JPH05501052A - Quantification of bacteria using a nucleic acid hybridization assay - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Quantification of Bacteria Using Nucleic Acid Hybridization Assays Background of the Invention Yobodan standing The present invention provides a unique and oven-initiated synthesis of bacterial 16S liposomal RNA (rRNA). Quantifying bacteria using invariant bacteria-specific nucleic acid probes in one highly conserved region provide a method to do so. This probe allows rapid detection of 16S rRNA in samples. The number of marginal bacteria in a sample can be determined by comparing it with a known standard. It can be roughly estimated. The method is accurate, reproducible and performed at room temperature.

1 farm Sign of a nucleic acid hybridization assay to estimate the total nucleic acids present in a sample It is known to use null strength. E.J. Govance (E, J, G.

(Ans), N.R. Silver) (A, R. Bert) and - J. Burrall (C, J, Burrall) Innode with nucleic acid probes of specific DNA and RNA sequences in tissues and cells by Ubaibrinode formation. Detection (Chapter 5, 19+19), R.H. Mons (R, h, sy-.n s), CR/-Press, Inc. (CR, CPress, Inc.) , Pokalayton, Florida, and M.L.M. Anternon, M. L, M, Anderson) and B.D. Yanog (B, D, Y Quantitative Filter High in Nucleic Acid Hybridization Brid formation, practical methods (chapter 4), B.D. Haymes (E, D, Fa mes) and Niss J. Higgins (S, J, 111gg1ns), eds. IRL Press, United States of America E-C.

Universal probes for bacterial detection are known. Nis Jay Nojibannoni ( S., J. Giovannoni) et al., 1988, for mono-microbial cell identification. Phylogenetic group-specific O, ligodeoxynucleotide probe, J, Ba ct, 170 (2): 720-726 and B Noei Chu μ ( Rapid detection of bacteria associated with human periodontitis (P., J., Chuba) et al., 1988. Synthetic oligonucleotide/nucleotide probes for commercial use, J, Gen, Micro bi.

1, 134: Oligonucleotide reflecting the 1931-1938° UP9A region The code was written by C, R, Woese et al. (+975). Conservation of primary structure in +6s liposomal RNA, Nature 254: 83-85 (see Table 1. Oligos 47, 49 and 51) and International Publication No. 811103957 (see page 105).

The use of marginal bacteria counts to diagnose periodontal disease is currently accepted practice. isn't it. Nis-Nis Tukranksky (S, S, 5ocranksky etc., the microbial flora of the gingival sulcus region of Man-1, total microscopic and viable counts, and specific microbiota. Number of things, ArchOral, Biol, 8:27S-280 and double j L'E. C. Moore (1, E., C. Moore), 1987, Microbiology of periodontal disease. Biology, J, Periodontal Res, 22:335-341° Teeth The Force Center ( Forsyth Center) and J. of Dental Res, S Year, March 15-19, 1989, Volume 68, 1 It was reported on page 9, abstract number 122-124.

Summary of the invention The present invention involves lysing bacteria in a biological sample and applying the lysate to a hybridization process. under the condition 5°CTGCTGCCTCCC[1TAGGAGT3° Measuring the amount of bacteria in the above sample consists of contacting with a oligonucleotide probe provide a method to do so. The phrase “5°CTGCTGCCTCCCGTAGGAG d3° "Oligonucleotide probe having the sequence of" includes functional equivalents of this sequence. The intention is to Such equivalents are described in more detail below, but include nucleic acids. Contains analogs and slightly different combinations of oligonucleotides, hence the probes Specifically binds to a target region on 16S rRNA to which the claimed sequence is complementary do.

The term "lysate" refers to a solution containing bacterial nucleic acids. Lysate is a crude mixture of decaying bacteria , including crude solutions and purified solutions of bacterial nucleic acids.

The claimed probe is either a capture probe or a signal probe can be. The capture probe binds to the target nucleotide and then It is an unlabeled probe that captures the target on a solid support. Signal probe/gunar , adapted to be used for the generation of probes with an avinone moiety, for example. It will be done.

The sample is from a human, particularly a biological source, including blood, oral area or anogenital area. Obtainable.

The method includes at least one additional nucleic acid that is polar, polymorphic, or strain-specific. It can be further enhanced by adding probes. These additional probes are In addition to location, qualitative information can also be provided.

The present invention also provides diagnostic kits using the above techniques.

detailed description The present invention provides a nucleus designated 1IP9A that provides universal binding to 16S rRNA. It concerns the use of a unique sequence of acids (see Table 1). This array is thin @r Particularly specific to R,NA and does not significantly hybridize or form RAD with human nucleic acids. stomach. Furthermore, this sequence is located in the region of the liposome that is available for hybridization. and the abnormalities in rRNA secondary structure are minimal. Thus, quantitative assays It can be carried out without heat denaturation. A target sequence with this property is Referred to as the "oven" region because these regions are relatively available for hybridization. .

Bacterial quantification relies on the assay's ability to respond in a predictable manner to increasing amounts of rRNA. based on The υP9A probe is negatively related to the increase in bacterial rRNA snow. and reacts in a predictable manner by providing a linear response. suitable mark By preparing a standard and comparing it with that, the number of marginal bacteria in the sample was disclosed. can be easily quantified using the invention.

The present invention is useful in a vast number of clinical and industrial applications where rapid monitoring of bacterial counts is useful. expected to be applied in the environment. Bacteria count is a special disease state when a large number of bacteria is present. It is particularly used in diagnosing disease states that are suggestive of. For example, the number of bacteria may increase due to periodontal disease, stomach Useful in diagnosing ulcers, bacteremia, and urinary tract infections. Furthermore, rapid bacterial quantification is possible in blood. ! l! 2 and is often desired during the fermentation process.

Table 1. Examples of universal oligonucleotides for 16S bacterial liposomes.

18S rRNA oligonucleotide probe E. coli base position 0P7B S°G TAT ACCGC GGC GCTG 3° 519-536UP3A 5’TG ACGGGC[1GTGGTACA3' +390-1408UP9A S °CTGCTGCCTCCCGTAGGAGT3' 338-357 Oligonuc Acquisition of leotide, UP9A Complementarity (homogeneity) required for detectable binding of the UP9A probe to bacterial rRNA The degree of Ru.

