JPH05192198A - Detection of nucleic acid - Google Patents

Abstract

PURPOSE:To provide a process for easily and quickly detecting the objective nucleic acid in high sensitivity. CONSTITUTION:A single-stranded nucleic acid complementary to the target nucleic acid to be detected is immobilized on an immobilization carrier to place the nucleic acid in a state free from the complementary chain to the single- stranded nucleic acid. The immobilized single-stranded nucleic acid is subjected to hybridization with the objective nucleic acid in a labeled specimen to detect the objective nucleic acid. The detection sensitivity of the nucleic acid can be improved by using a single-stranded nucleic acid containing plural sequences hybridizing with the objective nucleic acid as the single-stranded nucleic acid to be immobilized.

Description

Detailed Description of the Invention

[Background of the Invention]

FIELD OF THE INVENTION The present invention relates to a method for detecting nucleic acid.
More specifically, it is a method of detecting a target nucleic acid by immobilizing a single-stranded nucleic acid complementary to the target nucleic acid to be detected on a fixed carrier, and hybridizing this with the target nucleic acid in a labeled sample. It is a quick and easy method to mechanize.

[0002]

2. Description of the Related Art A basic hybridization method for detecting a specific base sequence of a nucleic acid is a solid hybridization method in which a nucleic acid adsorbed on a carrier is hybridized with a nucleic acid in a solution.
There are a liquid hybridization method and a liquid-liquid hybridization method for hybridizing nucleic acids in a solution [Anal. Biochem., 169, 1-25 (1988)]. To date, various improvements have been made to the above method in order to make the detection of nucleic acids simpler, faster, and more sensitive [Anal. Bioche
m., 169, 1-25 (1988)].

Among them, a method using a microplate originally used in the antibody field has been devised for the purpose of automating the operation of detecting nucleic acids (Japanese Patent Laid-Open No. 61-2).
19400). In this method, a double-stranded nucleic acid in a sample is denatured into a single strand, and the single strand is immobilized on a microplate by nonspecific adsorption in the presence of complementary strands. Therefore, there are those that return to double-stranded chains during fixation, or those that form double-stranded chains after fixation, and it is considered that the number of hybridizable hybrids in actual hybridization is considerably less than the immobilized DNA. In addition, DNA was originally used in such a fixing method.
The amount of adsorbed is relatively small, and detection sensitivity is insufficient for practical application.

As a capture probe for sandwich hybridization, a method of immobilizing polythymidylate on a microplate has been devised [Molecular
and Cellular Probes, 3, 189-207 (1989)]. This method can be said to be advantageous in that the amount of adsorption is predominantly larger than that in the case where four types of bases are mixed by immobilizing a polymer of thymidylic acid, which is more reactive than other nucleic acid bases in the photoreaction. However, the application of this method is limited to the sandwich hybridization that captures polyadenylic acid, and it is inevitable that the sensitivity inherent in the sandwich hybridization is complicated and the sensitivity is lowered due to the complexity of the system.

On the other hand, the recently developed nucleic acid amplification method is an epoch-making method that can increase the amount of a specific trace amount of gene by 100,000 times or more in a short time (PCR method: JP-A-61).
-274697). Then, a method has been devised for relatively easily detecting a point mutation of a human gene using the nucleic acid amplified by this method [Proc. Natl. Aca.
d. Sci. USA, 86, 6230-6234 (1989)]. This method is named reverse dot hybridization, and it is designed so that oligonucleotides complementary to the base sequence to be detected are chemically synthesized and polythymidylate is added to it by an enzymatic reaction to easily immobilize it on a nylon membrane. is doing. This method is excellent as an efficient method for immobilizing oligonucleotides on nylon membranes, but the method itself using nylon membranes is not suitable for mechanization of detection operation, and the preparation of immobilized probes is suitable for large-scale preparation. There are drawbacks such as not.

Each of the above methods has its own merits, but at the same time, it has drawbacks, and no method has yet been developed for realizing satisfactory simple, quick, and high sensitivity.

[Outline of the Invention]

DISCLOSURE OF THE INVENTION The present inventor has now found that a single-stranded nucleic acid containing a sequence complementary to a target nucleic acid is immobilized and the single-stranded nucleic acid is in a state in which a complementary strand to the nucleic acid does not exist. It was found that the target nucleic acid can be detected easily and quickly with high sensitivity by using the fixed carrier, and the present invention has been completed. Therefore, an object of the present invention is to provide a method capable of detecting a target nucleic acid simply and quickly with high sensitivity. Another object of the present invention is to provide a method for detecting a target nucleic acid which is easily mechanized.

[0008]

The method for detecting nucleic acid according to the present invention comprises the following steps (a) to (d). (A) A step of labeling the target nucleic acid to be detected. (B) A step of immobilizing a single-stranded nucleic acid capable of specifically hybridizing with a target nucleic acid on a fixed carrier so that a complementary strand to the single-stranded nucleic acid does not exist. (C) Target nucleic acid labeled in step (a) and step (b)
A step of carrying out a hybridization reaction with the single-stranded nucleic acid immobilized in. (D) A step of detecting the target nucleic acid by using the label existing in the target nucleic acid simultaneously with or after the step (c). According to the nucleic acid detection method of the present invention, a target nucleic acid can be specifically and highly sensitively and efficiently detected, and the detection operation can be speeded up, simplified, and mechanized.

