JPH05163439A - New water-soluble tetraazaporphine, fluorescent labeling pigment containing the same, biological substance labeled with fluorescent labeling pigment, reagent containing the same and fluorescent analysis method using the same - Google Patents

Abstract

PURPOSE:To provide the subject compound useful as a fluorescent labeling pigment, useful for the analysis of antibodies, chemicals, DNA, etc. CONSTITUTION:A compound of the formula [M is H2, Mg, Al, etc.; Y is halogen,-OR<1>,-NR22,-SR<3> (R<1>-R<3> are H, alkyl, aryl, etc.,); p is 0-2; A is a condensed polycyclic aromatic ring having m substituents; X is O, N; Q is hydrocarbon, heterocyclic ring; m is 1-4; p is >=0; four (n) are >=1, respectively; Z is anion, and E is cationic group; or Z does not exist, and E is polyethylene glycol residue, etc.,]. For example, sodium salt of zinc phthalocyanine tetracarboxylic acid. The compound of the formula is obtained e.g. by reacting zinc tetra (n- amyloxycarbonyl) naphthalocyanine in a solvent such as ethanol in the presence of a base such as sodium hydroxide.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel water-soluble tetraazaporphine, a fluorescent labeling dye, a biological substance labeled with a fluorescent labeling dye, a reagent containing these, and a fluorescence analysis method using these. .

[0002]

2. Description of the Related Art Labeling methods have long been used for molecules, cells, antigens,
It is used for many substances such as antibodies, DNA, RNA, and polypeptides. Until now, the labeling method based on the radioisotope (RI) method has been widely used due to its long history of research. Since RI has a high risk of being exposed to radiation, a special license is required for its use, and at the same time, a special laboratory is required, and only a limited number of people can use it in a limited facility. .

On the other hand, the coloring substances, chemiluminescence method, fluorescence method and the like have attracted attention as non-dangerous labeling methods since they do not require RI. Colored substances are not useful enough to replace the RI method because they cannot have high detection sensitivity. On the other hand, the chemiluminescence method and the fluorescence method are considered as safe labeling methods instead of the RI method because they can increase the detection sensitivity. However, the chemiluminescence method is 2
Because of the luminescence due to the combination of chemical reactions of more than one species,
The operation becomes complicated. Therefore, the fluorescent labeling method is the most excellent labeling method in terms of safety, simplicity, and high sensitivity.

Conventionally, only dyes that emit fluorescence in the ultraviolet region have been known, but recently, rhodamine-based dyes and oxazine-based dyes are known to be known in this field as dyes that can be excited by an argon laser or a He-Ne laser. Has become.

[0005]

Recently, as a light source,
Since small-sized semiconductor lasers (670 to 840 nm) have become available at low cost, it is considered that this will become the mainstream in the future with the aim of reducing the cost, size and weight of the equipment. However, the rhodamine-based dyes and oxazine-based dyes conventionally used have a problem that they cannot be used in this semiconductor laser.

Recently, it has been proposed to use phthalocyanine, which has an appropriate fluorescence quantum yield and high solubility in water, as a fluorescent labeling dye (WO Patent No. 88/047).
77 publication, WO patent 90/02747 publication). However, phthalocyanines have a maximum absorption region and a fluorescence emission region of the Q-band in the range of 670 to 690 nm,
Not only cannot be excited by a semiconductor laser with an oscillation wavelength of 700 nm or more, but when a semiconductor laser with a wavelength of 670 to 680 nm is used, the detected light emits light because the oscillation wavelength region of the laser and the fluorescence emission region overlap. It cannot be used because it cannot be distinguished whether it is due to the emitted fluorescence or due to the scattered laser light source. That is, there is a fatal defect that it cannot be used at all in the system using the semiconductor laser which is the mainstream.

Further, in a system in which heme in blood, which is an in-vivo substance, coexists, heme has an absorption region at 700 nm or less, and phthalocyanine overlaps with this, so that
There is a problem that the substance in the living body interferes with the measurement. INDUSTRIAL APPLICABILITY The present invention is not affected by in-vivo substances such as heme existing in blood, and is inexpensive and small in size.
A novel compound, a fluorescent labeling dye, a reagent, a clinical test reagent, and a fluorescence analysis method, which are useful for the analysis of various antigens, drugs, DNA, etc., or the analysis of the base sequence of DNA, etc. It is provided.

[0008]

The present inventors have accomplished the present invention as a result of intensive studies to solve the above problems. The present invention relates to the following (1) to (12). That is, (1) general formula (I)

[Chemical 3] [In the general formula (I), M is H ₂ , Mg, Al, Si,
P, Zn, Ga, shows a Ge or Sc, Y is a halogen atom, -OR ^1, -NR ² ₂ or -SR ³ (provided that, R ^1,
R ² and R ³ are each independently a hydrogen atom, an alkyl group which may have a hydrophilic substituent, an aryl group which may have a hydrophilic substituent, or an aralkyl which may have a hydrophilic substituent. Group, an acyl group which may have a hydrophilic substituent, a silyl group which may have a hydrophilic substituent, or a phosphorus atom-containing group which may have a hydrophilic substituent). , Y represents an integer of 0 to 2 representing the number of bonds to M, A represents a condensed polycyclic aromatic ring in which two or more aromatic rings having m substituents XQ are condensed, and X is Indicates an oxygen atom or a sulfur atom,
Q represents a saturated or unsaturated hydrocarbon group or a heterocyclic group, m independently represents a positive integer of 1 to 4 with respect to 4 A, and 4 n represents 4 A , Each independently represents an integer of 0 or more, 4n (a total of four n) represents an integer of 1 or more, and 4n substituents (EZ)
Are each independently and independently bonded to the condensed polycyclic aromatic ring and / or Q constituting A,
E and Z are, when Z is an anion, E is a cationic group, Z
Is a cation, E is an anionic group, and when Z is absent, E is a polyethylene glycol residue, a polyether residue,
Shows a binding group containing a polyamine residue, a polyalcohol residue or a polycarboxylic acid residue].

