri, Song Associates and Willy Inter Science (Q r e e n Publishing As5ociates and Wiley Interscience) (1987).

Mutated Ml 3mp 181j! Bs5hll/BaI from small clones 1 of f. ．． All different mutations were generated in the wild using 9 kg of DN A fragment. Type pHXB2gI)t. Full-length I(l　V　1 mutation clone) pA3HXB, pA4 according to the oligonucleotides used for mutagenesis. HXB, pAi5HXB and pA14-15HXB. M13mp1 The entire region transferred from the 8 plasmid was analyzed using double-stranded DNA sequencing. [AIJSLIbel, F, M et al., Molecular Biology] Current Protocol in Mo 1ecular Biol.

gy) (Green Buffrisosong Associates & Willy Inta) - Science (Green Publishing As5ociates a) nd Wiley Interscience) (1987)] Desired mutation confirmed the existence of and the absence of other changes. Standard procedures for all DNA manipulations I followed.

cos-1 cells were incubated with 10% fetal calf 24 hours before transfection. Inoculate DME medium supplemented with serum at a density of 10'/100 mm plates and and incubated at 37°C in 5% CO2. Cheno (Ch, en) and 10 μg of plasmid DNA as described by Okayama. Transfections were performed using /Pray1-. Chen and Okayama, Molecular & Cellular Biology (Mo1. Cel　1. Biol, ), 7-2748-2752 (1987). virus When the particles were scheduled for RNA analysis, they were transfected into cos-1 cells. The injection was carried out according to the method of Selton et al. Seld.

n) R, F, et al., Molecular and Cellular Biology (Mof, Ccl 1. Biol, ), 6:31.73-3179 (1986)] Phosphoric acid When performing calcium transformations, avoid the high degree of DNA contamination of the samples that is observed. avoided. RNA was extracted from supernatants containing equal amounts of p24 and performed in the presence of a large amount of added tRNA, and uses tRNA to finalize the RNA. Recovery was monitored. The RNA sample was added to water with the same concentration of tRNA (1 μg/ml). ) and transfer 1.03 and 01 equivalents of RNA onto nitrocellulose. where one equivalent contains 18 ng of p24. represents the amount of RNA obtained from Slot-plot analysis of RN A is conventionally described. Performed as described. Ausube I, F, M, et al. Current protocols in molecular biology n Mo1ecular Biology) (Green Buffliso Song Aso) Sheats & Wiley Interscience (Green Publicis) hing As5ociates and Wi Iey Intercienc e)) (1987) o 3.8kb C1al/Eco from pHXB2gpt The gag-pol fragment of RI was labeled with 32p by random brining and and used as a probe for slot plots.

Nucleic acid analysis 48 hours after transfection, Queen and Baltimore RN using the hot phenol method described by (Baaltimo r e). A was extracted from cos-1 cells. Queen (Qeen), C11g's DNA RNA from whole cells treated with enzyme was used per lane. mock transformer RNA from transfected cos-1 cells was used as a negative control and 5 μg of RNA from H9 chronically infected with HXB2 virus was used as a positive control. used as. The HIV-1-specific probe is a 32p-labeled full-length virus probe. It was DNA. For protein analysis, 48 h with 10 pg of each plasmid. quickly transfected cos-1m#I (4XIQ') 500tt, C4 was labeled with 355 methionine for 4 hours. As a negative control, post-transcriptional defects Transfect cells with plasmid pHXB2Bam p3, which does not produce viruses. I had a fection. Feinberg (Feinbe rg), M, B,... Cell (Cel l l), 46: 807 (1986), cell lysate prepared and immunoprecipitations were performed as described. Veronese (Ver.

nese), F, D, et al., Pro/-Dinges of National Academy - HIV- of Sciences (Proc, Natl, Acad, Sc) 1-positive human serum exhibits reactivity with all known viral structural proteins. Proven. Feinberg, M.B., Cell ), ±6: 807 (1986). 5% of the immunoprecipitated protein Resolved using DS-polyacrylamide gel. Laemml i), U, K, Naci+-(NapA3-HXB, pA4-HXBSpA1 5-HXB, pA14-15 and PHXB2Bam p3 for 48 hours earlier Transfected cos-1 cells (4 x 10') were injected with 500 μCi of 358 cells. Labeled with thionine for 4 hours. Prepare cell lysate and Using serum from HIV-1 positive humans, which demonstrated reactivity with the structural proteins of viruses, Immunoprecipitation was performed using Feinberg, M.B. , Cell, Dan: 807 (1986), immunoprecipitated proteins were A 10% 5DS-polyacrylamide gel was used for resolving. Laemuri emml i), U, ni, Nature +- (Nature) 227:680 ( (1970), the virus was incubated for 3 hours at 27,000 rpm in a 5W27o-tar. It was precipitated by centrifugation.