[Detailed Description of the Invention] Target Nucleic Acid The "target nucleic acid to be detected" as used in the present invention includes a specific base sequence to be detected, and includes DNA and R
It may be either NA. Such nucleic acids to which the present invention can be applied can be prepared from all living organisms such as bacteria, viruses and higher animals and plants. In addition, the nucleic acid may or may not be purified when the detection method according to the present invention is applied. Further, in the method for detecting a nucleic acid according to the present invention, not only a nucleic acid obtained from the above-mentioned organism but also a nucleic acid obtained by amplifying the nucleic acid by a method described below, or a synthetic nucleic acid corresponding to the nucleic acid derived from this sample or A synthetic nucleic acid complementary to this nucleic acid may be used as the nucleic acid to be detected. Therefore, the target nucleic acid in the present invention is meant to include, in addition to the nucleic acid derived from the specimen to be detected, a synthetic nucleic acid corresponding to the nucleic acid to be detected derived from the specimen, and further a synthetic nucleic acid complementary to the nucleic acid. I will use it.

Nucleic Acid Detection Method Step (a): Target Nucleic Acid Labeling Step In the nucleic acid detection method of the present invention, the target nucleic acid to be detected is first labeled. As the labeling method, for example, a method of directly introducing a labeled substance into a target nucleic acid,
A method for synthesizing a nucleic acid corresponding to a target nucleic acid or a nucleic acid complementary to the target nucleic acid by using a labeled oligonucleotide primer, and a target nucleic acid using an oligonucleotide primer in the presence of a labeled unit nucleic acid. A specific example is a method of synthesizing a nucleic acid corresponding to a corresponding nucleic acid or a target nucleic acid.

As a method for directly introducing the labeled substance into the target nucleic acid of [1], a biotin derivative is introduced into the target nucleic acid by photoreaction, and detection is performed with streptavidin to which an enzyme is bound [Nu
cleic Acids Res., 13, 745 (1985)], a method of sulfonation of a target nucleic acid and detection using an enzyme-labeled anti-sulfonated antibody [Proc. Natl. Acad. Sci. USA, 81, 3466-3470 (198).
4)] and the like are preferable from the viewpoint of easy operation and quickness.

On the other hand, as the above-mentioned and methods, a method of amplifying a specific nucleic acid sequence [BIO / TECHNOLOGY, 8, 291]
(1990)] can be used. These methods have received particular attention in terms of amplifying the target nucleic acid, but not only that, but also in that they can relatively easily label a synthetic nucleic acid corresponding to the target nucleic acid or a synthetic nucleic acid complementary to the target nucleic acid. High utility value. For example, the PCR method [Science, 2
30, 1350-1354 (1985)], a labeled extension product or amplification product can be obtained by using a labeled primer or a labeled mononucleotide triphosphate. it can. In addition, an amplification method using Qβ replicase [BIO / TECHNOLOGY, 6, 119
7 (1988)], a labeled extension product or amplification product can be obtained by utilizing similarly labeled mononucleotide triphosphate. Also, in nucleic acid amplification methods other than those described above, the extension product or the amplification product can be labeled by labeling the mononucleotide triphosphate or the oligonucleotide incorporated by the extension reaction or the amplification reaction. The above method is particularly preferable in the present invention.

The labeling substance used here may be radioactive or non-radioactive as long as it can detect this substance after the hybridization operation. A non-radioactive labeling substance is preferable from the viewpoint of easiness of handling, storability, disposal, and the like, and the one which most effectively enjoys the effects of the present invention.

Examples of non-radioactive labeling substances include biotin, 2,4-dinitrophenyl group, haptens such as digoxigenin, fluorescein and its derivatives [eg fluorescein isothiocyanate (FITC)].
Etc.], rhodamine and its derivatives [eg, tetramethylrhodamine isothiocyanate (TRITC), Texas Red, etc.], 4-fluoro-7-nitrobenzofuran (NBDF) and fluorescent substances such as dansyl or chemiluminescent substances such as acridine. Can be mentioned. In the case of labeling the oligonucleotide with these, any known means (Japanese Patent Laid-Open Nos. 59-93098 and 59-930).
The labeling can be carried out by the method described in No. 99). Further, in the case of labeling nucleotide triphosphate, known means [Proc. Natl. Acad. Sci. USA, 80, 4045 (1983)
, JP-A-63-152364].
Commercial products can be used.

Step (b): Immobilization of single-stranded nucleic acid In this step, a single-stranded nucleic acid containing a sequence capable of specifically hybridizing with a target nucleic acid is immobilized on a fixed carrier, and as a result, this fixed single-stranded nucleic acid is immobilized. This is a step of leaving the strand nucleic acid in a state where there is no complementary strand to the single-stranded nucleic acid.