The degree of complementarity is most preferably 100 percent, but the degree of complementarity is most preferably 100 percent, but By reducing the stringency of the lid forming media and/or cleaning media It should be understood that slight variations in RNA and UPS parameters can be offset. Gakushite , even though the complementarity is not 1.00 percent under reduced stringency conditions, the salt It is possible to obtain functional probes with slightly different groups for their rRNA targets. It is. Therefore, under less stringent hybridization conditions, acceptable specificity can be achieved. A small amount of tlP9A probe was added to quantify the presence of saline bacteria while maintaining the It is possible to modify it in any way.

UP9A oligonucleotides can be RNA or DNA compounds .

Additionally, nucleoside analogs may be used in place of naturally occurring nucleosides. You can also do it. Advantages of analogs include greater stability and resistance to nuclease activity. properties and ease of signal attachment. For g up g^ is machine It is intended to include all functionally equivalent species. Equal UP9^ Bukoob is also Certain sequences, concatemers of sequences, or flanking the UP9A complementary region of bacterial rRNA 10 or less bases located on one side and having any degree of complementarity with the natural sequence are in contact with the sides. It can also consist of probes that are

The υP9A probe can be chemically synthesized using commercially available methods and equipment. can be done. For example, to produce short probes of 15 to 50 bases, A body-phase postphoramidite method can be used. In the present invention, Califor Applied B of Foster City, Lunia iosystem S) model 380B DNA synthesizer, the company's It is preferred to chemically synthesize short DNA probes using reagents supplied by Yes.

In order to obtain a large amount of UP9A probe, T. Maniatis (T. iatis), etc., Laboratory Manual, Cole, New York Traditional roninog as described in Dospring Harbor 11982 The desired sequence can also be cloned using the commercially available Probes can be manufactured by chemical synthesis using an NA synthesizer. Ru. Examples of cloning include liposomal RNAM cDNA replication vectors, e.g. For example, pBR322, an insertion into M2S, or a vector containing the 5Pfi promoter. insertion into vectors (e.g., insertion of single-stranded RNA using 5P6 RNA polymerase) production), and transformation of bacterial hosts.

DNA probes are prepared by lysis and nucleic acid extraction, treatment with selected restriction enzymes, and gel analysis. It can be purified from host cells by further isolation by electrophoresis.

The use of polymerase chain reaction technology was also used to obtain large quantities of υP9A probe. can do. (See U.S. Pat. No. 4,683,202).

The UP9 probe detects bacterial rRNA as the target nucleic acid, Capture probes for Santoifti-type assays where GNAR probes facilitate detection It can be used as Table 1 lists additional universal probes for signal detection and Provides UP7B and UP3^ which are useful as

The +IP9A probe can also be used as a /gunar probe. / Guna Rubrobes are typically used to detect the presence of hybrid polynucleotides. can be labeled by any one of several methods used. most common A detection method is to use a probe labeled with 3H, 1251, 35S, 14c or 32P. The use of autoradiography by et al. The selection of radioactive isotopes is Depends on research preferences due to ease of synthesis, stability and half-life of isotope of choice do. Other labels include fluorescent substances, chemiluminescent agents, and enzyme-based 4jA-recognized antibodies. It is connected to the body and includes Gantt. Alternatively, the probe may be fluorescent, chemiluminescent, etc. Can be directly conjugated to specimens such as nescens agents or enzymes. Specimen selection depends on the required sensitivity, ease of conjugation with the probe, stability requirements and available instrumentation. Depends on usage.

The choice of beacon determines the manner in which the label binds to the probe. Radioactive probes are typical Generally, commercially available nucleotides containing the desired radioisotope are manufactured using Radioactive nucleotides can be prepared using a DNA synthesizer, e.g. , terminal deoxygenation/deoxygenation by nick translane transfer with DNA polymerase 3-terminus of radioactive DNA base probe by nucleotidyl tranosferase In the presence of radioactive thioquinonucleotides (dNTPs) by tailing to the end One JIM with a specific insert in the frenara fragment of DNA polymerase Radioactive thioquine nucleotide (dNT by transcribing from an RNA template using reverse transcriptase in the presence of P). or specific RNA viral promoters (e.g., SP6 promoter). from the vector with the corresponding RN in the presence of radioactive ribonucleotide rNTP. Transcribe the RNA using an A polymerase (e.g., 5P6 RNA polymerase) can be introduced into the probe by

Probes determine whether the isotope is present as part of a nucleotide molecule or The radioactive component is an inorganic acid, such as 32P phosphate or 14C organic acid. esterified with a radioactive moiety or treated to provide a linking group to the label. A radionuclides attached to a nucleotide through a terminal hydroxyl group that is sterlated. Labeling can be done using leotide.

Non-radioactive probes are often labeled by indirect methods. For example, the ligand molecule is Covalently bound to the probe. The ligand is then naturally detectable or or a detectable signal such as an enzyme, fluorescent substance or chemiluminescent compound. The antibody binds to an anti-ligand molecule that is either covalently linked to a molecular system. Riga The targets and anti-ligands can vary widely. The ligand is a natural anti-ligand. have ligands such as piotin, teroteicin, and cortisol. When the ligand is labeled and used in conjugation with a naturally occurring anti-ligand, I can do it. Alternatively, any hubtenic or antigenic compound can be combined with an antibody. can be used.

Probes can also be labeled by direct conjugation to a label. For example, clone The converted DNA probe is conjugated with poreslabdi/yuperoxidase or alkaline phosphatide. direct cobbling with sphatase (M., Renz and Kurz. , D N A colorimetric method of hybrid formation. Hue, Aeids Res, 12:3435-3444.1984), and synthetic oligonucleotides directly coupled to lucary phosphatase (E, Jablon ski et al., oligodeoxynucleotide-alkaline phosphatase conjugate and Their use as hybridization probes. Nue, Ac1ds, R e514+6115~612B,! 986, and PLI, etc., combined with enzymes Synthetic oligonucleotide probe Non-radioactive detection of preintestinal E. coli in fecal specimens Out. Nuc, Ac1ds Re5ls+5275-5287 (1987) ).

The enzymes that are important as labels are primarily phosphatases, esterases, and glycoproteins. Hydrolases such as Dase, or Oxid/Doreductase, especially Peroxidase/Dreductase. It is Fluorescent compounds include fluorescein and its derivatives, rhodamino and Examples of these include wire-shaped conductors, Dannol, and Umbelliferone. Chemiluminescence is /ferrin and 2,3-dihydrophthalanone dione such as luminol. .