(2) General formula (II)

[Chemical 4] [In the general formula (II), M is H ₂ , Mg, Al, Si,
P, Zn, Ga, shows a Ge or Sc, Y is a halogen atom, -OR ^1, -NR ² ₂ or -SR ³ (provided that, R ^1,
R ² and R ³ are each independently a hydrogen atom, an alkyl group which may have a hydrophilic substituent, an aryl group which may have a hydrophilic substituent, an aralkyl group which may have a hydrophilic group, An acyl group which may have a hydrophilic substituent, a silyl group which may have a hydrophilic substituent, or a phosphorus atom-containing group which may have a hydrophilic substituent), and p is Y Represents an integer of 0 to 2 which represents the number of bonds to M, and A represents m substituents XQ.
Or a condensed polycyclic aromatic ring in which two or more aromatic rings optionally having Q are condensed, X is an oxygen atom, a sulfur atom, a nitrogen atom, a phosphorus atom, a silicon atom, a selenium atom, N
H ・ CO, NH ・ PO ₂ , NH ・ SO ₂ , O ・ CO, O ・
SO ₂ , O ・ PO ₂ , S ・ CO, S ・ SO ₂ , S ・ PO ₂ , CO, S
O ₂ or PO ₂ is shown, Q is a saturated or unsaturated hydrocarbon group or a heterocyclic group, m is an integer of 1 to 4 for 4 A's, and 4 n Is four A
, Each independently represent an integer of 0 or more, and 4n
(Total of four n) represents an integer of 1 or more, and the 4n substituents (EZ) are each independently and independently, a condensed polycyclic aromatic ring and / or A constituting A. E and Z are bound to Q. E is a cation when Z is an anion, E is an anion when Z is a cation, and E is a polyethylene glycol residue, a polyether residue, or a polyamine residue when Z is not present. Group, a linking group containing a polyalcohol residue or a polycarboxylic acid residue].

(3) A reagent containing the fluorescent labeling dye according to (2) above. (4) A reagent containing the fluorescent labeling dye according to (2) above and a nonionic surfactant. (5) A biological substance labeled with the fluorescent labeling dye according to the above (2). (6) A reagent containing the labeled biological substance according to (5) above. (7) A reagent containing the labeled substance of biological origin as described in (5) above and a nonionic surfactant. (8) The biological substance according to (5) above or the reagent according to (6) or (7) above, wherein the biological substance is an antigen, an antibody or a nucleotide. (9) The biological substance or reagent according to the above (8), wherein the antigen is a drug. (10) The above (8), wherein the antibody is a monoclonal antibody
The biological material or reagent as described. (11) The biological substance or reagent according to the above (8), wherein the nucleotide is an oligonucleotide or a polynucleotide. (12) The nucleotide is ATP, CTP, GTP, T
TP, UTP, dATP, dCTP, dGTP, dTT
P, dUTP, ddATP, ddCTP, ddGTP,
The biological substance or reagent according to (8) above, which is ddTTP, ddUTP, or a derivative thereof. (13) A fluorescence analysis method, which comprises using the fluorescent labeling dye according to (2) as a fluorescent label. (14) The fluorescence analysis method according to (13), wherein a semiconductor laser having a wavelength of 670 to 840 nm is used as a light source. (15) The fluorescence analysis method according to (13) or (14), which uses the labeled biological substance according to (6).

Since the novel tetraazaporphine derivative represented by the general formula (I) has excellent solubility not only in water but also in polar organic solvents such as methanol and ethanol, it can be chromatographed and recrystallized. Further, it can be easily purified by a reprecipitation method or the like to improve its purity.

In the compound of the general formula (I) according to the present invention, R
Specific examples of the alkyl group which may have a hydrophilic substituent of ¹ , R ² and R ³ include a methyl group, an ethyl group, a propyl group, a butyl group, a pentyl group, a hexyl group, a heptyl group,
Linear, branched and cyclic groups such as octyl group, nonyl group, decyl group, dodecyl group, tetradecyl group, hexadecyl group, octadecyl group, enokosyl group, docosyl group, etc., or hydroxyl group, carboxylic acid group, sulfonic acid group , An aryl group which may have a hydrophilic substituent such as a phosphoric acid group, and which may have a hydrophilic substituent is a phenyl group, a biphenyl group, a terphenyl group, a cumenyl group, a furyl group or a thienyl group. , A pyrrolyl group or a hydroxyl group, a carboxylic acid group, a sulfonic acid group, a group having a hydrophilic substituent such as a phosphoric acid group bonded thereto, and the aralkyl group which may have a hydrophilic substituent is a benzyl group, There is a phenethyl group or a group in which a hydrophilic substituent such as a hydroxyl group, a carboxylic acid group, a sulfonic acid group, or a phosphoric acid group is bonded, and examples of an acyl group which may have a hydrophilic substituent Is a formyl group, an acetyl group, a propionyl group, a butyryl group, a valeryl group, a pivaloyl group, a hexanoyl group, an octanoyl group, a lauryl group, a palmityl group, a stearyl group and the like linear, branched and cyclic groups or a hydroxyl group thereof, There is a group to which a hydrophilic substituent such as a carboxylic acid group, a sulfonic acid group and a phosphoric acid group is bonded, and examples of the silyl group which may have a hydrophilic substituent include a trimethylsilyl group, a triethylsilyl group and a tripropylsilyl group. , A tributylsilyl group, a triamylsilyl group, a trihexylsilyl group, a dimethylphenylsilyl group, a diphenylmethylsilyl group, a triphenylsilyl group and the like, a silyl group having a linear, branched or cyclic group or a hydroxyl group or a carboxyl group thereof. There is a group to which a hydrophilic substituent such as an acid group, a sulfonic acid group or a phosphoric acid group is bonded, and even if it has a hydrophilic substituent The have a phosphorus atom-containing group, a phosphoric acid residue, a phosphoric acid ester and the like.