The precipitate is diluted with dissociation buffer (0,01 molar Tris HCI, pH 7,3,0,2% Triton X-100,0,001 mol EDTA, 0.005 mol dithiothreitol (DTT), 0.00 6 molar KCI) or perform protein analysis. If 0. Resuspend in 2% Triton and Laemmli's buffer. wes Tanplot analysis and radioimmunoprecipitation (RIP) were performed using VeroNase. nesc) procedure was followed. Veronese, F, D, etc. Proceedings of the Sixth Academy of Sciences (P r　o　c.

Nat 1. Acad, Sc i,) USA, 82:5199-5202 (1985). Perform p24 analysis on tissue culture supernatant or precipitated virus. carried out.

p2 detected in the supernatant of each mutant 48 hours after transfection. The amount of 4gag protein (ng/ml) is shown in FIG. Each transfection The sample was overlaid with 1Qml of medium. DuPont P24 ELISA kit was used and three different dilutions of each supernatant were analyzed. each mutation 3 ml of Co5-1 supernatant from transfection at 27.00 rpm. RT activity was measured after concentration by centrifugation for 3 hours. The value is 1ml. The supernatant is shown and is the average of three experiments. Wild type by radioimmunoprecipitation Analysis of the protein content of the and mutant particles was also performed.

Example 3 Evaluation of HIV-1p15-gag An infectious copy of the DNA of the HI V-HXB2-D provirus is was introduced into plasmid W13 containing the virus [Kim, (J, Virology L in press]. [Shaw et al., Science (S science), 226 +1165-1171 (1984), W13 is Insert the 8 nucleotide long CIaI linker present at position 2009 and then This Clal site was blunt-ended using Klenow to prepare the gag reading frame. W13 was modified by The resulting mutated configuration The body is called bcA20-W13. The mutation results in the substitution of two residues and The group immediately follows the first Cys-His box, arginine-alanine, and then followed by four amino acids, serine-isoleucine-alanine-methionine ((first Figure 7). Therefore, the nature of the intervening sequence between the two Cys-His boxes and The length is changed.

To analyze the phenotypic consequences of the mutations, COS cells were transfected with bcA20. fection and the amount of p24 antigen as well as the amount of reverse transfection released into the supernatant. Document the generation of viral particles by measuring transcriptase activity. (Table 3).

Table 3 Transfected COS cells and RT4 (ΔE-dhfr) cell line p24 antigen° and reverse transcriptase (RT) activity in supernatants5 p24 antigen (ng/11) RT activity (cpa+/ml/) cos transfection ction type W13 (WT) 120 23,000bcA20-W13 50 7,30 0HT4 cell line HT 4 (WT-ΔE-dhfr) 400 75, 000HT 4 (b C^20-ΔE-dhfr) 180 20.000'p2=1 antigen is ELIS A assay system (DuPon t-NEN, lnC, Billerica, Massachusetts) ).

' RT activity was determined as described [Kim, Virology i (J, Virology), in press].

bcA20-induced p24 and reverse transcriptase activities, respectively, were approximately 40% and 30% wild type. As this shows, in 1-+CA20 The mutations present in the virus only mildly interfered with the release of virus particles. then , CO8 cell supernatant was used to infect H9 cells and then HIV-infected individuals An indirect immunofluorescence assay was performed using serum from the body as the detection antibody. [HO (HO), D, D, et al. After 3 weeks, no positive cells were seen. This is As shown, the particles generated after transfectane treatment were non-infectious. did Therefore, it can be concluded that the bcA20 mutation is lethal for viral replication. did it.