District social results Microbial specimens used in the present invention may be obtained from any source suspected of containing bacteria. I can do it. Sample collection should be uniform and reproducible so that meaningful comparisons can be made. must be capable.

Samples are generally best dispersed when dissolution is possible immediately and the measured amount is Disperse in buffer. This dispersion buffer generally provides a biologically compatible solution. Ru. A typical dispersion buffer solution is 150d NaCl, 20w+M Tris-BC. I (pl+ 7.5), 10M EDTA, 10++M ethylene glycol rubis (β-amino/ethyl ether) N, N, N', N'-tetraacetic acid ( EGTA) or 150mM NaCl, 20mM NaPO3 (pH 7,5) , 10■y EDTA, and 10cm EGTA. Keep samples cool until use. Can be frozen.

Prior to quantification, samples suspected of containing bacteria are first subjected to a lysis solution to quench the cells. Release the nucleic acid. Sample dispersion before lysis is optional. The lysis buffer is known in the field. European Patent 199.439+ T.V.P. Tsu (ding)

V, Potji and Berry, Em, Internat. J, Sys, Bacter, 33 Near 6S-771 (1983), Wa Y, Bonta et al., J. Dent, 1ies, 64 A93-798 (1985).

Generally, these buffers have a pH between 7.0 and 8.0, and chelate It contains both a surfactant and a surfactant. Typically, the dissolved solution is a divalent metal Il-enriched surfactant solutions or surfactants with chelating agents (e.g. 5O5), a reducing agent and a divalent metal ester (EDTA). It is a chaotropic salt solution. N-acetyl muramidase (lysochy The use of enzymes such as proteases (e.g. protease K) or proteases (e.g. protease K) promote and deliver quality results.

Samples can be directly immobilized on supports or further processed to extract nucleic acids prior to immobilization. can be processed. The released or extracted mm nucleic acids (including target nucleic acids) are Lulose, nylon, nitrocellulose, noazobennoroquine methylcellulose It is immobilized on a solid support such as. The immobilized nucleic acids are then converted into hybrids. It can be subjected to forming conditions.

Alternatively, a sample is collected and 3M guanidine thio/anate (GuScN) , 50 M Tris (pH 7,6), 10 mM EDTA, 0.1% such as sodium dobuflu sulfate (SDS) and 1% mercaptoethanol. Can be dispersed in a dissolution solution that also serves as a Vibrilift forming solution ( 7.1ilniatls, etc., Molecular Cloning: WaX Manual, New York (Cold Spring, Kentucky, Haha+, 1982).

Hybrid, Do2 Various neutral solvents comprising about 20 to 60% polar organic solvent, preferably 30% A brift-forming solution can be used. A typical hybridization solution is approximately 5 0 v/v% formamide, about 0.5 to IM sodium chloride, about 0. 05 to 0.1 M buffer, e.g. sodium citrate, Tris-11 cL, Bi Beth or Hepes (pH range about 6-9), about 0.05 to 0.2% surfactant , e.g. sodium dobuflu sulfate, or between 0.5 and 20-M EDTA, 0 ．． 01-0.05% Ficoll (approximately 300-SOO beef Rodalton), 0.0 1-0.05% polyvinylpyrrolidone (approximately 250-500 kilodaltons) and and 0.01-0.05% clear albumin. Typical hybridization The solution contains approximately 0.1 to 51 g/ml of unlabeled carrier nucleic acid and fragmented nucleic acid. DNA, calf thymus or salmon sperm DNA or yeast RNA, and optionally about Also included is 0.5 to 2% v/v glycine. Various polar water-soluble or swellable agents such as polyethylene glyfur, anionic polymers such as polyacrylic or polymethyl acrylate or polystyrene sulfonic acid, and Ionic saccharide polymers, such as capacitance excluders containing dextran sulfate. Other additives may also be included.

About 2 to 4M GuSCN, preferably about 3L001 to 0.1M Tris (p i+ range about 60 to 8.5), dodecyl sulfur at a concentration of about 01 to 5% (W/V) a surfactant such as sodium chloride, and about 0.01 to 0.1 M EDTA or Another hybridization solution can be used. Other additives, e.g. A carrier such as DNA or RNA, or bovine serum albumin or gelatin. It can also contain other proteins. The stringency of the hybridization solution is approximately O It is possible to add 10%, usually 5%, of formamide.

No particular hybridization technique is required for the invention. Hybridization technology is , Nucleic Acid Hybridization - Practical Methods, B. D. Heimes and Niss D. Edited by A. Higgins, IR Press, 1987. GaLL and Pardue (1969), Proc, Natl, AcadScl, United States of America, 63:3711-383, and (John), Burnsteil and Jones (J ohnes) (1969) General to Nature+223+582-587 It is described in. As improvements are being made in hybridization techniques, they Easy to apply.

The amount of labeled probe present in the hybridization solution depends on the nature of the label, the cell The amount of labeled probe that can reasonably bind to the target nucleic acid of the hybrid Wide variations are possible depending on the stringency of the head forming medium and/or the cleaning medium.

In general, probes that exceed significantly the stoichiometric amount of target nucleic acid are Used to increase the rate of binding to DNA.

Various stringencies of hybridization can be used. of hybridization As conditions become more stringent, probe and target must be present for duplex formation to occur. The degree of complementarity between them should be greater. Stringency is temperature, ionic strength, pH and can be controlled by the presence of partially denaturing solvents like formamide. Ru. For example, the stringency of hybridization is determined by varying the formamide concentration from 0% to 50%. Operating within a range, the polarity of the reactant solution can be varied to advantage.

The assay test protocols used in the present invention are conventional in the field of nucleic acid hybridization. single-phase and target or probe polynucleic acids in solution. mixed phase in which either the probe polynucleic acid or the probe polynucleic acid is immobilized on a fixed support. be. Assay test protocols vary and are considered a limitation of the invention. Shouldn't. A general review of monophasic hybridization and nucleic acid hybridization in practice Methodology, edited by B. D. Haymes and Niss J. Higgins, IR. Elpres, 1985, and hybridization of nucleic acids immobilized on solid supports. , Jay Meinkoth (J, Meinkoth) and Nor Wah (G, 1) fah), Analytical Biochemistry, 238.267-284, 1984. Therefore, it can be obtained. Mixed phase/~brid formation is preferred.