Specific examples of the saturated or unsaturated linear, branched or cyclic hydrocarbon group represented by Q in the substituent XQ include a methyl group, an ethyl group, a propyl group, an isopropyl group and a butyl group. , Isobutyl group, sec-butyl group, tert-butyl group, pentyl group, isopentyl group, neopentyl group, hexyl group, heptyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, vinyl group, 1-propenyl group Group, allyl group, isopropenyl group, 1-butenyl group, 2-butenyl group, 2-pentenyl group, ethynyl group, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cyclohexenyl group, phenyl group, tolyl group, Xylyl group, mesityl group, cumenyl group, benzyl group, phenethyl group, naphthyl group, etc. Specific examples of the group, a furyl group, a thienyl group, a pyrrolyl group. Examples of the anion represented by Z include Cl ⁻ , Br ⁻ , I ⁻ , and Cl.
O ₄ ⁻ , SO ₄ ²⁻ , PO ₄ ^3−, etc., and examples of the cation represented by Z are H ₊ , Li ₊ , Na ₊ , K ₊ , M.
g ² ₊ , Ca ² ₊ , ammonium ion, etc., and the cationic group represented by E is

[Chemical 5] (However, R ⁴ and R ⁵ are an alkyl group which may have a hydrophilic substituent shown by R ¹ , R ² , and R ³ , an aryl group which may have a hydrophilic substituent, and a hydrophilic group. And the same meaning as an aralkyl group which may have a substituent), and examples of the anionic group represented by E include —COO ⁻ , —OSO ₃ ^— , and —.
Examples of the condensed polycyclic aromatic ring in which two or more aromatic rings represented by A are condensed include naphthalene ring, anthracene ring, phenanthrene ring, quinoline ring, quinoxaline ring, and OPO ₃ ⁻ and —SO ₃ ⁻ . There is a chrysene ring or the like, and the bonding position thereof is not particularly limited.

The types and shapes of these substituents are not limited to the solubility of the novel tetraazaporphine represented by the general formula (I) in water or a polar organic solvent, but also the absorption spectrum waveform in the solution and It has a great influence on the absorption maximum wavelength or the fluorescence emission maximum wavelength and the fluorescence emission intensity.

Further, p represents the number of bonds of Y to M, from 0 to
Represents an integer of ₂ , p is 0 when M is H ₂ , Mg or Zn,
When M is Al, Sc, Ga, p is 1, M is Si, P, G
In the case of e, p represents 2. In the compound of the general formula (I), the water-soluble group represented by EZ is bonded to the fused polycyclic aromatic ring represented by A and / or Q bonded to the aromatic ring. The position at which EZ is bound depends on the difference in the synthetic route of the compound of general formula (I). For example, as shown in Example 3 which will be described later, when a group capable of imparting water solubility is subsequently introduced into a compound having Q having no special substituent, the water-soluble sulfonic acid group is represented by A. Substituted on both the condensed polycyclic aromatic ring and the benzene ring represented by Q. On the other hand, as shown in Example 4 which will be described later, when XQ having a substituent (ester group) capable of becoming EZ by hydrolysis is introduced into the condensed polycyclic aromatic ring represented by A and then hydrolyzed, water solubility is obtained. The sexual group EZ is substituted only for Q.

Specific examples of the novel tetraazaporphine according to the present invention are shown in Tables 1 to 6 as exemplary compounds.

[Table 1]

[0017]

[Table 2]

[0018]

[Table 3]

[0019]

[Table 4]

[0020]

[Table 5]

[0021]

[Table 6]

The novel water-soluble tetraazaporphine represented by the general formula (I) can be obtained by various synthetic methods. For example, it can be synthesized by the following route.

[Chemical 6] Here, NcA is -Yp,-in the general formula (I).
(EZ) indicates n and portion excluding the XQ, Y _R -NcA
In —XQ-EZ, Y is —OR ¹ , —N in the general formula (I).
R ² ₂ or -SR ³ (Here, R excluding the case of H) is a compound having at XQ and EZ, Y _H-NCA
-XQ-EZ is a compound represented by general formula (I) in which Y is -OH, -NH.
₂ or —SH, which is a compound having XQ and EZ, Y _X —NcA-XQ-EZ is represented by the formula (I) in which Y is
Is a halogen atom, is a compound having XQ and EZ, and Y _R —NcA-XQ is represented by the general formula (I):
Y is -OR ^1, -NR ² ₂ or -SR ³ (Here, R excluding the case of H) is, has XQ, the NcA substituents which can be the EZ by hydrolysis and condensation polycyclic aromatic A compound which may be present on the group ring or on XQ, and is Y _H —Nc
A-XQ has the formula (I) in which Y is -OH, -N.
An H ₂ or -SH, has XQ, a hydrolyzate or a compound which may have a substituent which can be the EZ on the fused polycyclic aromatic ring NcA or XQ by, Y _X -
NcA-XQ has the formula (I), in which Y is a halogen atom, has XQ, and is hydrolyzed to give EZ.
A substituent that can be a substituent on the condensed polycyclic aromatic ring of NcA or X
Y _R —NcA is a compound which Q may have,
In the general formula (I), Y is -OR ^1, -NR ^{₂ 2} or -
SR ³ (provided that R is not H), which is a compound which may have a leaving group substitutable with XQ, Y _H —N
cA is a compound represented by formula (I) in which Y is —OH, —NH _2.
Or —SH, which is a compound which may have a leaving group substitutable with XQ, and Y _X —NcA has the formula (I):
Wherein Y is a halogen atom and may have a leaving group substitutable with XQ. The reaction between each compound in the above route is well known and differs depending on the structure to be introduced. The preferred route also depends on the final compound to be obtained. In the above route, the change from the lower compound to the upper compound, that is, the substitution of Y _X to Y _H , involves hydrolysis (when Y _H is —OH), ammolysis (Y _H is —NH ₂ ). Etc.) and the substitution of Y _{H with} Y _R is carried out by reacting the corresponding alcohol, acyl chloride, silanol, chlorosilane, chlorophosphine, chlorophosphite, phosphoryl chloride, etc. It can be carried out. In the above pathway, the change from the compound on the right side to the compound on the left side, that is, the introduction of XQ and EZ is carried out in one step or a plurality of steps by using a chemical species having a desired one or a site capable of becoming these. Can be carried out by reacting. In the above route, the compound in the dotted line is the compound represented by the general formula (I).

In the above equation, Y _X -NcA-XQ-E
Z, a compound represented by Y _X -NcA-XQ and Y _X-NCA in the literature (Zh.Obshch.Khim. 39
Vol. 2554-2558 (1969), J. Am. Am.
Chem. Soc. 106, 7404-7410 (1984), Zh. Obshch. Khim. Third
Volume 9, pp. 2536-2541 (1969), Che
m. Ber. 121, 1479-1486 (19
1988), Synthetic Metals, No. 9
Vol. 329-340 (1984), etc.) and can be synthesized from the corresponding dicyanoaromatic compound or isoindoline derivative.