As the single-stranded nucleic acid in the present invention, when the single-stranded nucleic acid is DNA, for example, double-stranded nucleic acid denatured and complementary separated can be used [Nucleic
Acids Res., 13, 5457-5468 (1985)]. Alternatively, it may be synthesized using a DNA polymerase and separated from the template [Anal. Biochem., 162, 130-136 (1987)].
Furthermore, a single-stranded nucleic acid obtained from M13 phage into which the gene to be detected is integrated, or a phage-plasmid composite vector (for example, pUC118, pB
Single-stranded nucleic acid obtained from SM13 ⁺ , PUCf1, etc.) can also be used [Methods in Enzymology, 153,
3-34 (1987)]. When the single-stranded nucleic acid is RNA, not only naturally-occurring RNA but also those synthesized in vitro using RNA polymerase or the like may be used. When a base sequence other than the sequence specifically hybridizable with the target nucleic acid contained in these single-stranded nucleic acids is unfavorable for the hybridization reaction, the method of Messing et al.
thods in Enzymology, 101, part C, 20 (1983)].

According to another aspect of the present invention, it is preferable to use, as the fixed single-stranded nucleic acid, one having a plurality of sequences capable of hybridizing with the target nucleic acid therein. If there are many sequences that can hybridize with the target nucleic acid in the immobilized single-stranded nucleic acid, the hybridization time can be shortened and the gene can be detected rapidly. is there.

The single-stranded nucleic acid having a plurality of sequences capable of hybridizing with the target nucleic acid is, for example, the above-mentioned phage D.
NA or a composite vector of phage and plasmid,
It is preferable to use a single-stranded nucleic acid obtained by introducing multiple copies of a sequence capable of hybridizing with the target nucleic acid. In particular, it is preferable to use a single-stranded nucleic acid obtained from a vector into which 5 to 200 copies of a sequence capable of hybridizing with the target nucleic acid is introduced.

Further, when detecting a point mutation of a base sequence in a sample by hybridization, it is preferable that the sequence hybridizable with the target nucleic acid is relatively short.

Generally, the method described below is used to immobilize these single-stranded nucleic acids on the carrier, but depending on the immobilization method, high immobilization efficiency may not be expected. However, even in such a case, if a single-stranded nucleic acid containing a plurality of sequences hybridizable with the target nucleic acid is used for immobilization, a relatively large number of sequences hybridizable with the target nucleic acid can be immobilized. Is advantageous in that

Further, generally, when an oligonucleotide having a sequence capable of hybridizing with a target nucleic acid is bound to a carrier, a portion involved in fixing to the carrier loses freedom and cannot participate in hybridization.
It is known that the hybridization efficiency is lower than that in the solution. However, when a single-stranded nucleic acid prepared by using the above-mentioned single-stranded preparation vector is used, it is considered that there are a large number of hybridizable unit sequences that are not involved in immobilization on a carrier, and hybridization by immobilization. The decrease in efficiency is considered to be small, which is advantageous.

However, in the case of labeling using an extension reaction or amplification reaction and detecting the labeled product, the single-stranded nucleic acid to be immobilized has low homology with the primer used in the extension reaction or amplification reaction. Those are preferable. For example,
In the PCR method described above, the primer used for gene amplification is often present in the solution unreacted after the completion of the amplification reaction, and the sequence of the single-stranded nucleic acid is arranged so that the primer and the single-stranded nucleic acid do not hybridize. It is necessary to select Such caution applies to other gene amplification methods.

The carrier for immobilizing these single-stranded nucleic acids may be one that can non-specifically adsorb nucleic acid, or one that can introduce a functional group and can covalently bond the functional group and the nucleic acid. For example, any material and any shape can be used. Specific examples thereof include so-called polymer microplates, tubes, and beads. In particular, it is preferable to use a microplate because it is easy to mechanize.

As a method for immobilizing the above-mentioned single-stranded nucleic acid on these carriers, a chemical bonding method can be mentioned first [Nucl
eic Acids Res., 15, 5373-5390 (1987)]. A specific example of the method for immobilizing nucleic acid by chemical bonding is a method in which an amino group-introduced carrier and a nucleic acid are bonded to each other using a crosslinking agent such as glutaraldehyde. It is also effective to introduce a functional group (for example, a primary amino group by a transamination reaction) into the nucleic acid and bond it with the functional group introduced on the carrier by using an appropriate crosslinking agent.

Alternatively, the nucleic acid can be directly immobilized on the carrier by nonspecific binding such as adsorption. Especially when the carrier is a microplate, UV irradiation or MgCl 2
It is possible to increase the adsorption efficiency by adding ₂ (JP-A 61-219400). Furthermore, a method of chemically binding or nonspecifically adsorbing the nucleic acid and the protein by an appropriate method and immobilizing the protein by utilizing the nonspecific adsorption of the protein and the carrier is also effective.

As described above, the single-stranded nucleic acid is immobilized on the immobilization carrier, whereby a state where there is no complementary strand to the single-stranded nucleic acid is realized.

Step (c): Hybridization reaction In this step, the target nucleic acid labeled in step (a) and the single-stranded nucleic acid immobilized in step (b) are subjected to a hybridization reaction.

The conditions for the hybridization reaction may be appropriately selected and determined depending on the combination of the target nucleic acid and the single-stranded nucleic acid immobilized on the carrier. For example, the hybridization reaction in this step can be basically performed in the same manner as conventional hybridization using a membrane [BD Hames and SJ Higgins, Nucleic.
Acid Hybridization, A Practical Approach, IRL Pre
ss (1985)].

