JPH05317097A - Method for detecting chlamydia - Google Patents

Abstract

PURPOSE:To obtain a new nucleotide having a basic sequence which is a part of main outer coat protein genes of Chlamydia, useful as a primer used in detection of microorganisms of the genus Chlamydia utilizing an amplifying method by a polymerase chain reaction. CONSTITUTION:A nucleotide having the sequence of the formula or a derivative obtained by carrying out at least one change comprising a change by removing 1 or 2 bases from the end on 5' side in the sequence of the formula or a change removing 1 or 2 bases from the end on 3' or change adding -T or -TA to the end and change replacing 1 or 2 bases other than both ends with other base selected from A, C, G and T. The nucleotide having sequence of the formula is obtained e.g. by synthesizing using a DNA synthesizer and then purifying with a high-performance liquid chromatography.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting and identifying a microorganism of the genus Chlamydia using polymerase chain reaction (PCR), a primer used therefor, and the above-mentioned PCR.
The amplification product of

[0002]

Chlamydia is a coccus-like microorganism, and the family Chlamydia includes the genus Chlamydia as a single genus, and this genus contains three species, namely Chlamydia trachomatis.
is), Chlamydia psittaci
And Chlamydia pneum
oniae) is included. They grow in the vacuoles of host cells and are associated with trachoma, inclusion body conjunctivitis, and familial lymphogranuloma.
(LGV), pneumonia, etc.

At present, the most reliable method for detecting the pathogen of chlamydia infection is the isolation culture method. However, this method has a drawback in that it takes several days to make a judgment and requires skill in operation and judgment. There is also a method using an enzyme immunoassay, but this has a problem of the presence of cross-reactivity with indigenous bacteria, and the sensitivity of the DNA hybridization method is not yet satisfactory. further,
None of the above methods was able to identify three species belonging to the genus Chlamydia.

Since the PCR method is capable of amplifying DNA at a high magnification, it has recently been used for detecting a very small amount of DNA. Regarding the nucleotide sequences of three outer membrane protein genes of Chlamydia, Nucleic Acids Research (Nucleic Acids Research)
Res. 17: 8366, 18: 1061, 3
414, 6136, FEMS Microbiology Letters, Vol. 42, 18
5-190, 55, 229-234, Journal of Bacteriology (J. Bacteriol.) 168.
Volume 1277-1282, Infection &
Immunity (Infect. Immun.) Volume 59 2195-2
199, pp. 2853-2855, Journal of General Microbiology (J. Gen. Microb
iol. ) 137, pp. 465-475.

[0005] The method of detecting Chlamydia using PCR is described in the Journal of Infectious Diseases, Vol. 65, 1183-1187.
Page and The Journal of Infectious Daisies, Vol. 162, Vol. 984-9
Although it is described on page 87, the former method cannot be applied to Chlamydia sittaci and Chlamydia pneumoniae (p. 1185, left column, lines 11-13), and the latter method is the result of using three kinds of primer pairs. There was the annoyance of comparing and identifying. The present invention has been made in order to provide a method for detecting and identifying Chlamydia without the above-mentioned drawbacks.

[0006]

That is, the present invention is
It provides the following: (1) The following array

[Chemical 3] (B) deleting 1 or 2 bases from the 5 ′ end, or (b) deleting 1 or 2 bases from the 3 ′ end in the nucleotide shown in -T or -TA is added to (c) 1 other than both ends
Alternatively, a derivative obtained by adding at least one modification of replacing two bases with another base selected from A, C, G and T. (2) The following array

[Chemical 4] 1 or 2 bases from the (5) 5'end of the nucleotide shown by or in the above sequence, or G at the end
-Or CG- is added, (e) 1 or 2 bases are deleted from the 3'side end, (f) 1 other than both ends is added.
Alternatively, a derivative obtained by adding at least one modification of replacing two bases with another base selected from A, C, G and T.

