JPH05168479A - Variant neutral protease ii - Google Patents

Abstract

PURPOSE:To provide a new variant neutral protease remarkably lowered in the thermal stability. CONSTITUTION:A variant neutral protease II in which cysteine is substituted with an amino acid not having a SH group in the amino acid sequence of the neutral protease II of Aspergillus oryzae. For example, a variant neutral protease II in which cysteine units at the 6-position and/or the 78-position of the amino acid sequence of the neutral protease II of Aspergillus oryzae are substituted with a neutral amino acid having no SH group (e.g. alanine, serine). A variant neutral protease II CDNA is produced by the site-specific mutation of a neutral protease II CDNA originated from the Aspergillus oryzae, and a microorganism belonging to the genus Saccharomyces is used as a host to produce the variant neutral protease II.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a mutant neutral protease II, the gene, a novel recombinant DNA, and a method for producing the mutant neutral protease II.

[0002]

2. Description of the Related Art It is known that when soy sauce is added to a kneaded product such as kamaboko or ham, the kneaded product is fragile. The cause is considered to be that the heat-resistant protease contained in soy sauce that does not inactivate even after burning decomposes the protein contained in the kneaded product. Attempts have been made to reduce proteases (JP-A-2-131554). However, removal of heat-resistant protease in soy sauce by these methods is accompanied by an increase in manufacturing cost due to modification of the brewing process. Therefore, it is considered possible to provide a low-cost soy sauce for adding a kneaded product by producing a soy sauce containing no heat-resistant protease by directly modifying a soy sauce brewing microorganism.

This heat-resistant protease is generally considered to be a neutral protease II produced by Aspergillus oryzae [Aspergillus oryzae] or Aspergillus sojae]. Therefore, the present inventors previously conducted various studies on the neutral protease II gene derived from Aspergillus oryzae, performed the isolation and structure determination of the neutral protease II cDNA for the first time, and further analyzed the gene of Saccharomyces cerevisiae.
(Saccharomyces cerevisiae) was successfully secreted and produced, and patents for these were filed
(JP-A-3-198779).

[0004]

However, it is difficult to provide a low-cost soy sauce for addition of a kneaded product containing no heat-resistant protease based only on such knowledge. Then, this invention makes it a subject to establish the genetic engineering method for the purpose of developing the said low cost soy sauce for adding paste products.

More specifically, from the nucleotide sequences already disclosed in the above patent application, it is presumed that cysteine residues are present at 6 positions on the primary sequence of the neutral protease II derived from Aspergillus oryzae. In the above, the present inventor confirmed from the results of the preliminary test that such neutral protease II has no free SH group. Based on this, it was then found that there would be three disulfide bonds in the neutral protease protein molecule, which are generally considered to increase the thermal stability of the protein.

Therefore, the present inventor has found that the neutral protease
By removing at least one of the six cysteine residue portions presumed to be contained in II with an amino acid that does not have an SH group and is similar in size to the cysteine residue, the disulfide bond can be removed. , The neutral protease II
By analogy with the fact that the thermostability of A. can be reduced, the object was to provide a neutral protease II having this property.

[0007]

Means for Solving the Problems As a result of intensive studies for solving the above-mentioned problems, the present inventor used a neutral protease II cDNA derived from Aspergillus oryzae Neutral Protease II encoding an amino acid sequence in which a cysteine-free amino acid has been substituted in the amino acid sequence of sex protease II
When a cDNA was obtained and a mutant neutral protease II was produced using a microorganism belonging to the genus Saccharomyces as a host, the mutant neutral protease II was significantly reduced in heat stability as compared with the wild-type neutral protease II. The present invention has been completed by finding out that the above can be obtained.