In some carriers, non-specific adsorption to nucleic acids may be weak depending on the hybridization conditions. In such a case, the operation of prehybridization reaction can be omitted. The solution composition of hybridization may also be simplified for the same reason.
Furthermore, since the immobilized single-stranded nucleic acid may be liberated when the hybridization reaction is carried out for a long time, it is preferable that the conditions for the hybridization reaction can be shortened as much as possible.

The washing operation after the hybridization reaction can be carried out almost in the same manner as the conventional method. in this case,
Considering the simplicity of the operation, it is preferable that the conditions are such that excess reagents can be removed at room temperature as much as possible.

However, when detecting a point mutation, the washing conditions must be carefully examined. In such a case, conditions that depend only on the length of the complementary portion and not on the base composition [Nucleic Acids Res., 1
6, 4637-4650 (1988)].

Step (d): Detection step This step is a step of detecting the target nucleic acid using the label present on the target nucleic acid at the same time as or after the step (c).

The detection operation in this step may be appropriately selected and determined according to the type of the label present in the target nucleic acid.

Here, when the label present in the target nucleic acid is directly detectable, that is, when the label is, for example, a radioisotope, a fluorescent substance, a dye, etc., the labeled nucleic acid is bound to the solid phase. The detection operation is performed, or after the label is bound to the nucleic acid or released from the nucleic acid in the state where the label is cleaved from the nucleic acid, the detection operation is performed by a method according to the label. In addition, when the label is indirectly detectable, that is, when the label is a ligand for a specific binding reaction such as biotin or hapten, a direct signal is used, as is generally used for their detection. The detection operation is carried out using a receptor (for example, avidin or an antibody) to which an enzyme that catalyzes a reaction that generates a label or a signal that generates a signal is bound. In addition, these receptors may be added in advance in the step (c), in which case a part of the detection step, that is, the specific binding reaction between the ligand and the receptor is performed at the same time as the step (c). The whole process can be further simplified.

[0035]

【Example】

[Experimental Examples] The present invention will be described in more detail by the following experimental examples, but the present invention is not limited to these experimental examples. In addition, the genetic engineering method in the following experimental examples is based on the molecular cloning No. 2 of Maniatis et al.
Edition [Cold Spring Harbar Laboratory Press (1989)]. For oligonucleotides, an automated synthesizer model 381A manufactured by Applied Biosystems was used, and a general method [Oligonucleotide Synthesis, IRLPr
ess (1984)] and used after deprotection and purification. In addition, a biotin-labeled oligonucleotide has aminolink II (trademark) (manufactured by Applied Biosystems) added at the end of oligonucleotide synthesis to introduce an amino group, and is described in US Pat. No. 4,849,336. Obtained by reacting with biotin succinimide ester according to the method.

Experimental Example 1 Preparation of single-stranded DNA for immobilization To obtain a linear single-stranded DNA, the method of Messing et al. [Methods in Enzymology, 101, Part C, 20 (1983)]
Was used. That is, the chemically synthesized DNA shown in FIG.
The fragment was inserted between the EcoRI and HindIII cleavage sites of plasmid pBSM13 ⁺ (manufactured by Stratagene) to obtain plasmid pUPPO1. Next, a 1.8-kilobase fragment containing E6 and E7 of the human papillomavirus 16 gene was inserted into the HincII cleavage site of this plasmid to obtain plasmid pUPPHP16.
Escherichia coli NM522 was transformed with the obtained plasmid,
Using the helper phage M13K07, single-stranded DNA was prepared according to a conventional method [Methods in Enzymology,
153, 3-34 (1987)]. Furthermore, the obtained single-stranded DNA
Restriction enzyme EcoRI or B
It was cut with amHI.

Experimental Example 2 Immobilization of Single-Stranded DNA on Plate The single-stranded DNA obtained in Experimental Example 1 was treated with 10 mM Tris.
・ HCl pH 7.6, 100 ng / in 1 mM EDTA solution
μl concentration, and 4 volumes of H ₂ O and 5 volumes of immobilization buffer (1.5 M NaCl, 0.3 M Tri).
s.HCl pH8.0, 0.3M MgCl2) was added and mixed, and a microplate (Dynatech, Immulon 2) was added.
, Removawell strips, No. 011-010-6302), 100 μl per well. The plate was covered and left at 37 ° C. for 16 hours. After that, remove the liquid, 37 ℃
After air-drying for 30 minutes at room temperature, Stratalinker ™ 2400
(Manufactured by Stratagene) was irradiated with light of 500,000 μJ. After irradiation with light, wash buffer (1M N
aCl, 2 mM MgCl ₂ , 0.1M Tris · HC
1 pH 9.3, 0.1% Tween 20: 200 μl) was washed 3 times. The plate was placed in a vinyl bag, sealed, and stored at 4 ° C.