Nucleic acids obtained from bacteria lysed with GuSCN can be directly immobilized on and hybridized with a suitable probe. . The GuSCN-lysate was diluted with formaldehyde-containing buffer and treated with nitrocellulose. Rulose is diced and heated to 80°C to denature the nucleic acids.

Regardless of the assay test protocol used, bacterial cells remain at moderate temperatures for long periods of time. and the hybridization solution. In single-phase assays, double-stranded duplicates are S] Precipitate duplicate molecules after nuclease digestion or choose phosphoric hydroxide can be separated from single-stranded nucleic acids. In mixed phase assays, support Nucleic acids immobilized on a support are treated with a concentration similar to that specified in the hybridization solution. Introduced into a wash solution with sulfur chloride, buffer and surfactant.

The time the support is kept in the wash solution can vary from a few minutes to 3 hours or more. can be set.

Either the hybridization or washing medium can be g­concentrated.

Typically, mixed-phase assays most often determine stringency and The washing solution promotes the dissociation of duplicates of different orientations. buffered dilute sodium chloride After washing the support at room temperature with a solution of can be assayed according to the nature of the recognition.

If the label is radioactive, the presence of the probe can be detected with a non-delay/triple counter. can do. Further advantageously, in mixed-phase assays, the substrate is dried and exposed to X-ray film using any number of conventional autoradiographic protocols. can be done.

If the label is fluorescent, the sample is first illuminated and detected using a particular wavelength of light.

The sample absorbs this light and then a different wavelength of light is picked up by a detector. (Physical Biochemistry, D, Frei felder+W, H, Freeman & Co, pp. 1537-542, 19 82).

If the label is a hapten or antigen, the sample can be detected using antibodies. Wear. In these systems, the signal is generated by coupling a fluorescent or enzymatic molecule to the antibody. can be done. Optionally, the antibody is labeled with a radioactive probe.

(P, Tijssen, Practice and Theory of Enzyme Immunoassay, Biochemistry and Molecular Biology Laboratory techniques in physics, li, 11. Burdon, ph, B, va (Ed. Knippenberg, Elsevier, p. 9+0, 1985) .

One detection method is enzymatic detection conjugated with biotin. Fluorescence is an alternative label However, biotinylated peroxidase or alkaline phosphatase Preference is given to enzyme vA in combination with avidin or streptavidin. enzyme Avidin or streptavidin conjugated with enzymes can also directly couple the enzyme to the probe. It can also be used (Haase et al., cited in 1). The preferred enzyme is peroxidase. Sidase or alkaline phosphatase. A particularly preferred method is to Using directly conjugated enzymes. Preferred enzymes are alkaline phosphatase and It is peroxidase. There are no known methods for conjugating enzymes to oligonucleotides. ing.

Nucle (c Ac1d Res, 14:8115~et2a (198B) and Nucl, Ac1d Ras, IS:5275-5287 (198 7).

In preferred cases, the UP9A abscess protocol is of the sandwich type. This is an assay for The main component of a sandwich-type assay is the solid support. Ru.

The solid support is unlabeled and complementary to a portion of the rR,NA sequence. Adsorbs or covalently binds immobilized nucleic acid probes. Shown in Table 1 Hybridization with minimal secondary and tertiary interference with the liposomal RNA region, such as Preferably, the probe will form a waveform. The advantages of such probes are hybrid, The fact that code formation can be performed without an additional step of thermally denaturing the sample nucleic acid Ru. The test sample suspected of containing bacteria is then placed in hybridization medium. to contact the solid support. Finally, complementary to another rRNA sequence of the pathogenic bacterium A second soluble specimen probe is hybridized with a nucleic acid probe immobilized on a solid support. Hybridizes with rRNA forming a hybridization duplex. mentioned above As mentioned above, the UP9A probe can be either a capture probe or a signal probe. can function as a

Alternatively, the assay format is a mixed phase, non-sandwich type assay. Can be done. In preferred embodiments, all assays are performed at room temperature. One bacterial sample Nidoran capture filter and multiple biotinylated signal oligonucleotides is dissolved in a lysis/hybridization solution containing. Hybridization is intense Shake well (optional) and complete in 40 minutes. Filter filters hybridization solution Wash with streptavidin-HRP and shake vigorously to avoid Combine for minutes. Wash the filter again, then shake gently for 10 minutes. Place in coloring solution. Color development was stopped at the final wash and filters were evaluated. .

Not the number of marginal bacteria, but the specific fine m8! provides an assay that can quantify the amount of In order to Combination with otide probes is also feasible.

1st emperor The proportion of UP9A bound to the matrix of thin@rRNA is predictably and reproducibly increases with the amount of bacterial rRNA in in the sample In order to accurately quantify the amount of rRNA present, standards must be prepared for comparison. No.

Virtually any label or detection means used in nucleic acid hybridization can be Can be standardized and quantified for use with the 9A probe.

Standards were UF '9^ Take a known amount of bacteria that have complementary sequences and pair these bacteria with It is used as a light to produce illumination. The amount of signal can be compared between standards and unknowns. It must be correlated with the amount of hybridization. For example, auto radio Gram intensity can be used to compare the relative amount of hybridization. Noriyoshi Typically, a densitometer is used for comparison. Enzyme-linked probe in colorimetric assay format The use of a tube allows for the use of automation/stem to measure bacterial load. child This is an technique that uses a spectrophotometer to measure the amount of antigen present in an unknown sample. Similar to the law.

on earthworks [Using the IP9A probe to construct a commercial diagnostic kit for clinical laboratories] be able to. Such kits are suitable for performing nucleic acid hybridization abscesses. It will include an instruction card and vials containing the various solutions needed. this These solutions include lysis solution, hybridization solution, lysis and hybridization solution. Includes a combination solution, and a wash solution. Bovine throat can also contain labeled probes I can do it. [1P9A probe is either unlabeled or 1m according to the assay format. Either is fine. yAr$ reference for comparing results is given solution It may also be necessary to easily estimate the number of bacteria inside. According to the signs used, Additional ingredients may be required in the kit. For example, enzyme labeling requires a substrate .

Depends on total number. diagnosis of Using standard culture methods, the following parameters allow the diagnosis of periodontal disease using the total bacterial count. Developed Lameter. The total bacterial count is sometimes referred to as the "bacterial load."