(3) A primer comprising the compound according to 1 or 2. (4) A base sequence by polymerase chain reaction, characterized in that the primer and the DNA polymerase described in (3) are added to a medium containing a major outer membrane protein gene of a microorganism of the genus Chlamydia, and a heat denaturation / annealing / extension cycle is applied. Amplification method. (5) A nucleotide which is an amplification product by the method described in (4). (6) A method for detecting an outer membrane protein gene of a Chlamydia genus microorganism, which comprises applying the amplification method according to (4) to a sample suspected of containing a Chlamydia genus microorganism and searching for a nucleotide that is an amplification product. .. (7) In addition, the amplification product nucleotides are digested with the restriction enzymes AluI, PvuII and Sau3AI and the products are compared with each other or with the digestion product of the amplification products obtained using the major outer membrane protein gene. A method for identifying a Chlamydia spp.

Among the nucleotides used as a primer in the present invention, the nucleotides of SEQ ID NO: 1 and SEQ ID NO: 2 are those of Clamydia trachomatis.
It is a part of the outer membrane protein gene of achomatis).
Chlamydia trachomatis has at least 15 serotypes (A, B, Ba, C, D, E, F, G, H, I, J,
K, L1, L2, L3) are known, but SEQ ID NO: 1
And the sequence of the sense strand of SEQ ID NO: 2 (antisense strand) (shown as SEQ ID NO: 3) is completely common to at least serotypes L2 and H, which is clear from a comparison of the sequence listing below. In the comparison table below, SEQ ID NO: 4 is a part of the outer membrane protein gene sequence of serotype L2, and SEQ ID NO:
5 is also a part of the H sequence.

[Chemical 5]

It goes without saying that these primers can anneal to the denatured outer membrane protein gene of Chlamydia trachomatis, but according to the invention, they are C. psittaci and Chlamydia pneumoniae (C. psittaci). It has been revealed that Pneumoniae can be annealed to the denatured outer membrane protein gene.
The following comparative table shows the relationship between the Chlamydia cyttacy A22 / M strain and the Chlamydia pneumoniae standard strain (isolated in the United States and subcultured). Incidentally, SEQ ID NO: 3 is Chlamydia trachomatis serotype L2 as in the above comparison table,
SEQ ID NO: 6 is Chlamydia sittaci A22 / M strain,
SEQ ID NO: 7 is a Chlamydia pneumoniae standard strain.

[Chemical 6]

[Chemical 7]

As is clear from these comparison tables, the sequence of Chlamydia sittaci corresponding to SEQ ID NO: 1 (shown in SEQ ID NO: 8) and the sequence of Chlamydia pneumoniae (shown in SEQ ID NO: 9) are There is one difference from the sequence of number: 1. According to the present invention, it has become clear that annealing can be carried out even when the one or two positions are different, and that it can be used as a primer. On the contrary, in SEQ ID NO: 1, the above (a), (b), (c)
And those with the changes shown in (d), (e) and (f) above to SEQ ID NO: 2
It was revealed that it can be annealed and can be used as a primer. Preferred primers are shown in SEQ ID NO: 1 or SEQ ID NO: 2 itself or with the modification of (C) or (F) or SEQ ID NO: 8 or SEQ ID NO: 9 (these sequences are the same). It is a thing. The primer can be synthesized by a method known in the art using, for example, a DNA synthesizer. The synthesized primer is preferably purified by a purification means such as high performance liquid chromatography.

The amplification of the base sequence by the PCR reaction is carried out by using, for example, an automatic amplification apparatus, in a suitable medium such as a buffer solution, the template DNA, each base, the primer and the DNA.
This can be done by methods known in the art such as subjecting the polymerase to a temperature conversion cycle. An example of a preferred method of implementation is as follows. (1) Add a reaction solution having the following composition to a 0.5 ml centrifuge tube. Preferably, mineral oil (eg Sigma M-35)
Cover with 16). (Composition) Sample containing template DNA 0.5 μM forward primer 0.5 μM reverse primer 10 mM Tris-HCl (pH8.3) 50 mM KCl 1.5 mM MgCl ₂ 0.001% gelatin 25-250 μM each dNTP 1 .25-2.5 unit DNA polymerase The above composition can be appropriately changed. For example, the magnesium concentration is preferably 0.5 to 2.5 mM above the total concentration of dNTPs. If the dNTP concentration is too high, the possibility that the DNA polymerase will take up the wrong dNTP increases. If the DNA polymerase is too high, non-specific products will increase, but if it is too low, the product yield will decrease. As the DNA polymerase, a thermostable one is preferable, and examples thereof include Perkin Elmer Cetus, Stratagene,
Taq DNA polymerase sold by New England Biolabs, etc. [obtained from Thermus aquaticus or expressed in E. coli] is suitable.