The fluorescent labeling dye in the present invention includes
Not only all of the novel tetraazaporphine derivatives represented by the general formula (I) can be used, but they have been proposed for other uses (US Pat. No. 4,657,554, JP-A-57-57). 210000, JP-A-6
Some of the water-soluble tetraazaporphins can also be used as the water-soluble tetraazaporphine (0-199890, JP-A-1-130978, JP-A-1-198391, etc.). The compound including them, which is used as the dye for fluorescent labeling of the present invention, is represented by the general formula (II).

In the compound of the general formula (II) of the present invention, R ¹ , R ² and R ³ have the same meanings as described in the general formula (I), and the hydrocarbon group and the heterocyclic group represented by Q are represented. The specific example of is also as explained in the general formula (I). Further, the description regarding p and EZ has the same meaning as in the general formula (I). Furthermore, their manufacturing method is
There is no particular limitation, and the compound can be produced, for example, by the same route as the method for producing the compound of the general formula (I).

The most important characteristic required for use as a fluorescent labeling dye is high fluorescence quantum yield (> 0.1).
That is. In order for the tetraazaporphine derivative to show such a high fluorescence quantum yield, it is necessary that the central metal is not a heavy metal or a transition metal and that tetraazaporphine is in a monomolecular state in a solution. Therefore, the central metal M is H ₂ , Mg, Al, S
i, P, Zn, Ga, Ge or Sc. In particular, the central metal M is a tetravalent metal such as Si or Ge, and a compound having two substituents Y on the upper and lower sides of a tetraazaporphine ring is used for M, or a substituent having large steric hindrance is added to the tetraazaporphine ring. Introduced, intermolecular face-to-face H characteristic of tetraazaporphine
-It is most preferable to keep the monomolecular state in the solution by suppressing the formation of aggregates. In order to realize the monomolecular state in the aqueous solution, it is preferable to coexist with a surfactant, and the concentration thereof is 0.01.
The range of 5 to 5% by weight is preferable, and 0.04 to 2% by weight is more preferable.

Examples of the above-mentioned surfactants include ionic surfactants and nonionic surfactants, and among them, non-ionic surfactants such as Triton X-100, Tween, and Brij. Activators are particularly preferred. The tetraazaporphine thus obtained, which exhibits a monomolecular state in the aqueous solution, exhibits a sufficiently high fluorescence quantum yield (> 0.1) for use as a fluorescent labeling dye. In particular, it has high solubility in water and polar organic solvents, easy separation and purification during synthesis, and high fluorescence quantum yield (>
From the viewpoint of 0.29), it is particularly preferable to use the novel tetraazaporphine represented by the general formula (I).

The tetraazaporphine which can be used as the fluorescent labeling dye according to the present invention is not limited to the novel tetraazaporphine represented by the general formula (I) shown in Tables 1 to 6 but also the general formula (II). Included, eg Table 7-
Those shown in 9 can also be used.

[Table 7]

[0029]

[Table 8]

[0030]

[Table 9]

The above-mentioned fluorescent labeling dye can be used as a reagent for various fluorescence analyses. The reagent is, as described above,
Depending on the type of the dye, it is preferable to include a nonionic surfactant. In practice, the fluorescent labeling dye is bound to various substances to be used as a reagent depending on the purpose of analysis.
When used for immunoassay, the substance is various antigens (including haptens, drugs, etc.) and antibodies, and when used for DNA base sequence analysis or as a DNA probe for analysis, it is the DNA or nucleotide. .. Often used as a fluorescent label for biological substances, including these analyses. Examples of biological substances that can be labeled with the fluorescent labeling dye used in the present invention include proteins / peptides, nucleotides, saccharides, lipids, hormones, vitamins, alkaloids obtained from organisms such as animals, plants, microorganisms (including viruses), There are antibiotics, their composites, and the like, and these may be extracted from nature, artificially completely synthesized, or artificially semi-synthesized. Specific examples of proteins and peptides include serum albumin, IgG, IgA, and I.
Immunoglobulins such as gM, IgD and IgE, monoclonal antibodies against various proteins and membrane antigens of leukocytes,
Examples thereof include enzymes such as peroxidase, glucose oxidase, and alkaline phosphatase, and specific examples of nucleotides include DNA, RNA, synthetic oligonucleotides, synthetic polynucleotides, ATP, CTP, GTP,
TTP, UTP, dATP, dCTP, dGTP, dT
TP, dUTP, ddATP, ddCTP, ddGT
P, ddTTP, ddUTP, or derivatives thereof, and the like. Specific examples of the saccharide include glycogen,
In addition to polysaccharides such as starch and mannan, oligosaccharides and monosaccharides such as glucose and mannose are listed, lipids include phosphatidylcholine, phosphatidylethanolamine, fats and fatty acids, and hormones such as insulin, growth hormone and oxytocin. , Vasopressin, secretin, epidermal growth factor, gastrin, glucagon, calcitonin and other peptide hormones, androgens, estrogens, steroid hormones such as hydrocortisone, adrenaline, catecholamines such as noradrenaline, and the like, vitamin A, vitamins, and the like. Vitamins B ₁ , B ₂ , B ₆ , B ₁₂ , biotin, folic acid,
Examples include various vitamins such as vitamin C, vitamin D, and vitamin E. Examples of alkaloids include opiate alkaloids such as morphine, tropane alkaloids such as atropine and scopolamine, indole alkaloids such as vinblastine and vincristine, and isoquinoline alkaloids such as laurene. Examples of the antibiotic include penicillin, cephalosporin, kanamycin, erythromycin, chloramphenicol and the like.

In order to bind the bio-based substance and the fluorescent labeling dye, functional groups such as phosphoric acid group, carboxylic acid, amino group, hydroxyl group, thiol group in the bio-based substance and the carboxyl group in the fluorescent labeling dye, A functional group such as a sulfone group is directly bound by an ionic bond or a covalent bond, or a biological substance and a fluorescent labeling dye are bound to each other via a binding assisting group called a linker so as to facilitate the bond formation reaction. It is possible. The biological substance labeled with the fluorescent labeling dye can be purified by a conventional separation means such as a chromatography method or a recrystallization method.

The above-mentioned linker is required to be a group having at least two or more functional groups because it is necessary to form a bond with both the biological substance and the fluorescent labeling dye. For that purpose, diols, diamines, amino alcohols, dicarboxylic acids, dithiols, amino-carboxylic acids, hydroxy-carboxylic acids and the like can be used.