In an earlier but unrelated study conducted by Forsys Dental Center, Ken H. / 1x102 to 1/1o5 of the patient without plaque or after treatment It was reported to have between 1 and 2 cells. The inventor suggested that There is a literature that states that the marginal bacteria burden test is useful for diagnosing periodontal disease! find a basis Because it could not be normal, the disease being treated with tetracytalin fiber, Disease after treatment, culture of individual pathogenic periodontal bacteria in diseased patients after tooth scraping In addition, we decided to measure the marginal fungal burden. Suitable plaque samples are cured. cells were collected in cells and placed in culture medium, and the cell counts of saline bacteria and individual pathogenic bacteria were determined. was determined by established microbiological techniques as shown in Table 2.

Table 2 Culture of disease pockets at Fornos de Notarce/Tar and the University of Washington Average number of total and individual bacterial counts measured by Forsys Washington Research a University research Edge line @6x107 7x107 individual bacteria Actinomycetem fumitans (^a) 2x 106 Sx Log bacterium Odes Gingivalis (Bg) 4X106 7X106 Bataderiodes Inota - Metuus (Bi) 6x 106 8X 106 Eikenera Frodenos (E e) 3X 106 4x 106 Fusobacterium nucleatum (Fn) 5x 105 2x 105 Vuorinella Lecta (Wr) lx + oa 3x 104 Table 3゜Diseases and treatments at Forsys Dental Center and the University of Washington and the total bacterial count measured by culture of normal pockets.

Disease status: number of marginal bacteria Disease (+00) a 6X10f Fierce/moderate b 7X107 After treatment (40) 8 2.5X106 Normal (20) b 5X106 a) Measured at Forsys Center b) Measured at the University of Washington From the data in Tables 2 and 3, it can be concluded that: When the state becomes normal, the average cell number decreases by about 90%.

b) When treating disease conditions either with tetracyclinos or after scraping A similar decrease in cell number is observed.

C) From these two studies, we found that when collecting bullion samples with cow elms, The disease state begins when the cell number increases substantially above 5x+06 cells.

These values will become more accurate as more data accumulates. Beef Collection I noted that approximately 10 times more plaque samples were collected using scraping and then paper fish. Should. Therefore, the power and nodal cell count to determine the disease status is a sample collection method. Rely on.

There is cumulative evidence confirming the relationship between total bacterial count and bacterial vaginal status. Therefore, periodontal disease It is possible to measure the number of edge lines m in the same way as in the case of .

It is known that the progression of screen syndrome depends on the number of marginal bacteria cells. Similarly, limbobacteria cells The number can be measured in the same way as for periodontal disease.

In peptic ulcers, gastric 911 is elevated and may favor increased bacterial growth. be observed. Therefore, we believe that the total bacterial count would be an indication of the presence of an ulcer. that Therefore, the marginal fungal count test can also be used in this case.

Example 1: Colorimetric Sand German Cheapsey method and UP9A Nidra as a capture system Detection of Marginal bacteria in pI% GuSCN lysates using 3M GuSCN, 2% Zarconle, 50 ■ Mackerel Tris, pI+7. a, from EDTA on 25■ of 108 cells in a 100 microliter volume using a lysis solution of a. Bg.

A mixture of Bl, Ee, Fn and Wr was dissolved at 19°C. Then, melt The lysate was heated in a 65°C water bath for 10 minutes. Bacterial 1fiSr RNA (Si A biotinylated 24-component oligonucleotide complementary to the constant region of Otide probes (UP7B and UPJ^) are 3M G used as diluent. Both uSCN lysis solution and lysate were added to a final concentration of 100 nanograms per 11 I added it so that Seven 10-fold serial dilutions were then made on the heated lysate; This solution was then added to 1 microgram of tlP9A-specific oligonucleotides. The capture probe was covalently immobilized for 1 hour at ambient temperature. I covered Innogyu with Suk. Then, the solid support is S D S/FW (0 ,01-2.0% sodium dodel/sulfate and 0.09M0) NaCl,p H7,50) Filter 0.01M Tris-HCl and 5mM EDTA After washing with washing solution (FW) at ambient temperature, Avidin/porslabino/-baroki/dase (SA/l'1RP) conjugate and Both were incubated at ambient temperature in SDS/FW.

The solid support was then washed with SDS/FW, FW, and then treated with peroxy/dase. Presence of 3 mM 4-methox/naphtho in O, IM phenolate buffer, pH 5.5 The measurement was performed by incubating for 15 minutes with the filter containing the filter. As a result A cell culture of 1 x 106 bacterial cells was achieved using supplemented pAOUSCN lysates. It showed what had been accomplished.

Example 2: Quantification of the number of bacteria in plaque samples 20 normal periodontal samples were collected and 1/2o of these samples were taken for microbiological culture analysis. Is there a remaining sample? The resulting nucleic acids were immobilized on Nidoran membranes and then primed with the universal primer UP9A. explored. Table 4 Comparison of cell numbers determined by microji culture and probe analysis It shows. As explained in the experimental section below, bacterial numbers are The intensity can be estimated in a sample by comparing the signal intensity of a standard. 32 P Signal intensity is similar when hybridizing with titllUP9A. What we are doing is that the total nucleic acid extracts of a panel of 72 strains of 14 different bacteria As previously shown in Lancelot plots.

Table 4 Comparison of the number of thin m cells measured by microculture and probe analysis ! , 5X 1G7 5X l07 4, 6X106 3x106 5, 8X Lo66x 107 6, 2x 107 ax 107 7, 5x106 3x107 ! 1. IXII) 7 6X107 9, 4x106 6xlQ6 1.0. 9x105 3xlOf+ 11, I x 106 3x 10812, 3x106 1. x1G? 13, 5XIQ5 2x10g 14, lX107 6X106 Is, 1Xio7 6xll18 16, 1x105 1x105 17, 8x104 1xl [15 +8. 2X 106 2X 107 19, 1x 107 ax106 20, 5X 106 2x 1.0? Microbiological cell counts only show viable bacteria Therefore, the probe cell count is based on the total nucleic acid isolated from both viable and non-viable bacteria. is generally expected to be higher because it detects the presence of

Method Plaque samples were collected with curettes and mixed with 21 buffer solution (Q, 115M Na C1,0,2M Tris-1ick pn 7.5.0. OIM EDTA, p 7.5 and 001M EGTA). When done carefully, the cue Reproducibly eliminates up to 90% of the bacteria present in the tooth pockets of the mouth using LEFT. can be removed. Remaining stock of each sample (1/20 for microbiological culture) (after taking) was stored at -20°C for several days. After thawing, the sample has an SD of IW/V% The cells were treated with S and 1 mg/++1 of brotinase. Total nucleic acid consists of two phases. Treated with alcohol-chloroform extraction followed by ethanol precipitation.