Experimental Example 3 Hybridization and Detection in Plate On the plate on which the single-chain NDA containing the human papillomavirus 16 gene obtained in Experimental Example 2 was fixed, a hybridization solution (5 × SSC, 5 × Denhardt's solution, 0) was added. ．
2% SDS, 200 μg / ml, salmon sperm DNA: 100
μl / well), and as a probe, a biotin-labeled oligonucleotide (Bio-ATTGTAAT) complementary to a part of the gene of human papillomavirus 16 described above.
GGGCTCTGTCCG, 20 ng / well),
It was kept warm at 55 ° C for 30 minutes. The hybridization solution was removed, and the wells were washed 3 times with 2 × SSC (200 μl / well). Add streptavidin-alkaline phosphatase solution (streptavidin-alkaline phosphatase from BRL) to 0.1M Tris-HCl.
pH 7.5, 0.3 M NaCl, ₂ mM MgCl ₂ , 0.
Diluted 1/105 with 05% (v / v) Triton X-100: 100μ
1 / well) was added and shaken at 23 ° C. for 10 minutes. Remove the reaction solution and wash (0.1M Tris-HCl pH
7.5, 0.3 M NaCl, 2 mM MgCl ₂ , 0.
05% (v / v) Triton X-100: 200 μl / well) 3
Washed twice. After washing, p-nitrophenyl phosphate solution (1M diethanolamine pH 9.8, 0.5 mM MgC
L ₂ : 4 mg / ml: 100 μl / well) and add 23 ° C.
After reacting for 1 hour, the absorbance was measured at 405 nm. The results are shown in Table 1.

Table 1 Absorbance (405 nm) Human papilloma gene-containing plate 1.34 Single-stranded DNA-immobilized plate Human papilloma gene-free plate 0.13 Single-stranded DNA-immobilized plate DNA unimmobilized plate 13 The numerical values in Table 1 are the values obtained by subtracting the background due to the substrate at the absorbance of 405 nm.

Experimental Example 4 Effect of UV Irradiation on Immobilization of DNA on Plate The plasmid pUPPHP16 obtained in Experimental Example 1 and the single-stranded DNA obtained from it were cleaved with EcoRI to give a linear form. Each was fixed to a plate in the same manner as in Experimental Example 2. However, in the case of immobilizing the double-stranded DNA, it was heat-denatured before being mixed with the immobilization buffer. Then, two types of plates were prepared, one that was irradiated with UV and the other that was not irradiated, as in Experimental Example 2. Using the above plates, as in Experimental Example 3, Bio-ATTGT was used.
The hybridization ability of the plate was examined using AATGGGCTCTGTCCG. The results are as shown in Table 2.

Table 2 UV irradiation No UV irradiation Double-stranded DNA 0.51 0.48 Single-stranded DNA 1.58 0.56 The numerical values in Table 2 are obtained by subtracting the background due to the substrate at the absorbance of 405 nm. It is a value.

Experimental Example 5 High-strength after single-stranded DNA and double-stranded DNA were immobilized on a plate
Comparison of Hybridization Ability The single-stranded DNA and the denatured double-stranded DNA were compared with each other for the hybridization ability after plate immobilization.
Single-stranded DNA and double-stranded DNA were prepared in substantially the same manner as in Experimental Example 4. However, the single-stranded DNA was fixed in a circular shape. According to Experimental Example 2, 1 μg per well, 10
Immobilization was performed by adding 0 ng and 10 ng of DNA. Experimental example 3
Bio-ATTTGTAATGGGG according to the method shown in
The hybridization ability of each plate was examined using CTCTGTCCG as a probe. The result is shown in Figure 2.
(The measurement of the absorbance at 405 nm is
This was done with a microplate reader).

Experimental Example 6 Labeling by gene amplification method and detection of its product
Detection of mutation In order to detect the human β-globin gene, genes corresponding to codons 2 to 11 were chemically synthesized and inserted into the HincII site of plasmid pUCf1 (FIG. 3).
The same operation was performed for both the normal gene (βA) and the point mutation gene (βS) that causes β-thalassemia. A single-stranded DNA was prepared by selecting one of the obtained clones from which a single-stranded DNA of the sense strand was obtained. The obtained single-stranded DNA was fixed to the plate in a circular shape according to Experimental Example 2.

Next, a gene amplification reaction was performed. The reaction is
GeneAmp ™ from Cetus was used and the protocol was followed. The primer used was 5'ACACACACTGTGTGTTCACTAGC and Biotin-labeled Bio-CAACTTCATCCACGTTCACC, and the β-globin gene P was used as a template.
4.4 kilobase fragment obtained by stI digestion [Hemo
globin, 13, 657-670 (1989)] was used.

After gene amplification, a part of the reaction solution was taken, denatured by heat, and then hybridization was detected in the same manner as in Experimental Example 3. The results are as shown in Table 3 (measured values are obtained by a microplate reader).

Table 3 Absorbance (405 nm) βA-immobilized plate 0.432 βS-immobilized plate 0.288 β-globin-free 0.037 DNA-immobilized plate

Experimental Example 7 Preparation of single-stranded DNA containing repeating oligonucleotides
A part of E7 gene of manufacturing human papillomavirus 16 was chemically synthesized, it was prepared single-stranded DNA containing repetition of the unit sequence by the method shown in FIG.