That is, the present invention is a mutant neutral protease II characterized in that in the amino acid sequence of Aspergillus flavus neutral protease II, cysteine is substituted with an amino acid having no SH group. A mutant neutral protease II characterized in that in the amino acid sequence of neutral protease II, cysteine at position 6 and / or 78 is substituted with an amino acid having no SH group,
Also, in the amino acid of Aspergillus flavus neutral protease II,
It is a mutant neutral protease II gene encoding an amino acid sequence in which cysteine is substituted with an amino acid having no SH group, and in the amino acid sequence of Aspergillus niger neutral protease II, cysteine has an amino acid having no SH group. A novel recombinant DNA characterized in that a mutant neutral protease II gene encoding a substituted amino acid sequence is inserted into vector DNA, and the present invention further relates to the amino acid sequence of Aspergillus niger neutral protease II. Mutant Neutral Protease Encoding an Amino Acid Sequence in which cysteine is substituted with an amino acid that does not have an SH group
II gene, containing a recombinant DNA inserted into the vector DNA, culturing a microorganism belonging to the genus Saccharomyces having a mutant neutral protease II-producing ability in a medium, and collecting the mutant neutral protease II from the culture. The present invention provides a method for producing a characteristic mutant neutral protease II.

The present invention will be described in detail below. The present invention essentially requires the use of a gene in which the portion encoding the cysteine residue of the Aspergillus oryzae neutral protease II gene is replaced with a sequence encoding an amino acid residue having no SH group. As the Aspergillus flavus neutral protease II gene used in the present invention, for example, the present inventors previously described that Aspergillus
Prepro-type neutral protease II cDNA isolated from Orize (ATCC 20386) (JP-A-3-198779) and the like can be mentioned.

As a method for substituting the portion encoding the cysteine residue of the neutral protease II gene, for example,
Kunkel's method (TAKunkel, Proc. Natl. Acad. Sci. U
SA, 82, 488 (1985)), double primer method (P. Carte
r, H. Bedouelle, G. Winter, Nucleic Acid Res., 13 ,
4431 (1985)), a method using thionucleotide (JW
Taylor, J. Ott, F. Eckstern, Nucleic Acid Res., 1
3 , 8764 (1985)), cassette mutagenesis method (JA Wells,
Methods such as et al., Gene, 34 , 315 (1985)) can be adopted. It is also possible to use a commercially available gene mutation kit, for example, oligonucleotide-directed in vitro mutagenesis system
Version 2 (Oligonucleotide-directed in vitro mu
When the tagenesis system version 2) is used, the neutral protease II gene is ligated to an E. coli plasmid such as pUC119 or pTV118N, and the desired gene mutation is introduced according to the protocol, and the site-specifically mutated neutral protease is introduced. The II gene can be cleaved with a restriction enzyme to obtain the desired site-specific mutated gene.

The type of amino acid having no SH group is not particularly limited, but neutral amino acids such as alanine, valine, glycine and serine are not particularly limited in that they have no side chain for ionization. , Threonine, leucine, isoleucine, asparagine, glutamine, tyrosine, phenylalanine, tryptophan, proline and the like. Of these, alanine or serine is particularly preferable in that it has a size similar to that of cysteine.

Next, it is necessary to construct an expression vector for the above-mentioned mutant neutral protease II gene, but it is not particularly limited as long as it can express such neutral protease II gene, and examples thereof include phages and plasmids. , Cosmid and the like can be used. However, the above-mentioned neutral protease
Since the II gene is originally derived from Aspergillus oryzae, it is preferable that the vector is also a yeast-derived vector, particularly a vector capable of exhibiting its function in yeast belonging to the genus Saccharomyces. Specifically, pONP29 (Mo
l.Gen., 228, 97, (1991)), pAM82 (A. Miyanohara et a
l., Proc. Natl. Acad. Sci., USA, 80, 1 (198
3)), AAH5 (G. Ammerer, Methods in Enzymol., 101, 19
2 (1983)).