The fluorescent labeling dye of the present invention and the reagent containing the same can be used in various fluorescence analysis methods. Particularly when the novel compound represented by the general formula (I) is used among the fluorescent labeling dyes represented by the general formula (II), the semiconductor laser beam (670 to 840 nm) is efficiently absorbed and emits fluorescence. It is very useful for analysis of various antigens, drugs, DNA, etc., which is measured using an inexpensive and small semiconductor laser, or analysis of DNA base sequence (DNA sequencer).

[0035]

The present invention will be described below with reference to examples, but the present invention is not limited to these. Synthesis Example 1 [Synthesis of 3,4-bis (dibromomethyl) bromobenzene] 4-Bromo-o-xylene (75%) [Aldri
ch.] 37 g (0.2 mol) and N-bromosuccinimide 142.4 g (0.8 mol) in 500 ml of carbon tetrachloride were added with 1 g of benzoyl peroxide and placed in an internal irradiation tube (Ushio Denki Kogyo). It was irradiated with a high pressure mercury lamp (100 W) for 8 to 12 hours while refluxing. After cooling down,
The precipitated white crystals were removed by suction filtration, and the mother liquor carbon tetrachloride solution was concentrated under reduced pressure. The obtained solid was recrystallized from hexane / methylene chloride to obtain 64 g of 3,4-bis (dibromomethyl) bromobenzene as colorless crystals. Three
The physical properties of 4-bis (dibromomethyl) bromobenzene are shown below. (1) Melting point 108.5 to 110.5 ° C (2) Elemental analysis value: CH Br calculated value (%) 19.19 1.01 79.80 Analysis value (%) 19.12 0.88 79.84 (3) NMR spectrum value: CDCl ₃ solvent δ value 7.81 (1H, br-s) 7.57 (1H, d, J = 8.54 Hz) 7.50 (1H, dd, J = 8.54, 1.83 Hz) 7.06 (1H, s) 7.02 (1H, s) (4) The IR spectrum (KBr method) is shown in FIG.

Synthesis Example 2 [Synthesis of 6-bromo-2,3-dicyanonaphthalene]
3,4-bis (dibromomethyl) bromobenzene 10
0.2 g (0.2 mol), fumaronitrile 27 g
To a solution of (0.346 mol) in 800 ml of anhydrous N, N-dimethylformamide, 200 g (0.67 mol) of sodium iodide was added with thorough stirring, and the mixture was stirred under nitrogen atmosphere at about 75 ° C. for about 7 hours. After the reaction, the content was poured out into about 4 kg of ice. Sodium bisulfite was gradually added until the reddish brown aqueous solution became pale yellow, a slight excess of sodium bisulfite was added, and the mixture was stirred for a while and then left overnight at room temperature. The precipitated pale yellow solid was suction filtered and washed thoroughly with water and then methanol. The pale yellow solid was recrystallized from acetone / ethanol to obtain 33 g of colorless needle crystals. It was confirmed from the following analysis results that this crystal was 6-bromo-2,3-dicyanonaphthalene. (1) Melting point 254.5 to 255.5 ° C (2) Elemental analysis value: CHNBr calculated value (%) 56.06 1.96 10.90 31.08 analytical value (%) 55.99 1. 67 10.87 30.74 (3) NMR spectrum value: CDCl ₃ solvent (NMR spectrum is shown in FIG. 2) δ value 8.34 (1H, s) 8.27 (1H, s) 8.17 (1H, br-s) 7.88 (2H, m) (4) IR spectrum (KBr method) is shown in FIG.

Synthesis Example 3 [Synthesis of 6-bromo-1,3-diiminobenzo [f] isoindoline] Under a nitrogen atmosphere, anhydrous methanol 270 m
To a sodium methoxide-methanol solution prepared by adding 1.92 g (84 mmol) of metallic sodium to l in 6 times was added 6-bromo-2,3-dicyanonaphthalene 4.
4.1 g (0.17 mol) was added, and anhydrous ammonia gas was slowly bubbled for about 1 hour at room temperature while stirring well. About 3 while bubbling anhydrous ammonia gas
Reflux for hours. After cooling, the precipitated yellow solid was filtered, washed thoroughly with methanol, and dried under reduced pressure to give 6-bromo-
45 g of 1,3-diiminobenzo [f] isoindoline was obtained as a yellow solid. The IR spectrum of this 6-bromo-1,3-diiminobenzo [f] isoindoline is shown in FIG. 6-Bromo-1,3-diiminobenzo [f] isoindoline was used in the next reaction without further purification.

Synthesis Example 4 [Synthesis of dichlorosilicon-tetrabromonaphthalocyanine] 22.5 g (81.8 mmo) of 6-bromo-1,3-diiminobenzo [f] isoindoline under a nitrogen atmosphere.
1) Anhydrous tetralin 110 ml suspension was added to anhydrous tri-n.
-Butylamine 54 ml was added, followed by silicon tetrachloride 1
4.4 ml (0.126 mol) was added and the mixture was refluxed for about 3 hours. After cooling, 700 ml of methanol was added and left overnight. The reddish brown reaction mixture was filtered, thoroughly washed with methanol, and dried under reduced pressure to obtain about 20 g of dichlorosilicon-tetrabromonaphthalocyanine as a dark green solid. This dichlorosilicon-tetrabromonaphthalocyanine was used in the next reaction without further purification. The IR spectrum of dichlorosilicon-tetrabromonaphthalocyanine is shown in FIG. The electronic spectrum is shown in FIG.

Synthesis Example 5 [Synthesis of Dihydroxysilicon-Tetrabromonaphthalocyanine] 9.7 g (8.6 mmol) of dichlorosilicon-tetrabromonaphthalocyanine was added to 250 ml of concentrated sulfuric acid.
In addition, stirred for about 2 hours. The reaction mixture is iced to about 8
Pour into 00g and let stand overnight. The deposited precipitate is filtered,
After thoroughly washing with water and then with methanol, the precipitate was refluxed in 180 ml of concentrated aqueous ammonia for about 1 hour. After allowing to cool, it is suction filtered, thoroughly washed with water, methanol and then acetone, and dried under reduced pressure to give 8.7 g of dihydroxysilicon-tetrabromonaphthalocyanine as a dark green solid.
Was obtained. This dihydroxysilicon-tetrabromonaphthalocyanine was used in the next reaction without further purification. The IR spectrum of dihydroxysilicon-tetrabromonaphthalocyanine is shown in FIG. The electronic spectrum is shown in FIG.