The pellets were resuspended in TE (lomM Tris, 1 mM EDTA,) and heated at 95°C for 1 minute in the presence of IQ+iM Pibes, p) 17.6, and Scores were made on the Nidoran membrane filter. Nucleic acids are baked at 80℃ for 1 hour and was fixed on the filter. This filter is a 30% formamide hybrid. head forming solution (30% formamide, 0.6 M NaCl, 90 d Tris, 10sil EDTfi, +0.5W/V% SDS, 5X Den/λ lt, +o Kinase treatment for 16 hours at 43°C in 71 g/l of hydrolyzed yeast-RNA) -P-labeled universal primer oligonucleotide (UP9A). fill 50% in 0.09M NaCl, 9% Tris, 0.6M ED'TA. C. and then exposed to X-ray film. The obtained autoradiograph was Comparisons were made with a standard of cultured bacteria prepared and treated in the same manner (see below).

beans! Tanefeng plate! Total nucleic acids obtained from a known number of actively growing cultured bacteria were extracted as described above. then the nucleic acids are carefully extracted, serially diluted, scored and then probed with the same universal primer oligonucleotide. The resulting autoradiograph The graph shows the signal intensity of a known number of bacteria. Then use this standard curve to The amount of total nucleic acid present in the known sample was estimated.

Example 3: The 0PQA probe is a universal probe for di-bacterial blastids. be.

Tests were conducted on the following genera Niactitubatellus, Haemophilus, Bacteroidetes, and Eichene. La, Humbacterium, Vuorinella, Campylobacter, Essierifhia, P. Butostrebutococcus, Streptococcus, Cabnontophaga, Selenomo 78 different species of ai+m including Solanum, Actinomyces and Fusibacterium It was carried out on stocks. Nucleic acids obtained from different bacteria are extracted and Notched on Luther. The filter was then filtered with 30% formamide, Kinase for 16 h at 43 °C in 0.6 M sodium chloride hybridization solution. Probing with treated υP9A oligo. The filter is then exposed to X-ray film Prior to washing at 50° C. in 0.09 M NaCl 10.1% SDS solution. hive The degree of ribtoformation was strong (3), moderate (2), weak (1), and non-detectable (3) for all species tested. It was evaluated as 0). [lP9^ showed strong hybridization results in all bacterial species tested. showed results.

UP9^ is a universal probe for Niobacteria and Blastids. this pro The probe specifically hybridizes with nucleic acids (particularly rRNA) obtained from these two groups. Formation. This probe weakly interacts with Arcanibacterial and eukaryotic nucleic acids. It only forms hybrids.

Example 4 Total bacterial count capture oligonucleotide using sandwich assay and terminal transfer using UP9A as a signal oligonucleotide. Sandwich assay using polybiotin-treated UP3A and UP7E In the study, marginal bacterial cell counts were first determined from a mixed peridental (PD) bacterial cell culture. and secondly on plaque samples. Approximately 50 plaque samples were collected from the dental field. Teeth as intense, moderate and normal according to clinical parameters used in Classified by departmental hygienist. Samples were captured using UP9A as capture probe. analyzed using a switch assay. Preliminary results show severity of disease and presence of marginal bacteria It was found that there was a positive trend between Limbo bacterial counts were not performed on these samples. Therefore, the inventor could not draw an absolute conclusion at this point.

A mixture of 7p1 and FDIBII was constructed in equal proportions. cells by gel electrophoresis actively growing, while all PD bacterial cultures showed strong liposomal RNA bands. It was determined that it has. υPff＾Capture oligonucleotide and polybioti Each individual cell is isolated in a sandwich assay using a conjugated signal oligonucleotide. It was shown that the bacteria produced almost the same signal, except for slightly lower W, Lecta. It was.

Example 5: υP9A shows low cross-reactivity with human cells.

UP9A is particularly specific for bacteria and exhibits low cross-reactivity with nucleic acids of human origin.

Four human tissue culture cell types (AS49-lung cancer, He1x and 5iHa-both cervical cancer, and T2-lymph 11l) were lysed in 6M (iuSCN). I let it happen. Fresh blood was also lysed in GuSCN. Add 5 and 25 μl of blood. 108,107,106 and 105 cells mI [l cell equivalent ( bee) and bacterial cells (control) in a 100 μm volume sandwich assay. I'm tired. Human nucleic acids are estimated to be more complex than bacterial nucleic acids.

Capture: UP9A filter Signal: Biotinylated UP3^ and UI'7B Hybridization time: 40 minutes Only faint signals were seen in 108 bees of human cells. blood flow The filter is a dull tan color at 5 μm and darker at 25 μm, but It had no obvious blue signal. Therefore, of signals from human sources. so that the contribution is minimal and only when very large numbers of cells are present Seem.

IX108bea human nucleic acid or The background can be eliminated by changing the stringency.

Furthermore, 1. Fewer than X105 human cells are present in the plaque sample. It is expected that this will happen.

E. coli and 5iHa cells were used in this assay as positive and negative controls, respectively. used. It is clear that UP9A shows no cross-reactivity with nucleic acids obtained from 5iHa cells. Previously shown in Ro.1 Tobropt. However, in this study, we did not shake vigorously. In the Santoi 1 cyanose system used in A non-specific interference signal was seen in 5iHa cell numbers as shown below: Cell count Assay time cells minutes lX105 30 1X104 60 This low cross-reactivity hinders the utility of UF'9^ as a universal probe for bacteria. It doesn't work.