In order to efficiently express the above-mentioned neutral protease II gene, a promoter, a selection marker, and an origin of replication are added to the above-mentioned vector.
Can be linked with a gene. The promoter etc. in such a case is not particularly limited as long as it can efficiently express the above-mentioned neutral protease II gene in the host,
For example, when yeast-derived ones are used as the vector and the host, examples of the promoter include Zygosaccharomyces rouxi.
i) Derived glyceraldehyde-3-phosphate dehydrogenase (hereinafter abbreviated as “GAPDH”) promoter (T. Im
ura et al., Agric. Biol. Chem, 51 , 1641 (1987)), Saccharomyces cerevisi
ae) -derived alcohol dehydrogenase I promoter (G. Ammer, Methods in Enzymol., 101, 192, (198
3)) and the like can be exemplified, and the GAPDH promoter is particularly preferable because it can efficiently express the neutral protease II cDNA. The selection marker is not particularly limited as long as it can detect the insertion of the gene into the vector.
When yeast-derived vectors and hosts are used, for example, Saccharomyces cerevisiae (Saccharo
myces cerevisiae) TRP1 gene (G. Tschumper and
J. Carbon, Gene, 10 157 (1980)), Saccharomyces cerevisiae LEU2 gene (B. Ratzkin and J. Carbo
n, Proc. Natl. Acad. Sci. USA, 74 , 487 (1977)) and the like. The origin of replication is not particularly limited as long as it can effectively exhibit its function. When yeast-derived ones are used as the host and the vector, for example, 2 μm DNA (JD Beggs, Nature, 275 , 10
4 (1978)), ARS1 (K. Struh1 et al., Proc. Natl. Aca
d. Sci. USA, 76 , 1035 (1979)) and the like.

As a method for constructing this expression vector, a generally known method can be used. The host for transformation of the expression plasmid is determined according to the type of expression vector selected. For example, when a yeast-derived expression vector is selected as a vector, a host suitable for expression of the vector, for example, Saccharomyces cerevisiae AH22 (A. Hinnen et al., Proc. Natl. Acad.
Sci. USA, 75 , 1929 (1978)), SHY1 (Botstein et a
l., Gene, 8 , 17 (1979)) and the like, and yeasts belonging to the genus Saccharomyces in that neutral protease II can be efficiently produced, such as Saccharomyces.
It is preferable to use S. cerevisiae NA87-11A or the like.

As a means for transformation, a commonly known method can be used depending on the type of expression vector or host selected. The transformant or the like thus obtained is cultured in a medium, and the mutant neutral protease II can be collected from the culture. The culture conditions such as a medium and the method for collecting the mutant neutral protease II are determined according to the expression vector used and the type of host. For example, when yeast-derived ones are used for both the expression vector and the host, the medium should be a medium suitable for the growth of transformants, such as YP.
Examples thereof include D medium, SD medium and the like, or those to which various commonly known carbon sources, nitrogen sources, inorganic salts, vitamins and the like are added. More specifically, when the host is a yeast belonging to the genus Saccharomyces, a YPD medium containing glucose, polypeptone and yeast extract to which zinc chloride is added can be mentioned. The culturing temperature and the culturing time are also determined according to the type of the host. For example, when the host is a yeast belonging to the genus Saccharomyces, the culturing temperature is 25
~ 35 ℃, preferably about 30 ℃, culture time is 24 ~
96 hours, preferably about 72 hours.

The mutant neutral protease II can be obtained by a conventional method from the culture containing the active substance obtained by the above culture. More specifically, when the host secretes the mutant neutral protease II directly outside the cells, the culture is centrifuged to obtain a culture supernatant, and the obtained culture supernatant is used as a crude enzyme solution. Can be used. When it is not secreted outside the cells, the mutant neutral protease II can be obtained by destroying the cells by a generally known method, for example, a mild method such as osmotic shock.

Isolation and purification of the mutant neutral protease II can be carried out by a conventional method, for example, various treatment operations utilizing the physical or chemical properties of the mutant neutral protease II can be carried out. (For example, "Biochemistry Data Book II", pp1175-1259, 1st edition, 1st edition, 19
(Refer to Tokyo Kagaku Dojin, June 23, 80). Specific examples of such a purification and isolation method include treatment with an ordinary protein precipitating agent, ultrafiltration, molecular sieve chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis method, hydrophobic chromatography, or the like. Combinations etc. can be adopted.

When the mutant neutral protease II is directly secreted to the outside of the cell, the culture supernatant obtained by the above centrifugation can be used as it is as a crude enzyme solution. Then, it can be partially purified using a hydrophobic chromatography method, for example, phenyl sepharose CL-4B (manufactured by Pharmacia). The amino acid sequence of the mutant neutral protease II obtained as described above can be confirmed by a commonly known method such as Edman method.