First, two kinds of oligonucleotides as shown in FIG. 4 were chemically synthesized, and their 5'ends were phosphorylated using polynucleotide phosphatase and ATP. Next, these two kinds of oligonucleotides are mixed to form a double strand,
The double-stranded fragments were ligated together using T4 DNA ligase, and then E. coli DNA polymerase I
A blunt end was prepared using the Klenow fragment of E. coli and four types of deoxynucleotide triphosphates. The reaction product was subjected to 6% polyacrylamide gel electrophoresis, and the portion corresponding to 270 base pairs was excised to recover DNA.

Next, a plasmid pUC-Sfi × 2 (Japanese Patent Laid-Open No. 190194/1990) was cleaved with a restriction enzyme BamHI to remove the phosphate at the 5'end with alkaline phosphatase to prepare a plasmid. This was ligated with DNA previously recovered from polyacrylamide gel using T4 DNA ligase, and E. coli JM109 was transformed with the ligated DNA. The desired clone was selected by the ampicillin resistance selection marker in the plasmid, the obtained plasmid pUC-Sfi27x was cleaved with the restriction enzyme SfiI, and the portion containing the repeating sequence was purified and recovered by electrophoresis. Further, this fragment was self-ligated using T4 DNA ligase to obtain plasmid pUC119S [pUC1
SfiI linker (NEB at the BamHI cleavage site of 19
Company: # 1138) inserted] restriction enzyme SfiI
Inserted into the site. Clones having different numbers of unit sequences depending on the degree of self-binding can be obtained. In this experiment, clones in which the number of inserted unit sequences was 9, 14, 64, 165 were obtained.

Experimental Example 8 Effect of probe in which oligonucleotide was repeatedly inserted Single-stranded DNA was prepared in the same manner as in Experimental Example 1 from each of the clone obtained in Experimental Example 7 and the clone having one unit sequence separately prepared. Was prepared and fixed on a microplate in the same manner as in Experimental Example 2.

Next, the following two types of primers labeled with biotin, Bio-GCAACCAGAGCACAACTGATC Bio-ATTGTAATGGGGCTCTGTCCG, were used to produce E7 of papillomavirus 16 (HPV16).
A gene amplification reaction was carried out as follows using a plasmid containing the gene as a template.

10 ng of the plasmid pUPPHP16 (see Example 1) and 100 ng of each primer were added to Ge of Cetus.
The neAmp ™ reagent was added according to the protocol to bring the total volume of the reaction solution to 100 μl. The reaction solution was heated at 95 ° C. for 5 minutes in a thermal cycler manufactured by Perkin Elmer Cetus to denature the DNA, and then AmpliTaq (trademark) was added thereto.
Add 2.5 units, 72 ℃ 60 seconds, 94 ℃ 30 seconds,
A cycle of 30 seconds at 50 ° C. was repeated 30 times.

A part of this reaction solution (5 μl diluted 10-fold with water) was heat-denatured, and the previously prepared single-stranded DNA-immobilized microplate was prepared under the same conditions as in Experimental Example 3. Was used for hybridization and the absorbance was measured.

The obtained results are as shown in FIG. As is clear from this figure, when the unit sequence was 64 or 165, the sensitivity was about 20 times higher than when the unit sequence was one.

Experimental Example 9 Rapid and Simple Detection of Human Papillomavirus 16 Gene In order to further facilitate the hybridization in this method, the composition of the hybridization solution, the hybridization temperature and the color development time were examined. Human papillomavirus 1 under controlled conditions
Detection of 6 genes was performed.

As a positive sample, 10 ng of DNA extracted from caustic cells, and as a negative sample of 10 ng of DNA extracted from human peripheral blood were used as templates to perform P in the same manner as in Experimental Example 8.
Gene amplification was performed by the CR method. The obtained reaction solution is
Hybridization was carried out by adding the unit oligonucleotide prepared in Experimental Example 8 to the microplate on which the single-stranded DNA having a repetition number of 1 and the single-stranded DNA having a repetition number of 64 were immobilized, respectively. That is, hybridization solution (5 x S
SC, 0.2% SDS) (100 μl) and the above PCR reaction solution (5 μl) were added, hybridization was performed at 37 ° C. for 30 minutes, the hybridization solution was removed, and the plate was washed 3 times with 200 μl of a washing solution (2 × SSC). ..

In addition to this, streptavidin-alkaline phosphatase solution (streptavidin-BRL-
Alkaline phosphatase 0.1M Tris-HC
pH 7.5, 0.3 M NaCl, 2 mM MgCl ₂ ,
Diluted 1/1000 with 0.05% (v / v) Triton X-100: 10
0 μl / well) was added, and the mixture was shaken at 23 ° C. for 10 minutes. Remove the reaction solution and wash (0.1M Tris-HC
pH 7.5, 0.3M NaCl, 2mM MgC
_{l 2, 0.05% (v /} v) Triton X-100: were washed 3 times with 200 [mu] l / well). After washing, p-nitrophenyl phosphate solution (1M diethanolamine pH 9.8, 0.5 mM
(MgCl ₂ : 4 mg / ml: 100 μl / well) was added and the mixture was reacted at 23 ° C. for 20 minutes, and the absorbance was measured at 405 nm. The results are as shown in Table 4. As is apparent from this table, even if the operation method was simplified, 64 unit sequences were inserted, and it was possible to significantly distinguish between positive and negative.