To study the consequences of the 915g-w mutation contained within bct~20, A cell line was generated that constitutively expresses the E-variant of this mutation. , H.I.V. Expression of the gag gene product is responsible for the generation of viral particles in the endogenous region of the E. 1. Such a cell line is created as follows.To put it simply, WT4- 6C cells [HeLam cell line expressing CD4 molecules on their surface, B. Gift from Chesebro] Chesebro , B, Apology K Wellly (WehrlyL Virology Journal (J, V-shaped olo gy), 62:3779-3788 (1,988)1, construct bcA20- Transfection was carried out with ΔE-dhfr. This bcA20-△E-dhfr contains a translated frame in the env gene and a nef reading frame. bc containing a mutant dihydrofolate-reductase gene in place of It is a modified variant of A20-W13. Resistance of cells to methotrexate selected for sex, cloned, and analyzed by polymerase chain reaction. and tested for the presence of viral integrants (not shown). infected with HIV Indirect immunofluorescence was also performed using the serum of a sampled individual as the detection antibody. W The immunofluorescence seen in T4 (bcA20-ΔE-dhfr) is similar to that seen in wild-type g What is observed in WT4 expressing the ag sequence (WT-ΔE-dhfr) similar to (not shown). p24 antigen and reverse transcriptase activity The activity of bcA, 20/wild type was also measured in the supernatants of these cell lines; The ratio uses the temporary transfection of the corresponding W13 Macilus construct. This was roughly analogous to the ratio observed. In addition, the cytoplasmic protein vestal The plot analysis was previously described by TronO and coworkers. -Trono, D et al., Cell (Ce11), October 6, 1989] Anti-p24 monoclonal antibody [F, Verones c) as the detection antibody. WT4 (bCA20 -△E-dhfr) and WT4 (WT-△E-dhfr) have similar baton (Figure 8). 7 Therefore, the mutations present in bCA20 are ga It could be concluded that there is no effect on the synthesis, cleavage or stability of the g precursor.

. Detrimental to packaging of mutant viral RNA contained in bCA20 In order to determine whether WT4 (WT−△I’nee dhf r') and WT4 (bcA20-, toE-old]f') cells from seven clear fluids. A slot-plot analysis was performed. For this, 700 μm of medium was mixed with 35 μm 10 mg/ml proteinase K [Boehringer Mannheim (Boeh) ringer (Niannheim), 10 mg of 7 μm, tR of /ml, N A, 35 μm 0. 5-E/Shino EDTA, 175 mol 20% SDS and incubated at 37°C for 115 minutes, followed by phenol extraction. RNA was precipitated with ethanol in 7.04 molar NaCl. Resuspend in 1mM EDTA, 50% formamide-17% denatured in formaldehyde, heated to 50°C for 20 minutes, 1 of 3-5 x S SC and aspirated through a slot-plot device. By pulling (Ko-yo-), Nido [:J binds to cellulose and is formed. Next, the conventional As posted [Trono, D et al., Virus Jitsuzume (J, Vir o! ogy), complementary to Shi Odido 8475-8900, T7D Using a [”P] probe generated using NA polymerase, Daisen 3 was carried out. After hybridization, filters were added to 02XS Washed 13 times at 68° C. in SC; 1. and exposed to X-ray film.

1 result shows that from HT 4 (E-dbfr to bCA 20z) The amount of viral RNA present in the supernatant was compared to that of the control cell line, WT4 (WT- △E-dhfr) (Fig. 9); therefore, bCA 20 specifically inhibits the infiltration of viral genomic RNA into particles. It was concluded that it would cause harm.

Both cell lines were also examined by electron microscopy to determine the presence of viral RNA. We looked at whether defects in packaging were correlated with physical differences (No. Figure 10). Virus particles observed in WT4 (WT-△E-dhfr) The morphology of the offspring was WT4 (R7-dh f r), a cell line infected with EnV. What was observed here, the ability to replicate, is very similar to variants of the same virus. . Cell-released "mature" particles are condensed surrounded by two layers of viral lipids. (Figure 10, Panel A and Panel B). In contrast, W.T. 4 In the particle released from (bcA, 20-△E-dh"), two plays First, the diameter of the particles was slightly smaller than that observed in the control. It was about 50% larger: Second, the electron-dense regions are closely aligned against the film, but the grains are The center of the cell was markedly electron-transparent (Figure 10, panel C). In addition, Habo 1, % bcA20 anti-A2, RNA hybridization for cell supernatants Perhaps in the CA20 phenotype, as already suggested by the study of Due to certain linkages, it had a morphology close to that of the wild type. of these electrons The morphological findings indicate that packaging the viral RNA in bcA20 anti-A2 It is impossible to increase the diameter, and with this the diameter increases, and the There is a "first stage" of internal components, which usually reflects the final stage of maturation. . This block in maturation is primarily due to the absence of viral RNA within the particles. or whether it is a direct result of aberrant p15'"1 protein. There is only one thing left. Interestingly, the mutant type of bcA20 p15'' HIV-i antibodies produced by provirus-transfected cells Ilion encodes the p57'' precursor of the monkey immune deficiency virus, S V 0. Subodobutella infected with a recombinant baculovirus expression vector containing From Spodoptera frugiperda insect cells released, with a striking resemblance to virus-like particles [De Icha mbre), M, et al., EMBO Journal (J,) 8: 2653-266 0 (1980)]. RNA minus grains produced in these various settings Comparison of the morphological characteristics of the offspring indicates that the viral RNA itself is structurally organized and matured. may play an important role in the maturation of retroviral virions. This suggests that