Further, the nucleotide sequence of the mutant neutral protease II gene incorporated into the expression vector is, for example, the Maxam-Gilbert chemical modification method (AM Maxam and W. G.
ilbert, Methods in Enzymol, 65, 499 (1980)) and M13
Dideoxynucleotide chain termination method using phage (J.
Messing and J. Vieira, Gene, 19 , 269 (1982)) and the like.

The mutant neutral protease II gene is wholly synthesized by an ordinary method, for example, a conventional method such as the phosphite triester method (Nature, 310, 105 (1984)) or by a DNA synthesizer. You can also In the above-described genetic engineering method according to the present invention, for example, conventional means using various restriction enzymes, DNA ligase, polynucleotide kinase, DNA polymerase, etc., for cleavage, binding, phosphorylation of DNA, etc. These enzymes can be used, and those enzymes are easily available as commercial products.
Isolation and purification of the gene or nucleic acid in each of these operations may be performed according to a conventional method such as agarose electrophoresis. A DNA fragment encoding a desired amino acid sequence and a synthetic linker can be easily produced by the above chemical synthesis.

[0021]

EXAMPLES The present invention will be described in more detail below with reference to examples. (1) Quantification of free SH group of neutral protease II Neutral protease II contains 6 cysteine residues. To determine how many disulfide bonds are formed, the following method was used. The free SH group of neutral protease II was quantified.

Aspergillus oryzae (ATCC 2
0386), the method of Sekine (Agric.Biol. Chem., 36 , 1
98 (1972)), neutral protease II was purified.
Purified neutral protease II was prepared according to the method described in JP-A-3-251175 by DTNB (5,5'-dithiobis- (2-
Nitrobenzoic acid) (5,5'-dithiobis- (2-ni
trobenzoic Acid)) and DTT (dithiothreitol (dit
release of non-reduced state and reduced state
The SH group was quantified. The molecular weight of the neutral protease II was 19,000 Dalton estimated from the nucleotide sequence, and E _{1c m} , _1% was 9.0 A280 (H. Sekine, Agric. Biol.
Chem., 36 , 198 (1972)) was used.

As a result of the quantification, the number of free SH groups per molecule of neutral protease II was 0 in the non-reduced state and 6 in the reduced state. That is, 6 for neutral protease II
Was confirmed to contain cysteine residues, and
It was revealed that neutral protease II has three disulfide bonds. (2) Preparation of plasmid for site-specific mutation of neutral protease II cDNA Aspergillus oryzae previously obtained by the present inventors
Prepro-type neutral protease derived from (ATCC 20386)
II cDNA (The nucleotide sequence of the cDNA is shown in SEQ ID NO. 1. The portions corresponding to -7 to +24 and +216 to +239 of this cDNA are the primer A shown in SEQ ID NO: 2 and the primer B shown in SEQ ID NO: 3, respectively. The base at the 5'end of the mature region was defined as the first base.) (Described in JP-A-3-198779) was designed to be expressed in Saccharomyces cerevisiae. Plasmid pONP29 (Mol. Gen. Genet., 228, 97 (199
Starting from 1)), pONP102, a plasmid for site-directed mutation of neutral protease II cDNA, was constructed by the following procedure.

First, in order to conveniently construct a recombinant plasmid, EcoR on the 3'side of the neutral protease II cDNA is used.
I site was converted to BamHI site. That is, the BamHI site of pONP29 was deleted using a DNA blunting kit (Takara Shuzo) to obtain pONP29B. Then, pONP29B was partially digested with EcoRI and
Branding kit and Beckman DNA synthesizer
(System 1E Plus) synthesized BamHI linker (G
GGATCCC), pONP29B neutral protease IIcDN
The EcoRI site existing on the 3'side of A was converted into a BamHI site to obtain pONP33.

Next, pONP33 neutral protease II cDNA
Was excised with EcoRI and BamHI according to the conditions usually used, inserted between the EcoRI site and the BamHI site present in the polylinker of pUC119, and neutralized with Protease II.
We obtained pONP102, a plasmid for site-directed mutagenesis of cDNA. (3) Introduction of Mutation into Neutral Protease II cDNA It was clarified that neutral protease II has 6 cysteine residues and 3 disulfide bonds from the above (1), but it is site-specific. By mutation, the 6-position and 78-position cysteine residues were respectively replaced with alanine residues that are similar in size to cysteine residues and have no SH group, so that one disulfide bond can be removed. I tried.