Example 6: Specificity of 8g bacteria in pyrrolidone-based hybridization media detection 20% N-cyclohexyl-2-pyrrolidone and 20% N-hydroxymethane. Chill-2-pyrrolidone, 50 M Tris, pH 7', 6.25 M EDT A, using a hybridization medium consisting of 2% SDS, B1. 1 x 108 cells of Ee, Wr, Pn and Bg at 1.00 microlift The mixture was dissolved at 19°C in a volume of 100ml. A biological protein that is complementary to the constant region of bacterial 16S rRNA. 1 ml of tinated 24-mer oligonucleotide probe (target probe) 100 nanograms was added to give a final concentration of 100 nanograms. This solution is then added to the Ichrogram's 8g-specific oligonucleotide probe (capture probe, see Table 6) Incubate for 1 hour at ambient temperature with Nidoran discs covalently immobilizing FA). Cubated. The solid support was then washed using SDS/FW at ambient temperature. and then 10 ng/ml Streptavidin/Horse Radino Super 30 min at ambient temperature in SDS/FW with oxidase (SA/[IRP) conjugate. Incubated. The solid support was then washed with SDS/FW+FW and then The presence of peroxidase in the 3-methyl- 2-penzothiazine nonohydrazono, 6mM 4-methquinonaphthol and 4 O, IM citrate phosphate buffer containing mM hydrogen peroxide, pH 5, It was determined by incubating the filters in 50°C. As a result, 8g It was shown that only bacteria were detected in the colorimetric sandwich assay. Therefore, Pyrrolidone l-hybrid formation medium provides effective lysis and specific nucleic acid formation of target nucleic acids. Promoted base pair formation. Direct relationship between cell number and color density by comparison in serial dilutions was recorded.

Example 7. One-step Absay for Detecting Specific Nucleic Acid Sequences of Bacterial Pathogens 20 % N-chlorohexyl-2-pyrrolidone, 20% N-hydroxymethyl-2 -pyrrolidone, 10% N-dodenru-2-pyrrolitono, 501M Tris, p H7,6,251M EDTA and 2% SDS for 1 to 2M 11′ Cteroides dinogyvaris (Bg)-specific oligonucleotide 16StR probe (Table 6 #IKI) was covalently immobilized on top and also 16StR 1X10 cp 32P oligonucleotide complementary to the 8g specific region of NA Also contains probe (specific activity of lXl07 cps per microgram) 1-5 g of 6 micron beads (silica, Clwyd, UK) - Phase Sep, Deesida Ind (Spherisorb ) using a pre-prepared pyrrolidone solution (PLS) containing Aa, BL Ees Wr, Fn and Bg lX106 cells in 100 micro The mixture was dissolved at 19°C in a liter volume I.

This solution was then incubated for 30 minutes at room temperature. The solid support is then Cleaned with SDS/FW at room temperature and irradiated with no stains/dust. The sex probe was removed. The solid support was then released by counting /notile=7g. The activity was monitored. This result indicates that the 8g-specific oligonucleotide signal probe and specific labeled probes for ^a+Bi, Ek, Fn or Wr. It was shown that only 8g cells were detected when no lobe was used. Thus , in 30 minutes, lXloS 8g cells undergo a simple 1 step/% hybridization procedure. Detected in Sei. Direct comparison between cell number and radioactivity by comparison in serial dilutions Relationships can be recorded.

Example 8. To proteinase/SD S/guanidine thionanate dissolution/no ＼Ibri, assay for detecting specific nucleic acid sequences of pathogenic bacteria in do-forming solutions Anaerobic growth medium (10 M Bipes buffer, pHB containing brain, heart, and influenza cells) 02 g7 ml of proteinase and a pre-prepared solution consisting of 0.2% SDS. Aa + Bt, ag, Ec, Wr, Fnjgf lX108 bacteria Added to cells and left at room temperature for 3 minutes. Bacterial 16S rRNA constant region and Complementary 1oanIl/ml biotinylated 24-mer oligonucleotide protein Add an equal volume of 6M guanidine thionoanate solution containing UP 9A). This solution and guanidino cell lysis solution (GuCLS) were then added to each Aa+Bg, Bi, Ee+Wr, Fn-specific oligonucleotides in the macrogram Together with a Nidoran disk that covalently immobilizes a leotide probe (capture probe). Incubate for 20 minutes at ambient temperature. The solid support is then SDS/FW at ambient temperature, followed by 10 ng/ml streptavidin/water. SDS/F using Sladepununo f-oxidase (SA/BRP) conjugate Incubate in W for 5 to 10 minutes at ambient temperature. The solid support is then 3/FW, washed with FW, then/existence of Z1 oxidase as described in Example 1. Incubate the filter with a substrate that forms an insoluble product in this manner. Measured by heating. The results showed that when using bacteria-specific capture probes, bacteria is detected by the colorimetric Santoifuchi assay and there is a direct relationship between color concentration and cell number. It shows that there is.

The above method involves a) lysing the bacteria and directly incubating them in 3M GuCLS at ambient temperature. b) bacteria with 3M guanidinothiocyanate (GuSCN); ), 50 M Tris-HCl (pH 7,6), 2 (W/V)% Leconle, dissolved in 012M β-mercaptoethanol and l\Ibri C) heating to 65°C for 10 minutes before carrying out the pad formation at room temperature; The above method was compared to an identical method except that the bacteria were lysed directly in PLS.

The following relative sensitivities were observed for the four methods shown in Table 5: Table 5 Comparison of sensitivity of various lysis/hybridization methods.

Dissolution/Hybridization Relative Sensitivity GuCLS ambient temperature (^Leap) 1 heated GuCLS 10-25 For proteinase/SDS/GuCSN ATemp 10-25 pyrrolidone solution Solution solution (PLS) ATemp 5-10 Table 6゜No secondary and tertiary interference 16 Probes derived from the hypervariable and constant regions of S and 23S liposomal RNA.