In conclusion, the collision between the two Cys-His boxes of the p151°1 protein Table of in vitro engineered variants of HIV-1, bcA20, containing natural mutations. As a result of this evaluation of the current state, this domain is important for the D of the genome into the virus particle. This proves to be important for the packaging of NA. Furthermore, p15” The RNA-negative phenotype caused by damage to the As shown, it was shown to be associated with significant morphological abnormalities. importantly can generate HIV particles that do not contain the viral genome, the results show. I can do it. This produces intact, fully immunogenic, but non-infectious virus particles. of major relevance to the development of vaccine strategies based on

Ser　Se　rG　IuGInThr　A　rgA　!　aAsnse　r　 Pro ThrArgArgGl uLsuFIG, 3A FI G, 3B FIG.4 to FIG.8 FtG, 9 Copy and translation of amendment) Submission (Article 184-8 of the Patent Law) April 15, 1992 Wataru Fukasawa, Commissioner of the Patent Office, Magin 1. Display of patent application PCT/US 90105932 2. Name of the invention Non-infectious HIV-1 particles and their uses 3, Patent Applicant 4. Agent〒107 6. List of attached documents (1) Translated copy of the revised text) 1 copy Modified by insertion of a linker. This linker is unique to location ff1549. g The ag reading frame was corrected. As a result, in wild-type HIV-1, 1Cys-His box (arginine-alanine) two residues according to four Replace with amino acids: serine-isoloin shealanine-methionine (Figure 7) . Thus, the insertion is performed using the properties and the two Cys-His boxes as shown in Figure 7. Change the length between boxes.

Mutant biology of the HIV-1 gag metal-binding motif in cos”l cells A plasmid with active HIV-I DNA and replicative SV40 origin. Africa Green M.

When transfected with the kidney cell line cos-1 of Infectious HIV-1 virus is recovered. Viral transcription, translation, assembly and Germination and germination normally occur in these cells, and the recovered virus is not susceptible. can infect sexual cells. Feinberg, M.B. , et al., Cell (Ce I), 46: 807-817 (1986). H To produce virus from wild type and mutated molecular clones of IV-1 Then, cos-1 cells were incubated with the wild-type pHXB2gl)t plasmid and the wild-type pHXB2gl)t plasmid as described above. and four mutated plasmids. these four The mutated plasmids are as shown in Figure 2: pA3 -HXB, where nucleotides 293-331 are present in wild-type HIV-1 When it does, it is deleted. pA4-HXB, where nucleotides 293-313 are , is deleted when present in wild-type HIV-1; pA15-HXB.

Veronese, F, D et al., Proceedings of Na. National Academy of Sciences (Proc, Nat 1. Acad , Sc i, ) USA, 82: 5199-5202 (1985). tissue culture p24 analysis was performed on culture supernatant or precipitated virus.

p2 detected in the supernatant of each mutant 48 hours after transfection. The amount of 4gag protein (n g/ml) is shown in FIG. Each transfer The culture medium was overlaid with 10 m of culture medium. DuPont P24 ELISA The kit was used and three different dilutions of each supernatant were analyzed. each sudden change 3 ml of Co5-1 supernatant from different transfections was incubated at 27.00 Or RT activity was measured after concentration by centrifugation at pm for 3 hours. The number is 1 ml supernatant is shown and is the average of three experiments. by radioimmunoprecipitation Analysis of the protein content of wild-type and mutant particles was also performed.

Example 3 Evaluation of HIV-1p15-gag Adding the role of HIV-1p15"' Infectious copies of the DNA of the E (IV-HXB2-D provirus) was introduced into plasmid W13 containing [Kim, Virus Jizume ( J, VirologyL in press]. [Shaw-et al., Cynins (S Insert the 8 nucleotide long C1aI linker present in cie549 and then Then, this CIaI site was blunt-ended with Klenow to create the gag reading frame. W13 was modified by adjusting. The resulting mutated structure The adult is called bcA20-W13. The mutation results in the substitution of two residues, resulting in two The residue is the first Cys-His box, a) Claims 1, produces non-infectious virus particles and is present in wild-type HIV-1 and HI changes in the nucleotide sequence that are important for virus packaging The V-1 mutant construct differs from wild-type HIV-1 in having an HIV −1 mutant construct.