Recombinant plasmid pON obtained in (1)
From E. coli JM101 containing P102, `` Methods in E
nzymol., 153 , 3 (1987) ”was used to obtain a single-stranded recombinant plasmid pONP102. On the other hand, using a DNA synthesizer (manufactured by Beckman, System 1E Plus), oligonucleotides A and B for introducing mutations were synthesized. The structures of oligonucleotides A and B are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively. Oligonucleotide A
Consists of 31b and corresponds to the alanine TGC codon encoding the cysteine at position 6 of neutral protease II cDNA.
Converted to GCC codon, and Spl as a mutation marker
It is designed to add an I-site. Oligonucleotide B consists of 24b and is a neutral protease II cDNA
It is designed to convert the TGC codon encoding the cysteine at position 78 into the GCC codon corresponding to alanine, and further add the SnaBI site as a mutation marker.

[0027] The above single-stranded plasmid, oligonucleotide A or B, and further Oligonucleotide-directed mutagenesis system version 2 (Oligonucleotide-dir) manufactured by Amersham.
Using the ected in vitro mutagenesis system version 2), a site-specific mutation was introduced into the neutral protease II cDNA by the method supported by Amersham, and pONP61 (derived from oligonucleotide A, which is a plasmid containing the mutant neutral protease II cDNA). And pONP62 (derived from oligonucleotide B) were obtained respectively. In the screening of mutant plasmids, the SplI site was introduced in the case of pONP61 and the SnaBI site was introduced in the case of pONP62.

Mutant plasmids pONP61 and pONP62 were prepared by the method of Sakaki (“Vector DNA”, page 70, Kodansha, 1986).
Alkali denaturation according to M13 Sequence Kit
(Takara Shuzo Co., Ltd.) was used to determine the nucleotide sequence of the mutation site by the dideoxynucleotide chain termination method.As a result, it was confirmed that the neutral protease II cDNA of both plasmids had the mutation as originally designed. ..

(4) Construction of recombinant yeast capable of producing mutant neutral protease II Mutant neutral protease II contained in pONP61 and pONP62
The cDNA was excised with EcoRI and BamHI. On the other hand, pO
Treating NP33 with EcoRI and BamHI, the promoter of glyceraldehyde-3-phosphate dehydrogenase from Zygosaccharomyces rouxii (hereinafter abbreviated as GAPDH), GAP
DH terminator, Saccharomyces cerevisiae (Sa
ccharomyces cerevisiae) TRP1 gene, 2 μm DNA,
A 8.0 kb fragment containing pBR322 and pBR322 was obtained and ligated to the mutant neutral protease II cDNA. Thus, the mutant neutral protease II is a recombinant plasmid designed to be expressed in Saccharomyces cerevisiae under the control of the GAPDH promoter, pONP71 (derived from oligonucleotide A) and pONP72 (oligonucleotide A). (Derived from B) was obtained (FIG. 1).

PONP71 and pONP72 were transformed into Saccharomyces cerevisiae NA87-11A (sold by Professor Taiji Oshima of Osaka University) using the method of Beggs (Nature, 275, 104 (1978)) to transform the transformants and Saccharomyces. -Cerevisia NA87-11A (pONP71) and Saccharomyces cerevisiae NA87-11A (pONP72) were obtained. In addition, Saccharomyces cerevisiae NA87-11A (pONP71) and Saccharomyces cerevisiae NA87-11A (pONP72) were respectively registered at the Institute of Microbial Science and Technology of the Agency of Industrial Science and Technology, Microbiology Research Institute No. 12638 (FE
RM P-12638) and 12639 (FERM P-12639).