Table 4 \ Plate unit oligonucleotides Unit oligonucleotide sample \ 1 64 Positive sample 0.04 0.73 (Caski cell derived) Negative sample 0.00 0.02 (Normal person derived) * The numerical value is the absorbance at 405 mm Subtracted background due to substrate.

Experimental Example 10 Detection of mutation in HLA-DRB gene The following two biotin-labeled primers [GLPDR
B1: Corresponding to amino acids 17 to 23 of HLA-DRB, GAMPDRB1: Corresponding to amino acids 87 to 94 of HLA-DRB, J. Exp. Med., 169, 226
3-2267 (1989)] Bio-TTCTTCAATGGGACGGAGCG Bio-GCCGCTGCACTGTGAAGCTCT
Genes were amplified by PCR using C in the same manner as in Experimental Example 8 using 1 μg of DNA extracted from human peripheral blood as a template. The unit sequences (probes 1, 2, and 3) as shown in FIG. 6 were repeatedly bound in the same manner as in the method shown in Experimental Example 7 and fixed on the plate.
Probe 1 is completely complementary to genotype DR4 and probe 2 is genotype DR4 / DW 10 and DRW 13
Completely complementary to (Fig. 6). The probe 3 is common to all genotypes. Probe 1 and probe 2 had 50 unit oligonucleotides, and probe 3 had 10 unit oligonucleotides.

The reaction cycle for gene amplification is 3 at 94 ° C.
0 second, 50 ° C. for 30 seconds and 72 ° C. for 60 seconds were repeated 30 times. In the same manner as in Experimental Example 3, 5 μl of the obtained reaction solution was added to the plate on which the probe 1, probe 2 and probe 3 were immobilized, and hybridization detection was performed. However, hybridization was performed at 60 ° C. for 1 hour, and color development was performed at 23 ° C. for 1 hour.

The results are shown in Table 5. Both probe 1 and probe 2 show high absorbance in a type that is considered to have high sequence homology, and the results indicate that the present invention is effective for HLA gene typing.

[0062]Table 5 Sample Genotype Probe 1 Probe 2 Probe 3 1 DR4 / Dw15, DR9 7.5 * 0.12 10.1 * 2 DR4 / Dw15 13.7 * 0.18 9.0 * 3 DRw13, DRw14 0.35 6.6 * 17.8 * 4 DR9, DRw13 1.5 1.5 * 10.0 * 5 DRw8 / Dw8.3, DR9 6.9 0.17 12.1 * 6 DRw14 0.37 0.19 18.0 * 7 DR2 0.67 1.10 15.3 * *: The probe is assumed to be perfectly complementary. **: Numerical value is the absorbance at 405 mm and the background color is based on the substrate.
And the absorbance is 2 or more.
In that case, the value measured after dilution was converted into the value of the stock solution.

[0063]

[Sequence list]

SEQ ID NO: 1 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence features 5'Terminal A with a spacer Sequence with biotin bound via ATTGTAATGG GCTCTGTCCG 20

SEQ ID NO: 2 Sequence length: 22 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ACACAACTGT GTGTTCACTA GC 22

SEQ ID NO: 3 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence Features 5'terminal C with a spacer Sequence bound by biotin via CAACTTCATC CACGTTCACC 20

SEQ ID NO: 4 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence features 5'End G with a spacer Sequence bound by biotin via GCAACCAGCG ACAACTGATC 20

SEQ ID NO: 5 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence features 5'Terminal with a spacer Sequence bound by biotin via TTCTTCAATG GGACGGAGCG 20

SEQ ID NO: 6 Sequence length: 22 Sequence type: Nucleic acid Number of strands: Single-strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence features 5'End G with a spacer Sequence bound by biotin via GCCGCTGCAC TGTGAAGCTCG TC 22

SEQ ID NO: 7 Sequence length: 40 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CAGCTGAATT CGGATCCGTC GACGGATCCG AATTCAGCTG 40

SEQ ID NO: 8 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence CACCTGACTC CTGAGGAGAA GTCTGCCGTT 30

SEQ ID NO: 9 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CACCTGACTC CTGTGGAGAA GTCTGCCGTT 30

SEQ ID NO: 10 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AGGTATGAGC AATTAAATGA CAGCTCA 27

SEQ ID NO: 11 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence ACCTTGAGCT GTCATTTAAT TGCTCAT 27

SEQ ID NO: 12 Sequence length: 300 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Human (Homo sapiens) Sequence characteristics human leukocyte some sequences of the antigen (HLA) DR gene GGGGACACCC GACCACGTTT CTTGTGGCAG CTTAAGTTTG AATGTCATTT CTTCAATGGG 60 ACGGAGCGGG TGCGGTTGCT GGAAAGATGC ATCTATAACC AAGAGGAGTC CGTGCGCTTC 120 GACAGCGACG TGGGGGAGTA CCGGGCGGTG ACGGAGCTGG CGCGGCCTGA TGCCGAGTAC 180 TGGAACAGCC AGAAGGACCT CCTGGAGCAG AGGCGGGCCG CGGTGGACAC CTACTGCAGA 240 CACAACTACG GGGTTGGTGA GAGCTTCACA GTGCAGCGGC GAGTTGAGCC TAAGGTGACT 300