Synthesis Example 6 [Synthesis of bis (tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine] 2.82 g (2.6) of dihydroxysilicon-tetrabromonaphthalocyanine
280 ml of anhydrous β-picoline suspension of 8 mmol (33.mmol) of anhydrous tri-n-butylamine under a nitrogen atmosphere.
6 mmol) and then 7.2 ml (32.8 mmol) of tri-n-propylchlorosilane were added, and the mixture was refluxed for about 2 hours. After cooling, the mixture is mixed with ethanol / water (1/1) 60
It was poured into 0 ml, stirred well, and left overnight. The deposited precipitate was filtered and washed with water. Only the soluble portion of this precipitate was dissolved using hot chloroform, the chloroform solution was dried over anhydrous sodium sulfate, purified by silica gel column chromatography, and recrystallized from chloroform to give dark green crystals of 0.82.
g was obtained. It was confirmed from the following analysis results that the dark green crystals were bis (tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine. (1) Melting point 300 ° C. or higher (2) Elemental analysis value: CHNBr calculated value (%) 56.50 4.45 7.99 22.78 Analytical value (%) 56.28 4.39 8.04 22 .45 (3) NMR spectrum value (NMR spectrum is shown in FIG. 9): CDCl ₃ δ value 10.08 (4H, br-s) 10.01 (4H, br-s) 8.82 (4H, br- s) 8.54 (4H, dd, J = 8.85, 3.05Hz) 8.00 (4H, d, J = 8.85Hz) -0.29 (18H, t, J = 7.17Hz)- 0.90 (12H, sextet-like m) -2.08 (12H, t-like m) (4) electronic spectrum (CHCl ₃ solution) is shown in FIG. 10. (5) The IR spectrum (KBr method) is shown in FIG.

Synthesis Example 7 [Synthesis of bis (tri-n-butylsiloxy) silicon-tetrabromonaphthalocyanine] 2.82 g (2.6 m) of dihydroxysilicon-tetrabromonaphthalocyanine
280 ml of anhydrous tri-n-butylamine and then 8.8 ml (32.8) of tri-n-butylchlorosilane.
(mmol) and refluxed for about 2 hours. After cooling, the reaction mixture was treated in the same manner as in Synthesis Example 6 and recrystallized from chloroform to obtain 0.75 g of dark green crystals. It was confirmed from the following analysis results that the dark green crystals were bis (tri-n-butylsiloxy) silicon-tetrabromonaphthalocyanine. (1) Melting point 300 ° C. or higher (2) Elemental analysis value: C H N Br calculated value (%) 58.14 5.02 7.53 21.49 Analytical value (%) 58.36 5.11 7.521 21 .03 (3) NMR spectrum value (NMR spectrum is shown in FIG.
): CDCl ₃ δ value 10.09 (4H, br-s) 10.02 (4H, br-s) 8.85 (4H, br-s) 8.55 (4H, dd, J = 8. 85, 3.05 Hz) 8.01 (4H, d, J = 8.85 Hz) 0.02 (30H, m) -0.99 (12H, sextet-like m) -2.07 (12H, t-like). m) (4) Electronic spectrum (CHCl ₃ solution) is shown in FIG. 13. (5) IR spectrum (KBr method) is shown in FIG.

Synthesis Example 8 [Synthesis of bis (tri-n-hexylsiloxy) silicon-tetrabromonaphthalocyanine] 2.82 g (2.6) of dihydroxysilicon-tetrabromonaphthalocyanine
280 ml of anhydrous β-picoline in 8 ml (33.6 mmol) of anhydrous tri-n-butylamine, and then 12 ml of tri-n-hexylchlorosilane (32.
8 mmol) was added and the mixture was refluxed for about 2 hours. After cooling, the reaction mixture was treated as in Synthesis Example 6 and recrystallized from hexane / chloroform to give 0.78 dark green crystals.
g was obtained. It was confirmed from the following analysis results that the dark green crystals were bis (tri-n-hexylsiloxy) silicon-tetrabromonaphthalocyanine. (1) Melting point 298 to 300 ° C. (2) Elemental analysis value: CHNBr calculated value (%) 60.94 5.97 6.77 19.30 Analytical value (%) 60.77 5.71 6.65 19.02 (3) NMR spectrum value (NMR spectrum is shown in FIG.
): CDCl ₃ δ value 10.06 (4H, br-s) 10.00 (4H, br-s) 8.83 (4H, br-s) 8.53 (4H, dd, J = 8. 85, 2.44Hz) 7.99 (4H, dd, J = 8.85Hz) 0.63 (12H, sextet, J = 7.32Hz) 0.45 (18H, t, J = 7.32Hz) 0. 22 (18H, quintet, J = 7.32H
z) 0.05 (12H, quintet, J = 7.32H
z) -1.02 (12H, quintet- like m) -2.10 (12H, t-like m) (4) Electronic spectrum (CHCl ₃ solution) is shown in FIG. 16. (5) The IR spectrum (KBr method) is shown in FIG.

Synthesis Example 9 [Synthesis of bis (triethylsiloxy) silicon-tetrabromonaphthalocyanine] 2.82 g (2.6 mmo) of dihydroxysilicon-tetrabromonaphthalocyanine
10 ml (65 mmol) of triethylsilanol was added to a 100 ml suspension of quinoline of l), and the mixture was refluxed for about 3 hours. After cooling, the reaction mixture was mixed with ethanol / water (1/1) 5
It was poured into 00 ml, stirred well, and left overnight. The deposited precipitate was filtered and thoroughly washed with methanol and then with chloroform. The crystals thus obtained were washed with chloroform by the Soxhlet extraction method to give dark green crystals of 2.
1 g was obtained. The dark green crystals were confirmed to be bis (triethylsiloxy) silicon-tetrabromonaphthalocyanine by the following analysis results. (1) Melting point of 300 ° C. or higher (2) Elemental analysis value: CHNBr calculated value (%) 54.64 3.82 8.50 24.23 Analytical value (%) 54.18 3.62 8.81 23 .94 (3) NMR spectrum value: CDCl ₃ δ value 10.07 (4H, br-s) 10.00 (4H, br-s) 8.83 (4H, br-s) 8.54 (4H, dd) , J = 8.85, 3.05 Hz) 8.01 (4H, d, J = 8.85 Hz) -1.04 (18H, t, J = 7.32 Hz) -2.05 (12H, q, J = 7.32 Hz) (4) The electronic spectrum (CHCl ₃ solution) is shown in FIG. (5) IR spectrum (KBr method) is shown in FIG.