(5) Saccharomyces cerevisiae NA87-
11A (pONP71) and Saccharomyces cerevisiae NA87-
Production of mutant neutral protease II by 11A (pONP72) Saccharomyces cerevisiae NA87-11A (pONP71), Saccharomyces cerevisiae NA87-11A (pONP72), and, as a control, expression plasmid pONP33 containing wild-type neutral protease II cDNA Saccharomyces cerevisiae
NA87-11A (pONP33) was added to each of histidine and leucine to 60 mg / l, and 40 ml of SD medium (2%
Glucose, 0.67% yeast nitrogen base
w / o amino acid (yeast nitrogen base w / o amin
acid) (manufactured by DIFCO) at 30 ° C. for 2 days at a shaking speed of 120 rpm. This preculture solution was
Inoculate 2 L of YPD medium (2% glucose, 2% polypeptone, 1% yeast extract) supplemented with 2 mM zinc chloride,
3L jar fermenter (MB-C type, manufactured by Iwashiya)
Incubation was carried out at 30 ° C., aeration rate of 1 vvm and stirring speed of 600 rpm for 72 hours.

(6) Partial purification of mutant neutral protease II Saccharomyces cerevisiae NA87-11A (p) obtained in (4)
ONP71), Saccharomyces cerevisiae NA87-11A (pON
P72), and Saccharomyces cerevisiae NA87-11A (p
From the culture solution of ONP33), the mutant or wild-type neutral protease II was partially purified according to the following method. A culture supernatant was obtained from the culture solution by centrifugation. After adding ammonium sulfate to this to 1.5M,
Phenyl Sepharose equilibrated with buffer A (1.5 M ammonium sulfate, 50 mM sodium acetate, pH 6.0)
The neutral protease II was adsorbed on the gel by passing through CL-4B gel (Pharmacia). After washing the gel with buffer A, neutral protease II was eluted from the gel with buffer B (50 mM sodium acetate, pH 6.0). The elution fraction was subjected to an ultrafiltration membrane (manufactured by Amicon,
YM5) was used for concentration, and the buffer solution was replaced with buffer solution B to obtain a crude enzyme solution.

The amino acid sequence of wild-type neutral protease II is shown in SEQ ID NO: 4 (the N-terminal amino acid residue was defined as the first). In addition, the recombinant plasmid pONP
SEQ ID NO: 5 shows the amino acid sequence of the mutant neutral protease II in which the cysteine residue at the 6-position is replaced with an alanine residue, which is produced by the yeast having 71. And
The amino acid sequence of mutant neutral protease II produced by yeast having recombinant plasmid pONP72 in which the cysteine residue at position 78 is replaced with an alanine residue is shown in SEQ ID NO: 6.

(7) Thermostability of Mutant Neutral Protease II The thermostability of two types of crudely purified mutant neutral protease II and wild-type neutral protease II at 60 ° C. was examined by the following method. .. The crude enzyme preparation was incubated at 60 ° C for 10 minutes and 20 minutes, and rapidly cooled in ice, and the residual activity was measured using Klupaine (manufactured by Sigma) as a substrate, ninhydrin reagent Wako Ninhydrin reagent-L8500 set (Japanese (Manufactured by Kojunkaku Co., Ltd.), and the results are shown in Table 1.

[0035]

[Table 1] The parent strain Saccharomyces cerevisiae NA87-11A having no recombinant plasmid was cultured by the same method, and the protease activity of the culture supernatant was measured by the same method, but no activity was detected. From this, it was clarified that the total protease activity contained in the supernatant of Saccharomyces cerevisiae having the above recombinant plasmid was derived from the neutral protease II gene present on the recombinant plasmid.

As is clear from Table 1, the mutant neutral protease II of the present invention in which the cysteine residues at the 6-position and the 78-position are each converted to an alanine residue is a wild-type neutral protease.
Compared to II, the thermal stability was remarkably reduced. That is, it was revealed that the thermal stability of the neutral protease II was reduced by substituting the alanine residue for the cysteine residue of the neutral protease II by the site-specific mutation method.