(2) The reaction solution is set in an automatic amplification device, and a cycle consisting of a heat denaturation step, an annealing step and an extension step is performed for 20 cycles or more, preferably 30 cycles or more. Thermal denaturation temperature is usually 90-95 ° C, annealing temperature is usually 40-60 ° C, extension temperature is usually 70-75.
C is suitable, but the annealing temperature depends on the length of the primer and the GC content. The annealing temperature is usually Tm ° C. [however, Tm ° C. = 4 × (G + C) + 2 × (A + T)] to Tm−20 ° C., preferably around Tm−5 ° C.
The heat denaturation time is preferably 20 seconds or longer, the annealing time is 20 seconds or longer, and the extension time is preferably 30 seconds or longer. An automatic amplification device is sold, for example, by Perkin Elmer Cetus.

Amplification products are shown in the comparison table (Chemical Formulas 5, 6
7), SEQ ID NOS: 1 to 3 (Chlamydia
Trachomatis), SEQ ID NOs: 8 to 3 (Chlamydia sititas) and SEQ ID NOs: 9 to 3 (Chlamydia pneumoniae), and their antisense strands, which are separated by, for example, agarose gel electrophoresis. Separated by means. In addition, the product is detected by the length of the band by comparison with the marker, but it can be confirmed by Southern hybridization using a labeled probe. Examples of the probe include SEQ ID NO: 10 and SEQ ID NO: 1 shown in the above comparison table.
1, SEQ ID NO: 12 can be used. As the label, ³² P, biotin, digoxigenin, etc. are used.
Experimental methods using these are described in the literature. The presence of the amplified product indicates the presence of the outer membrane protein gene of Chlamydia spp. Microorganisms and is therefore an indicator of the presence of the above-mentioned microorganisms.

Furthermore, according to the present invention, digestion of the amplified product with different restriction enzymes produces different digested products depending on the species of Chlamydia spp. Microorganisms, which makes it possible to distinguish between three types of microorganisms. For example, in the case of Chlamydia trachomatis, digestion of the product with AluI produces three fragments of 67, 85 and 88 bp, respectively, but two bands were observed on electrophoresis, of which the large band was two. It looks thick (or dark) due to overlapping fragments. In addition, it is not digested with PvuII and is digested with Sau3AI into two unequal fragments. Chlamydia
In the case of shittasy, it is digested with AluI and PvuII into two unequal fragments, respectively, and not with Sau3AI. Also, in the case of Chlamydia pneumoniae, it is digested with AluI and Sau3AI into two unequal fragments, respectively, and is not digested with PvuII. Therefore, these three species can be identified by observing the digestion pattern and fragments. In order to carry out the above-mentioned identification method or identification method, it is convenient to put together reagents and equipment necessary for the execution into a kit. Such a kit can include one selected from the following: (1) forward primer, (2) reverse primer, (3) buffer, (4) KCl, (5) MgCl ₂ , (6) gelatin, (7) 4 kinds of dNTPs, (8) DNA polymerase,
(9) Mineral oil, (10) Centrifuge tube, (11) Color reagent
(Eg ethidium bromide), (12) restriction enzymes (3 types),
etc. Examples of the sample include cells, tissues, mucous membranes, crushed materials thereof, mucus, blood, exudate, medium and the like.

[0015]

EXAMPLES Hereinafter, the present invention will be described more specifically by way of examples, but the examples do not limit the present invention. Example 1 (Synthesis of Primer) Using a model 391 PCR-MATE EP DNA synthesizer manufactured by Applied Biosystems Japan Co., Ltd., base binding and deprotection were performed according to the operator's manual of the company, and primer CM-1 (SEQ ID NO: 1) was used. ) And CM-2 (SEQ ID NO: 2) were synthesized.

Example 2 (Detection from Chlamydia-infected HeLa cells) Chlamydia-infected HeLa cells were peeled off with a rubber policeman, and Chlamydia EB was roughly purified by a Urographin ™ discontinuous density gradient method. The crude EB purified solution was used as a lysis buffer containing 10 μg / ml proteinase K [10 mM Tris · HCl (pH 8.0), 5 mM EDT].
A, 0.5% SDS], 55 ° C for 15 minutes, 37
The reaction was performed at 45 ° C for 45 minutes. After that, phenol / chloroform extraction was performed, ethanol precipitation was performed, and the buffer solution [10 m
Resuspended in M Tris.HCl (pH 8.0), 1 mMEDTA]. A part of the solution was used as a template DNA sample for the PCR reaction described in Example 3 to carry out the reaction.