2. Changes in the nucleotide sequence are present in the HIV-I RNA sequence or within the nucleotide sequence encoding the gag expression product. The HIV-1 mutant construct according to item 1 above.

3. Non-infectious mutant HIV-1 virus particles.

4.a) Present in wild-type HIV-1 and for viral packaging have changes in the nucleotide sequence that are significant and b) of wild-type HrV-1. having a protein content that is essentially the same as the protein content; Non-infectious mutant H1v-1 virus particles.

5. Produces non-infectious virus particles and is important for virus packaging. comprising changes within a region of the essential wild-type HIV-1 nucleotide sequence, said changes comprising: , a) Deletion of all or part of the HIV-1 marker site; b) Nucleotides 293 to Deletion of 331, C) Deletion of nucleotides 293-313, d) Viral packaging deletion of the gag nucleotide sequence important for e) Nucleo at the unique Apal p15''1 site present at position 2009 Insertion of the sequence CATCGCGATC, f) in Gf7)A at position 1508 and substitution of A by G at position 1517, and g) by A of G at position 1571 and by G at position 111580 Substitution of A, An HIV-1 mutant construct selected from the group consisting of.

6. HIV encoded by the HIV-1 mutant construct according to paragraph 5 above. -1 mutation expression product.

7. Expression products of HIV-1 mutations as described in item 6 above and pharmaceutically acceptable A vaccine consisting of a carrier that can be used as a carrier.

8. A vaccine consisting of HIV-1 virus particles that do not contain the viral genome.

9. Vaccine consisting of non-infectious HIV-1 virus particles.

10. Consisting of mutated HIV-I DNA, the mutated HIV-I DNA lacks nucleotides 293-313 when present in wild-type DNA mutated in mammalian cells, consisting essentially of wild-type HincI DNA. A plasmid capable of expressing different HIV-I DNA.

11. Consisting of mutated HIV-I DNA, the mutated HIV-I DNA lacks nucleotides 293-331 when present in wild-type DNA mutated in mammalian cells, consisting essentially of wild-type Hincr DNA A plasmid capable of expressing different HIV-I DNA.

12. Consisting of mutated HIV-I DNA, the mutated HIV-I The DNA contains the G present at nucleotide 1508 of wild-type HIV-I DNA. A is present in its place, and nucleotide 1517 of wild-type HIV-I DNA consists essentially of wild-type Hincl DNA with an A in place of the G present in can express mutated HIV-I DNA in mammalian cells. plasmid.

13. Substitute for G present at nucleotide 1571 of wild-type HIV-I DNA and present at nucleotide 1580 of wild-type HIV-I DNA. The above-mentioned No. The plasmid described in Section 11.

14, an 8 nucleotide long 0 in the unique Apal present at position 1549. of mammalian cells consisting of HIV-I DNA with a 1aI linker in it. A plasmid in which mutated HIV-I DNA can be expressed.

15, in the unique Apal present at position 1549, the following nucleotide sequence: CATCGCGATG, (7) Medium i: From HIV-I DNA with can express mutated HIV-I DNA in mammalian cells. plasmid.

16, a) Check each of the first two cysteines of the second Cys-His box. Replace with rosin, b) each of the first two cysteines of the first and second Cys-His boxes and C) in the first and second Cys-His boxes. changes to the intervening sequences, mutated expression products with at least one change selected from the group consisting of HIV-1 mutant constructs encoding.

17. Changes in the nucleotide sequence present in wild-type HIV-1 naturally and the interposition between the two HIV-1gag Cys-HiS boxes. 1, which results in a change selected from the group consisting of a change in the length of the sequence. HIV-1 mutant construct.

18. Variants encoded by the HIV-1 mutant constructs described in paragraph 17 above. Natural mutation expression product.

19, a) pA3-HXB.

b) pA4-HXB, c) pAl5-HXB, d) pAl, 4-15-HXB, e) pΔPAC-HVgrO- and f) bcA20゜ An HIV-1 mutant construct selected from the group consisting of.

20. Regions of the HIV-1 genome essential for packaging of viral RNA Triggering mammalian cells with DNA consisting of an HIV-1 mutant construct with changes in Preparing non-infectious Hrv-1 virus particles by transfecting how to.