Synthesis Example 10 [Synthesis of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine] Bis (tributylsiloxy) silicon-tetrabromonaphthalocyanine 5 g
(3.36 mmol), 2.5 g of phenylthiolated copper (1
A suspension of 4.47 mmol) of quinoline in 50 ml of 160
The mixture was stirred at 1 ° C for 1 hour and further at 180 ° C for 5 hours. After cooling, the reaction mixture was added with methanol / water (1/1) 400 ml.
Poured out. After stirring for a while, the mixture was left overnight at room temperature. The precipitated solid was filtered and washed with methanol. Of the solid obtained, only the component soluble in toluene was dissolved out using hot toluene, separated and purified by silica gel column chromatography (developing solvent: hexane / toluene (1/1)), and then purified from methylene chloride / ethanol. By recrystallization, bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine was obtained as green crystals (3.03 g, 56%). This crystal was confirmed to be bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine by the following analysis results. (1) Elemental analysis value: C H N S calculation value (%) 71.87 5.91 6.98 7.99 Analysis value (%) 71.92 6.02 7.04 7.49 (2) NMR spectrum Value: (NMR spectrum is shown in FIG.
0): CDCl ₃ δ value 9.99 (4H, d, J = 3.66Hz) 9.89 (4H, br-s) 8.53 (4H, d, J = 8.85Hz) 8.46 (4H, br-s) 7.76 (4H, dd, J = 8.85, 1.22Hz) 7.65 (8H, m) 7.50 (12H, m) -0.02 (30H, m) -0.99 (12H, quintet-likem) -2.09 (12H, t-likem) (3) Melting point 293 to 295 ° C (4) The electronic spectrum (methylene chloride solution) is shown in FIG. (5) IR spectrum (KBr method) is shown in FIG.

Synthesis Example 11 {Synthesis of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2'-ethylhexyloxycarbonyl) ethylthio] naphthalocyanine} bis (tri-n-propylsiloxy) silicon-tetrabrom Organic solution of monaphthalocyanine 140mg (0.1mmol) in quinoline 10ml and pyridine 3.2ml.
Synthesis (Organic Syntheses),
Vol.42, p.22-
(2'-Ethylhexyloxycarbonyl) ethylthiolated cuprous (2.47 g, 8.8 mmol) was added, and
Refluxed at 170 ° C. for 8 hours. After left to cool, the content was synthesized as in Example 1.
When treated in the same manner as 0, 46 mg (24
%) Obtained. It was confirmed from the following analysis results that the yellow green crystals were bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2'-ethylhexyloxycarbonyl) ethylthio] naphthalocyanine. (1) Melting point 125-127 ° C. (2) Elemental analysis value: CHN calculated value (%) 67.65 7.54 5.74 Analysis value (%) 67.89 7.42 5.65 (3) NMR Spectral value (NMR spectrum is shown in FIG.
): CDCl ₃ δ value 10.04 (4H, br-s) 10.00 (4H, br-s) 8.57 (4H, d, J = 8.85Hz) 8.53 (4H, br- s) 7.84 (4H, d, J = 8.85Hz) 4.14 (8H, d, J = 5.80Hz) 3.56 (8H, t, J = 7.33Hz) 2.93 (8H, t, J = 7.33 Hz) 0.7 to 1.8 (36 H, m) 0.94 (36 H, m) -0.27 (18 H, t, J = 7.33 Hz) -0.87 (12 H, sextet-like m) -2.08 (12H , t-like m) (4) electronic spectrum (CHCl ₃ solution) is shown in Figure 24. (5) The IR spectrum (KBr method) is shown in FIG.

Synthesis Example 12 {Synthesis of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2 ', 2', 4 ', 4'-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine]} bis (Tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine 140 mg
(0.1 mmol) of quinoline in 10 ml and pyridine in 3.2 ml was added to organic synthesis (Orga).
(2 ', 2', 4 ', 4 synthesized by referring to the method described in Vol. 42, page 22).
???-Tetramethylpentyloxycarbonyl) ethylthioated cuprous (2.59 g, 8.8 mmol) was added and 160
Reflux at ~ 170 ° C for 8 hours. After allowing to cool, the content was treated in the same manner as in Synthesis Example 10 to yield 52 mg (2
6%) was obtained. The yellow-green crystals were bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2 ', 2', 4 ', 4'-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine according to the following analysis results. I confirmed that there is. (1) Melting point 131-133 ° C. (2) Elemental analysis value: CHN calculated value (%) 68.15 7.73 5.58 analysis value (%) 68.13 7.65 5.37 (3) NMR Spectral value (NMR spectrum is shown in FIG.
): CDCl ₃ δ value 10.05 (4H, br-s) 10.01 (4H, br-s) 8.57 (4H, d, J = 8.55Hz) 8.54 (4H, br- s) 7.84 (4H, d, J = 8.55Hz) 4.24 (8H, t, J = 6.56Hz) 3.57 (8H, t, J = 7.33Hz) 2.93 (8H, t, J = 7.33 Hz) 1.01 (8H, d, J = 5.5 Hz) 0.94 (60H, br-s) -0.26 (18H, t, J = 7.33 Hz) -0. 85 (12H, sextet-like m) -2.06 (12H, t-like m) (4) electronic spectrum (CHCl ₃ solution) is shown in Figure 27. (5) IR spectrum (KBr method) is shown in FIG.

Synthesis Example 13 [Synthesis of methyl 3,4-dimethylbenzoate] 47.6 g (0.317 mol) of 3,4-dimethylbenzoic acid was added to 200 ml of methanol, and in the presence of about 6 ml of concentrated sulfuric acid.
The mixture was refluxed for about 4 hours while being dehydrated with Molecular Sieves 3A (a desiccant manufactured by Wako Pure Chemical Industries, Ltd.). After cooling down, water 6
00 ml was added, and the mixture was extracted 3 times with about 200 ml of benzene. The benzene solution was washed 3 times with a saturated aqueous sodium hydrogen carbonate solution and then 3 times with water, and anhydrous sodium sulfate was added to dry the solution. When the benzene solution is concentrated and then distilled under reduced pressure, it has a boiling point of 133 to 134 ° C./30 mmHg of 49.4.
g of a colorless liquid was obtained. From the following analysis results, it was confirmed that this liquid was methyl 3,4-dimethylbenzoate. (2) NMR spectrum value: CDCl ₃ solvent δ value 7.81 (1H, br-s) 7.76 (1H, dd, J = 7.93, 1.53 Hz) 7.18 (1H, d, J = 7.93 Hz) 3.89 (3H, s) 2.30 (6H, s) (3) IR spectrum (coating method) is shown in FIG. About 1
It has absorption at around 710 cm ⁻¹ due to the C═O stretching vibration of the ester.