Example 3 (PCR reaction) In order to detect three Chlamydia species, the pair primer CM-
1 (SEQ ID NO: 1) and CM-2 (SEQ ID NO: 2) were used. The PCR reaction is based on Takara Gene Amp (trademark) P
CR Reagent Kit, Amplitac ™ DNA Polymerase (TaKaRa GeneAmp ™ PCR Reagent)
Kit. This product was made using a Perkin-Elmer Cetus Instruments company). PC
As the R mixture, 1 x reaction buffer [10 mM Tris-H
Cl (pH 8.3), 50 mM KCl; 1.5 mM MgCl ₂ ,
0.001% gelatin], 250 μM each of dGTP and dA
TP, dTTP, dCTP, 0.5 μM CM-1 and CM-2, and 1.25 units of Taq DNA polymerase were added to make a total volume of 50 μl. As the template DNA, a Chlamydia culture or the solution of Example 4 described later was used. PC
The R temperature condition is 9 ° C. after a long denaturation process of 94 ° C. for 3 minutes.
Denaturation at 4 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, 72
Elongation at 60 ° C. was performed for 35 seconds for 35 cycles. After the final cycle, a long extension at 72 ° C was performed for 7 minutes. After completion of the PCR reaction, the PCR product was stored at 4 ° C. until analyzed.

Example 4 (Agarose Gel Electrophoresis) After the PCR reaction, a part of the reaction solution (PCR product) and 1/6 of the amount of 6 × gel loading buffer [0.25%
(w / v) bromophenol blue, 0.25% (w / v) xylene cyanol, 30% (v / v) glycerin], and
TAE [40 mM Tris Acetate, 1 mM EDTA]
2% agarose gel [NuSieve ™ 3:
1 agarose or Seachem ™ GTG agarose]
Loaded on. After electrophoresis [conditions: 100 V, electrophoresis for 15 to 20 minutes (Mupid-2 (trademark), Cosmo Bio)], the band was observed using a UV transilluminator, and a photograph was taken with a Polaroid camera. As a result of Chlamydia trachomatis, a band as shown in Fig. 1 was recognized. In addition, Chlamydia Sittacy Mn, IT
O, Fe / 145, Chlamydia pneumoniae TW-
183 (USA 98105 Washington, Seattle, Suite 322, N. Forty Fifth Street 1107, Washington Research)
It was also detectable as shown in FIG. 2 even when the electrophoresis was carried out as described above using (Distribution from Foundation).

Example 5 (identification of three types of Chlamydia) PCR products of three types of Chlamydia obtained in Example 3
It could be identified by digestion with species restriction enzymes. The restriction enzymes AluI, PvuII and Sau3AI were used. 10 µl of the PCR reaction solution was taken, a buffer solution for each enzyme was added, and the reaction was carried out at the optimum temperature (37 ° C). After that, 2 μl of 6 × gel loading buffer was added, and analysis was performed by electrophoresis. The results of this analysis are shown in Table 1.

[Table 1] AluI PvuII Sau3AI Chlamydia trachomatis ++ - + Chlamydia Shittashi + + - Chlamydia pneumoniae ++ +: be cut. -: Not cut. ++: Two bands are observed, one of which looks thick.

Sequence listing

SEQ ID NO: 1 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence: CAGGACATCT TGTCTGGCTT 20

SEQ ID NO: 2 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Antisense: Yes Sequence: CAAGGATCGG AAGGATCTCC 20

SEQ ID NO: 3 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia trachomatis strain name L2 sequence: GGAGATCCTT GCGATCCTTG 20

SEQ ID NO: 4 Sequence length: 245 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia trachomatis strain name L2 sequence: CAGGACATCT TGTCTGGCTT TAACTAGGAC GCAGTGCCGC CAGAAAAAGA TAGCGAGCAC 60 AAAGAGAGCT AATTATACAA TTTAGAGGTA AGAATGAAAA AACTCTTGAA ATCGGTGAGAGAGACGTGATCGATGATCGACTGACTGACTGACTGAGTGATCGATGATCGATGGACGA