Oligonucleotide probe Escherichia coli base position 16S rRNA RNA region Aa-4B S’ACCCATCTCTGAGTTCTTCTTCGG3° 9 90-1 [13G^a-10B S’TGGCATGCTATTAACACAC CAACC3° 445-475Bg-68S’CCTTAGGACAGTCT TCCTTCACGC3' 395-430Bg-11B S'GGTTT-C ACCATCAGTCATCTAC^3' 990~10308g-5B S' CCGATGCTTATTCTTACGGGingACAT3° 475~505Bi -385'CACG-GCCCCAC-T-AC-CCCCAA3' 445~ 475Bl-5B S’GAGTC^^CA Ding CTCTGTATCCTGCG3 °990~10302B+-2B S’CGTGCGCCAATTTATTC CCACATA3' 445~475Elk-4B S'GTACGCTACT AAGCAATCAAGTTG! '828~865Ei! -2B 5゛GCA CTTCCCTTTTCTTCCCTAACA3' 445~475Elk-5 B　CTTCCGTCTCTGGG^^GGTTCCGTAC3' 990~ 1030Fn-2B S’GTTGGTACCGTCAdingTTTTTTCTTC 3'　445-475Fn-4BS'DINGCAGACTCTCGGTCCATTG TCCAA3° 445-475Fn-6B5°AAACATCTCTGTCT CATTCCTAAG3'990-1030!1r-IB S'GTACCG TCATAATTCTTTCCCAAG3' 445-475Wr-6B S' CTTGGG Ding ACCGTCATAATTC Ding TTCC3' 445-4752 3S rRNA RNA type area 8g23-2　S°GTACGGGTAACACAGAAATATGCT3° 1570-1620Bg23-4 5°GACTATATACCTCAAATT GCTTTT3' 1800~18308g23-6 5'CCTACACAT CTGATGCCAAATACA3' 2085-212016s rRNA missing strange area UP2D 5° CCCGTC11A TCMTTTGAGTTTT3° 906 ~927UP3A 5°TGACGGCGGTGTG ACA＾3' 139 0~1408UP7B 5° GTATTACCGCGGCTGC ding G3' 51 9~536UP9A 5'CTGCTGCCTCCCGTAGGAGT3゛33 8~357UO20B S’GACTACYIJGGGTATCTAATCCC3 '7115-805UP21^5'TTAAACCACATGYTCCWC CGCTTG3' 936-95923S rRNA constant region UP12B S’TYGATTGGCMTTTCACCCC3’ 775-79 3230PB　S’CCGGTCCTC ding CGTACTA3°　2653~26 6g23UPJ 5°TTCGCTC[1CCGCTACT3" 241~25 623UPM　S°GTTATAGTTACGGCCGCCGTTTAC3' lH7-1920 Example 9: Key for diagnosis of periodontal disease by measuring marginal bacterial load t.

The following ingredients are useful for estimating the marginal bacteria load in tooth pockets and diagnosing periodontal disease. Configure the kit.

Product insert. Product insert includes complete documentation of patient sampling and evaluation. Contains complete instructions. Instructions follow the method of Example 4.

data card. Data cards contain information such as patient identification, collection site, and test results. Enter the patient's minimum baseline data for recording.

Win two. Kyurebuto for sampling by scraping.

Endodontic treatment points. Also include the endodontic treatment point (paper fish) for collection of each sample to be tested. with gauze After cleaning the supragingival surface by wiping, mark the subgingival surface of the tooth to be sampled. Wipe away bacteria from the body and remove bacteria by absorbing saliva, gingival fluid and gingival plaque. used to collect.

Lysis reagent. Each point or curette with a sample collected lyses the bacteria and Thin l! ! Immediately place into numbered lysis reagent tubes to release nucleic acids.

Probes/enzyme reagents. Ligand with or directly conjugated to an enzyme reagent A standard fraction of probes labeled with bacterial nucleic acid targets and liposomal RNA Hives between/gnal oligonucleotide probes derived from constant regions of sequence Add lysis reagent to each tube to initiate the lid formation reaction.

Dipstick device. Bacteria-specific DNA covalently immobilized on a solid support Contain the area with the A probe and note and confirm each area of the tooth sampled. Individual dipstick devices with space for recognition Immediately insert into each tube containing the deformation mixture and incubate at room temperature. .

Cleaning reagent. Remove each dipstick device from the hybridization mixture. and wash with washing reagent using the provided container.

Enzyme substrate reagent. The dipstick device is grouped together in the enzyme substrate reagent container. and let the color develop for a few minutes to an hour at room temperature. Each dipstick The vise is washed again with cleaning reagent to remove excess pack grawand color.

Reference card. A reference that visualizes color development and indicates bacterial load by comparison with known standards Compare with cards.

Copy and translation of written amendment) Submission (Article 184-7, Paragraph 1 of the Patent Act) January 1, 1992 3 days

Claims (18)

[Claims] 1. Lyse the bacteria in the biological sample and extract the nucleic acids with the sequence under hybridization conditions with an oligonucleotide probe that wherein the method is carried out at a temperature range between about 12°C and about 40°C. A method for measuring the amount of bacteria in a biological sample. 2. Claim 1, wherein the oligonucleotide probe is a capture probe. Method. 3. Claim 1, wherein the oligonucleotide probe is a signal probe. How to put it on. 4. 2. The method of claim 1, wherein the sample is obtained from a human. 5. According to claim 4, the sample is collected from blood, oral area or anogenital area. Method described. 6. At least one addition of sample nucleic acid that is genus-specific, species-specific or strain-specific 2. The method of claim 1, further comprising contacting with a nucleic acid probe. 7. sample nucleic acids with at least one additional compound that universally hybridizes with bacterial nucleic acids; The method of claim 1 further comprising contacting with an additional nucleic acid probe. . 8. Oligonucleotide probe with sequence of bacterial nucleic acid hybridize under hybridization conditions and determine the degree of hybridization. Detect and use pre-determined bacterial load standards in health and disease states A method of identifying animal health and disease status using bacterial counts consisting of comparing 9. Obtain a standard size sample from the tooth pocket, lyse the bacteria in the sample, and extract the nucleic acid. hybridize with an oligonucleotide probe having the sequence contact under hybridization conditions to detect the extent of hybridization and Measuring the amount of bacteria in a mouth scraping sample consists of comparing the degree of formation with a standardized sample The method according to claim 8. 10. The diagnosis of periodontal disease is based on the fact that the amount of bacteria in the tooth pocket is 107 microorganisms per mouth scraping sample. The method according to claim 9, which is carried out by measuring that it exceeds bacteria. Law. 11. Oligonucleotide probe with the sequence [Sequence available], known amount A kit for quantifying the amount of bacteria in a sample, consisting of a reference sample with a nucleic acid and a lysis solution. . 12. selected from the group consisting of genus-specific sequences, species-specific sequences and strain-specific sequences. Claim 11 further comprises an oligonucleotide probe having a sequence as defined in claim 11. Kit included. 13. Regions where species-specific probes consist of the mouth, blood, lung region and anogenital region Claims for bacteria commonly found in areas of the human body selected from the group Kit according to item 12. 14. Claim 11, wherein the oligonucleotide probe is a capture probe. Kit included. 15. Claim 11, wherein the oligonucleotide probe is a signal probe. The kit described in. 16. If the probe nucleic acid has minimal abnormalities in rRNA secondary structure, Hybridization with target sequences located in the ribosomal region available for hybridization 2. The method according to claim 1, wherein the method comprises forming a pad. 17. Hybridization with a target sequence where the above probe is located in an open region The method according to claim 1, which may be performed. 18. Claim 1, wherein the measurement omits any step of denaturing the target nucleic acid. the method of.