SEQ ID NO: 13 Sequence length: 300 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Human (Homo sapiens) Sequence characteristics human leukocyte some sequences of the antigen (HLA) DR gene GGGGACACCC GACCACGTTT CTTGGAGCAG GTTAAACATG AGTGTCATTT CTTCAACGGG 60 ACGGAGCGGG TGCGGTTCCT GGACAGATAC TTCTATCACC AAGAGGAGTA CGTGCGCTTC 120 GACAGCGACG TGGGGGAGTA CCGGGCGGTG ACGGAGCTGG CGCGGCCTGA TGCCGAGTAC 180 TGGAACAGCC AGAAGGACCT CCTGGAGCAG AAGCGGGCCG CGGTGGACAC CTACTGCAGA 240 CACAACTACG GGGTTGGTGA GAGCTTCACA GTGCAGCGGC GAGTCTATCC TGAGGTGACT 300

SEQ ID NO: 14 Sequence length: 300 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Human (Homo sapiens) Sequence characteristics human leukocyte some sequences of the antigen (HLA) DR gene GGGGACACCC GACCACGTTT CTTGGAGCAG GTTAAACATG AGTGTCATTT CTTCAACGGG 60 ACGGAGCGGG TGCGGTTCCT GGACAGATAC TTCTATCACC AAGAGGAGTA CGTGCGCTTC 120 GACAGCGACG TGGGGGAGTA CCGGGCGGTG ACGGAGCTGG CGCGGCCTGA TGCCGAGTAC 180 TGGAACAGCC AGAAGGACAT CCTGGAAGAC GAGCGGGCCG CGGTGGACAC CTACTGCAGA 240 CACAACTACG GGGTTGTGGA GAGCTTCACA GTGCAGCGGC GANNNNNNNN NNNNNNNNNN 300

SEQ ID NO: 15 Sequence length: 300 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Human (Homo sapiens) Sequence characteristics human leukocyte antigen (HLA) partial sequence of the DR genes GGGGACACCA GACCACGTTT CTTGGAGTAC TCTACGTCTG AGTGTCATTT CTTCAATGGG 60 ACGGAGCGGG TGCGGTTCCT GGACAGATAC TTCCATAACC AGGAGGAGAA CGTGCGCTTC 120 GACAGCGACG TGGGGGAGTT CCGGGCGGTG ACGGAGCTGG CGCGGCCTGA TGCCGAGTAC TGGAACAGCC AGAAGGACAT CCTGGAAGAC GAGCGGGCCG CGGTGGACAC CTACTGCAGA CACAACTACG GGGTTGTGGA GAGCTTCACA GTGCAGCGGC GAGTCCATCC TAAGGTGACT

SEQ ID NO: 16 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence TACTTCTATC ACCAAGAGAA 20

SEQ ID NO: 17 Sequence length: 18 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GAAGACGAGC GGGCCGCG 18

SEQ ID NO: 18 Sequence length: 18 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGCAGACACA ACTACGGG 18

[Brief description of drawings]

FIG. 1 is a diagram showing a method for constructing an improved vector for preparing a linear single-stranded DNA and a method for preparing the single-stranded DNA.

FIG. 2 is a diagram showing a comparison result of hybridization efficiencies of single-stranded DNA and double-stranded DNA immobilized on a microplate.

FIG. 3 is a diagram showing a nucleotide sequence inserted into an immobilized single-stranded DNA preparation vector in detecting β-thalassemia point mutation.

FIG. 4 shows a method for preparing a plasmid vector that repeatedly contains a unit sequence complementary to the human papillomavirus 16 gene.

FIG. 5 is a diagram showing a relationship between the number of unit sequences of immobilized probes and sensitivity.

FIG. 6 shows the sequence of each type of HLA-DB gene and the sequence of the probe used in the present invention.

Claims (4)

[Claims] 1. A method for detecting a nucleic acid, which comprises the following steps (a) to (d): (A) A step of labeling the target nucleic acid to be detected. (B) A step of immobilizing a single-stranded nucleic acid capable of specifically hybridizing with a target nucleic acid on a fixed carrier so that a complementary strand to the single-stranded nucleic acid does not exist. (C) Target nucleic acid labeled in step (a) and step (b)
A step of carrying out a hybridization reaction with the single-stranded nucleic acid immobilized in. (D) A step of detecting the target nucleic acid by using the label existing in the target nucleic acid simultaneously with or after the step (c). 2. The method for detecting a nucleic acid according to claim 1, wherein the target nucleic acid labeled in the step (a) is a synthetic nucleic acid corresponding to the nucleic acid derived from the specimen or a synthetic nucleic acid complementary to the nucleic acid derived from the specimen. 3. The detection of nucleic acid according to claim 1 or 2, wherein the single-stranded nucleic acid immobilized in the step (b) comprises a plurality of sequences capable of specifically hybridizing with the target nucleic acid. Law. 4. The single-stranded nucleic acid immobilized in the step (b) has 5 to 20 sequences capable of specifically hybridizing with the target nucleic acid.
The method for detecting a nucleic acid according to claim 1 or 2, which comprises 0 nucleic acids.