SEQ ID NO: 5 Sequence length: 360 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia trachomatis strain name H sequence: CAGGACATCT TGTCTGGCTT TAACTAGGAC GCAGTGCCGC CAGAAAAAGA TAGCGAGCAC 60 AAAGAGAGCT AATTATACAA TCTTAGAGGT AAGAATGAAA AAACTCTTGA AATCGGTATT 120 AGTATTGACCGTTTGCAGCTCTCTCCAGCTCT CTCCCTGTCTTT GCCGA

SEQ ID NO: 6 Sequence length: 420 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia psittaci strain name A22 / M sequence: CAGGATATCT TGTCTGGCTT TAACTTGGAC GTGGTGCCGC CAGAAGAGCA AATTAGAATA 60 GCGAGCACAA AAAGAAAAGA TACTAGACAA TGATCGATCGATCGATCGCAGTCTCAGTCTCGATCTCAGTCTCAGTCTCAGCTTCGACTCTCTCCTCTAGCT

SEQ ID NO: 7 Sequence length: 300 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia pneumoniae strain name Standard Strain Sequence: CAGGATATCT TGTCTGGCTT TAATTTGGAC GTCGTGTCGC CAAAATATGA GTAATAGCGA 60 GCACATAAAT AAAAGATACT AAGCATAATC TTTAGAGGTGAGTA 240GTCGGCGTATCT TTATCCGCCTA CCTCCTCTCTAGCCTCCTTACAAG.

SEQ ID NO: 8 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia psittaci strain name A22 / M sequence: CAGGATATCT TGTCTGGCTT 20

SEQ ID NO: 9 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Fragment type: Intermediate fragment Origin: Biological name Chlamydia pneumoniae Strain name Standard strain sequence: CAGGATATCT TGTCTGGCTT 20

SEQ ID NO: 10 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: ATCGGTATTA GTGTTTGCCG CTTTGAGTTC 30

SEQ ID NO: 11 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: ATCGGCATTA TTGTTTGCCG CTACGGGTTC 30

SEQ ID NO: 12 Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: GTCGGCGTTA TTATCCGCCG CATTTGCTGG TTC 3
Three

[Brief description of drawings]

1 is a photograph of electrophoresis of Example 4 for Chlamydia trachomatis.

FIG. 2 is a photograph of the electrophoresis of Example 4 for Chlamydia sittaci and Chlamydia pneumoniae.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display area // (C12Q 1/68 C12R 1:01) (C12Q 1/04 C12R 1:01) (72) Inventor Hiroshi Yoshida 2-3-3 Morinomiya Morinomiya, Joto-ku, Osaka City, Osaka Fuso Yakuhin Kogyo Co., Ltd. Research and Development Center

Claims (7)

[Claims] 1. The following sequence: (B) deleting 1 or 2 bases from the 5 ′ end, or (b) deleting 1 or 2 bases from the 3 ′ end in the nucleotide shown in -T or -TA is added to (c) 1 other than both ends
Alternatively, a derivative obtained by adding at least one modification of replacing two bases with another base selected from A, C, G and T. 2. The following sequence: 1 or 2 bases from the (5) 5'end of the nucleotide shown by or in the above sequence, or G at the end
-Or CG- is added, (e) 1 or 2 bases are deleted from the 3'side end, (f) 1 other than both ends is added.
Alternatively, a derivative obtained by adding at least one modification of replacing two bases with another base selected from A, C, G and T. 3. A primer comprising the compound according to claim 1 or 2. 4. A polymerase chain reaction, characterized in that the primer and the DNA polymerase of claim 3 are added to a medium containing a major outer membrane protein gene of a Chlamydia genus microorganism, and a heat denaturation / annealing / extension cycle is applied. Nucleotide sequence amplification method. 5. A nucleotide which is an amplification product by the method of claim 4. 6. An outer membrane protein gene of a Chlamydia spp. Characterized in that the amplification method according to claim 4 is applied to a sample suspected of containing a Chlamydia spp. Detection method. 7. The amplification product nucleotides are further digested with the restriction enzymes AluI, PvuII and Sau3AI and the products are compared with each other or with the digestion product of the amplification products obtained using the major outer membrane protein gene. A method for identifying a Chlamydia spp.