[0037]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 1056 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Unknown Sequence type: cDNA to mRNA Origin: Aspergillus oryzae (ATCC 20386) Sequence: ATGCGTGTCA CTACTCTCTC CACTGCGCTC TTCGCGTTGA CTTCCACCGC TGTGTCAGCG -466 CCAACCGCTG GGAGCTCTTC TCCTGGTCTT GAGGTCAAGC TGACCCAGAT TGACAACACT -406 CGTGTGAAGG CGGTTGTCAA GAACACCGGC AGTGAGGAAG TGTCCTTCGT CCACCTGAAC -346 TTCTTCAAGG ACGCTGGCCC TGTCAAGAAG GTTTCCGTCT ACCGCGGCCA GGATGAGGTC -286 CAGTTCGAGG GTATCAAGCG CCGCTTGAGG AGCAGTGGCA TCACTAAGGA GGCTGTCACT -226 TCTCTCGGTG CCGGAGAGAC CCTGGAGGAT GAGTTCGATA TCGCCTCCAC CAGCGACCTG -166 GCAAGCGGCG GCCCCGTTTC CATCCGCAGC CACGGATTCG TCCCCATTGT CGTGGACGGC -106 AAGATCACCG GCTACATCCC CTACAAGTCC AACGACCTGA CCGTCAATGT TGACGGCGGT -46 AAGGCCGCCA AGGTCACCAA GGCGCTGT CAGCTCACCC GCCGCGAGGTCAGCA CCCC CCCCTGCCCGCCCC CCCCTGCCCCCCCCCCGTCCAACCGCTT ACTTCAAG 135 ACCACCGACC AGCAGACCCG CACGACCGTT GCTGAACGTC TGCGCGCTGT CGCTAAGGAA 195 GCCGGCTCTA CCTCCGGTGG CTCTACCACG TACCACTGCA ACGACCCCTA CGGCTACTGT 255 GAGCCTAACG TTCTGGCCTA CACCCTGCCC TCGAAGAACG AGATCGCCAA CTGCGACATC 315 TACTACTCTG AGCTTCCTCC CCTTGCTCAG AAGTGCCACG CCCAGGACCA GGCCACCACC 375 ACTCTTCACG AGTTCACTCA CGCCCCTGGC GTCTACCAGC CTGGTACTGA GGATTTGGGC 435 TACGGCTATG ATGCCGCTAC TCAGCTGAGT GCCCAGGATG CGTTGAACAA CGCTGATTCC 495 TATGCCTTGT ATGCCAATGC TATCGAGCTC AAGTGC 531

SEQ ID NO: 2 Sequence length: 31 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA primer Sequence: 5'CCGCCGTACGGAGGTCACCGACGCCAAGGGT 3 '

SEQ ID NO: 3 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA primer Sequence: 5'CTCTACTACGTACCACGCCAACGA 3 '

[0040] SEQ ID NO: 4 Length of sequence: 177 SEQ type: amino acid Topology: unknown sequence type: peptide Origin: Aspergillus oryzae (ATCC 20386) sequence: ThrGluValThrAspCysLysGlyAspAlaGluSerSerLeuThrThrAlaLeuSerAsn 20 AlaAlaLysLeuAlaAsnGlnAlaAlaGluAlaAlaGluSerGlyAspGluSerLysPhe 40 GluGluTyrPheLysThrThrAspGlnGlnThrArgThrThrValAlaGluArgLeuArg 60 AlaValAlaLysGluAlaGlySerThrSerGlyGlySerThrThrTyrHisCysAsnAsp 80 ProTyrGlyTyrCysGluProAsnValLeuAlaTyrThrLeuProSerLysAsnGluIle 100 AlaAsnCysAspIleTyrTyrSerGluLeuProProLeuAlaGlnLysCysHisAlaGln 120 AspGlnAlaThrThrThrLeuHisGluPheThrHisAlaProGlyValTyrGlnProGly 140 ThrGluAspLeuGlyTyrGlyTyrAspAlaAlaThrGlnLeuSerAlaGlnAspAlaLeu 160 AsnAsnAlaAspSerTyrAlaLeuTyrAlaAsnAlaIleGluLeuLysCys 177