21. The HIV-1 mutant construct is HIV-I RNA! exist in a part of the nucleotide sequence and the nucleotide sequence encoding the gag expression product. 21. The method of claim 20 above, having changes therein.

22, DNA consisting of the HIV-1 mutant construct described in item 5 above is used in mammalian cells. Non-infectious HIV-1 virus particles consisting of transfecting cells How to prepare.

23. DNA consisting of the HIV-1 mutant construct described in item 16 above is used in mammals. Non-infectious HIV-1 viral particles consisting of transfecting cells How to prepare children.

24. Non-infectious HIV-1 virus particles produced by the method described in item 20 above Child preparation.

25. Non-infectious HIV-1 virus particles produced by the method described in item 22 above Child preparation.

26. Non-infectious HIV-1 virus particles produced by the method described in item 20 above 2. A vaccine consisting of a child preparation and a physiologically acceptable carrier.

international search report ―h＾-＾-5ksllllll　Ie　PCT/US　90105932I III#11--6-^--mu Ill fishing φPCT no υ590105932 international Investigation report us　9005932 S^　41257

Claims (1)

[Claims] 1. Present in wild-type HIV-1 and important for viral packaging HIV-1 mutant constructs have changes in the nucleotide sequence that are , an HIV-1 mutant construct different from wild-type HIV-1. 2. Are changes in the nucleotide sequence present within the HIV-1 RNA ■ site? or present in a nucleotide sequence encoding a gag expression product, HIV-1 mutant construct according to paragraph 1 above. 3. Non-infectious mutant HIV-1 virus particles. 4.a) Present in wild-type HIV-1 and for viral packaging have changes in the nucleotide sequence that are significant and b) of wild-type HIV-1. having a protein content that is essentially the same as the protein content; Non-infectious mutant HIV-1 virus particles. 5. Nucleotides of wild-type HIV-1 important for viral packaging including changes within a region of the sequence, said changes including: a) all or all of the HIV-1 sites; is a partial deletion, b) deletion of nucleotides 293-331, c) nucleotide 2 93-313 deletion, d) gag nucleus important for viral packaging deletion of the leotide sequence, e) Nucleo at the unique ApaI p15■■■ site located at position 2009 Insertion of sequence CATCGCGATC, f) by A of G at position 1508 and substitution of A by G at position 1517, and g) A by A of G at position 1571 and A by G at position 1580 replacement of, An HIV-1 mutant construct selected from the group consisting of. 6. HIV encoded by the HIV-1 mutant construct according to paragraph 5 above. -1 mutation expression product. 7. Expression products of HIV-1 mutations as described in item 6 above and pharmaceutically acceptable A vaccine consisting of a carrier that can be used as a carrier. 8. A vaccine consisting of HIV-1 virus particles that do not contain the viral genome. 9. Vaccine consisting of non-infectious HIV-1 virus particles. 10. Consisting of mutated HIV-1 DNA, the mutated HIV-1 DNA lacks nucleotides 293-313 when present in wild-type DNA mutated in mammalian cells, consisting essentially of wild-type HincI DNA. A plasmid capable of expressing different HIV-1 DNA. 11. Consisting of mutated HIV-1 DNA, the mutated HIV-1 DNA lacks nucleotides 293-331 when present in wild-type DNA mutated in mammalian cells, consisting essentially of wild-type HincI DNA. A plasmid capable of expressing different HIV-1 DNA. 12. Consisting of mutated HIV-1 DNA, the mutated HIV-1 The DNA is a G that exists at nucleotide 1508 of wild-type HIV-1 DNA. A is present in its place, and nucleotide 1517 of wild-type HIV-1 DNA consists essentially of wild-type HincI DNA in which A is present in place of G present in can express mutated HIV-1 DNA in mammalian cells. plasmid. 13. Substitute for G present at nucleotide 1571 of wild-type HIV-1 DNA A is present at nucleotide 1580 of wild-type HIV-1 DNA. The above-mentioned No. The plasmid described in Section 11. 14, an 8 nucleotide long C in the unique ApaI present at position 2009. of mammalian cells, consisting of HIV-1 DNA with a laI linker in it. A plasmid capable of expressing mutated HIV-1 DNA within. 15, in the unique ApaI present at position 2009, the following nucleotide sequence: A mammal consisting of HIV-1 DNA having CATCGCGATG in it. A plasmid that can express mutated HIV-1 DNA in human cells. Do.