[0041] SEQ ID NO: 5 Length of sequence: 177 SEQ type: amino acid Topology: unknown sequence type: peptide Origin: Aspergillus oryzae (ATCC 20386) sequence: ThrGluValThrAspAlaLysGlyAspAlaGluSerSerLeuThrThrAlaLeuSerAsn 20 AlaAlaLysLeuAlaAsnGlnAlaAlaGluAlaAlaGluSerGlyAspGluSerLysPhe 40 GluGluTyrPheLysThrThrAspGlnGlnThrArgThrThrValAlaGluArgLeuArg 60 AlaValAlaLysGluAlaGlySerThrSerGlyGlySerThrThrTyrHisCysAsnAsp 80 ProTyrGlyTyrCysGluProAsnValLeuAlaTyrThrLeuProSerLysAsnGluIle 100 AlaAsnCysAspIleTyrTyrSerGluLeuProProLeuAlaGlnLysCysHisAlaGln 120 AspGlnAlaThrThrThrLeuHisGluPheThrHisAlaProGlyValTyrGlnProGly 140 ThrGluAspLeuGlyTyrGlyTyrAspAlaAlaThrGlnLeuSerAlaGlnAspAlaLeu 160 AsnAsnAlaAspSerTyrAlaLeuTyrAlaAsnAlaIleGluLeuLysCys 177

[0042] SEQ ID NO: 6 Length of sequence: 177 SEQ type: amino acid Topology: unknown sequence type: peptide Origin: Aspergillus oryzae (ATCC 20386) sequence: ThrGluValThrAspCysLysGlyAspAlaGluSerSerLeuThrThrAlaLeuSerAsn 20 AlaAlaLysLeuAlaAsnGlnAlaAlaGluAlaAlaGluSerGlyAspGluSerLysPhe 40 GluGluTyrPheLysThrThrAspGlnGlnThrArgThrThrValAlaGluArgLeuArg 60 AlaValAlaLysGluAlaGlySerThrSerGlyGlySerThrThrTyrHisAlaAsnAsp 80 ProTyrGlyTyrCysGluProAsnValLeuAlaTyrThrLeuProSerLysAsnGluIle 100 AlaAsnCysAspIleTyrTyrSerGluLeuProProLeuAlaGlnLysCysHisAlaGln 120 AspGlnAlaThrThrThrLeuHisGluPheThrHisAlaProGlyValTyrGlnProGly 140 ThrGluAspLeuGlyTyrGlyTyrAspAlaAlaThrGlnLeuSerAlaGlnAspAlaLeu 160 AsnAsnAlaAspSerTyrAlaLeuTyrAlaAsnAlaIleGluLeuLysCys 177

[Brief description of drawings]

FIG. 1 shows recombinant plasmids pONP71 and pONP72.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Eiichi Nakano 339 Noda, Noda, Chiba Prefecture Kikkoman Corporation (72) Inventor Hiroshi Motai 339 Noda, Noda, Chiba Prefecture Kikkoman Corporation (72) Inventor Kawabe Haruei, Hirakata-shi, Osaka 2-25-1 Otani, Otani Ltd. Midori Cross Central Research Institute Co., Ltd.

Claims (6)

[Claims] 1. A mutant neutral protease characterized in that, in the amino acid sequence of Aspergillus flavus neutralase II, cysteine is substituted with an amino acid having no SH group.
II. 2. A mutant neutral protease II, characterized in that, in the amino acid sequence of Aspergillus flavus neutralase II, cysteines at positions 6 and / or 78 are substituted with amino acids having no SH group. 3. The mutant neutral protease II according to claim 1, wherein the amino acid having no SH group is a neutral amino acid. 4. A mutant neutral protease II gene encoding an amino acid sequence of Aspergillus flavus neutral protease II, wherein cysteine is substituted with an amino acid having no SH group. 5. A mutant neutral protease II gene encoding an amino acid sequence of Aspergillus oryzae neutral protease II, wherein cysteine is substituted with an amino acid having no SH group, is inserted into vector DNA. A new recombinant DNA to be. 6. A recombinant in which a mutant neutral protease II gene encoding an amino acid sequence in which cysteine is substituted with an amino acid having no SH group in the amino acid sequence of Aspergillus oryzae neutral protease II is inserted into vector DNA. A microorganism containing Saccharomyces, which contains DNA and has a mutant neutral protease II-producing ability, is cultured in a medium,
A method for producing a mutant neutral protease II, which comprises collecting the mutant neutral protease II from a culture.