Synthesis Example 14 [Synthesis of 6-methoxycarbonyl-2,3-dicyanonaphthalene] Methyl 3,4-dimethylbenzoate 33.8 g
(0.2 mol) and N-bromosuccinimide 14
1 g of benzoyl peroxide was added to a solution of 2.2 g (0.8 mol) of carbon tetrachloride in 1 ml of benzoyl peroxide, and light was irradiated with a high pressure mercury lamp (100 W) for 8 to 12 hours while refluxing in an internal irradiation tube. After allowing to cool, the precipitated white crystals are removed by suction filtration,
The carbon tetrachloride solution of the mother liquor was concentrated under reduced pressure. The obtained solid was recrystallized from hexane / methylene chloride to obtain 79 g of methyl 3,4-bis (dibromomethyl) benzoate as colorless crystals. The physical properties of methyl 3,4-bis (dibromomethyl) benzoate are shown below. (1) Melting point 99.5 to 100.5 ° C (2) Elemental analysis value: CH Br calculated value (%) 25.03 1.68 66.62 Measured value (%) 25.07 1.54 65.72 (3) NMR spectrum value: CDCl ₃ solvent δ value 8.29 (1H, br-s) 8.03 (1H, dd, J = 8.24, 1.53Hz) 7.81 (1H, d, J = 8.24 Hz) 7.18 (1H, br-s) 7.09 (1H, br-s) 3.96 (3H, s) (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1705 cm ⁻¹ due to the C═O stretching vibration of the ester. Next, 48 g (0.1 mol) of the obtained methyl 3,4-bis (dibromomethyl) benzoate, fumaronitrile 1
To a solution of 3.5 g (0.173 mol) of anhydrous N, N-dimethylformamide in 400 ml, 100 g (0.67 mol) of sodium iodide was added with thorough stirring,
The mixture was stirred under a nitrogen atmosphere at about 75 ° C. for about 7 hours. After the reaction, the content was poured out into about 2 kg of ice. Sodium bisulfite was gradually added until the reddish brown aqueous solution became pale yellow, a slight excess of sodium bisulfite was added, and the mixture was stirred for a while and then left overnight at room temperature. The precipitated pale yellow solid was suction filtered and washed thoroughly with water and then methanol. The pale yellow solid was recrystallized from acetone / methanol to obtain 13.9 g of colorless needle crystals. This crystal was confirmed to be 6-methoxycarbonyl-2,3-dicyanonaphthalene from the following analysis results. (1) Melting point 264 to 265 ° C. (2) Elemental analysis value CHN calculated value (%) 71.18 3.41 11.86 Measured value (%) 71.21 3.37 11.87 (3) NMR spectrum Value: CDCl ₃ solvent δ value 8.72 (1H, br-s) 8.47 (1H, s) 8.41 (1H, s) 8.38 (1H, dd, J = 8.55,1.53Hz ) 8.06 (1H, d, J = 8.55Hz) 4.04 (3H, s) (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1700 cm ^{-1 due} to the C = O stretching vibration of the ester.

Synthesis Example 15 [Synthesis of n-amyl 3,4-dimethylbenzoate] 3,4
-Dimethylbenzoic acid 60 g (0.4 mol), n-amyl alcohol 43 ml (0.4 mol), p-toluenesulfonic acid monohydrate 22 g (0.116 mol) were added to benzene 150 ml, Dean Stark, and then molecular. The mixture was refluxed for about 6 hours while dehydrating with Sieves 3A. After allowing to cool, saturated sodium hydrogen carbonate aqueous solution 100 m
The reaction mixture was washed 3 times with 1 and then 3 times with water. The benzene solution of the reaction mixture was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. Distilling the oil under reduced pressure gives 14
77 g of colorless liquid was obtained at 5 to 148 ° C./8 mmHg.
From the following analysis results, it was confirmed that this liquid was n-amyl 3,4-dimethylbenzoate. (2) NMR spectrum value: CDCl ₃ solvent δ value 7.81 (1H, br-s) 7.77 (1H, dd, J = 7.94, 1.98Hz) 7.18 (1H, d, J = 7.94 Hz) 4.29 (2H, t, J = 6.72 Hz) 2.30 (6H, s) 1.76 (2H, quintet, J = 6.72 Hz) 1.40 (4H, m) 0. 93 (3H, t, J = 6.72 Hz) (3) IR spectrum (coating method) is shown in FIG. About 1
It has absorption at around 710 cm ⁻¹ due to the C═O stretching vibration of the ester.

Synthesis Example 16 [Synthesis of 6- (n-amyloxycarbonyl) -2,3-dicyanonaphthalene] 44.1 g (0.2 mol) of n-amyl 3,4-dimethylbenzoate and N-bromosuccinic acid Imide 142.4 g (0.8 mol) of carbon tetrachloride 5
1 g of benzoyl peroxide was added to a 00 ml solution, and a high-pressure mercury lamp (100
W). After cooling, the precipitated white crystals were removed by suction filtration, and the carbon tetrachloride solution of the mother liquor was sufficiently concentrated under reduced pressure. The obtained pale brown oily substance was dissolved in 800 ml of anhydrous N, N-dimethylformamide, and 27 g (0.346 mol) of fumaronitrile, and then 200 g (1.34 mol) of sodium iodide while stirring well.
Was added and the mixture was stirred under a nitrogen atmosphere at 75 ° C. for about 7 hours.
After the reaction, sodium bisulfite was gradually added until the reddish brown aqueous solution poured into about 4 kg of ice turned pale yellow, a slight excess of sodium bisulfite was added, and the mixture was stirred for a while, then at room temperature overnight. I left it. The precipitated pale yellow solid was suction filtered, washed thoroughly with water, and then washed several times with methanol. The pale yellow solid was dissolved in about 500 ml of chloroform, the chloroform layer was separated from the aqueous layer, and then dried over anhydrous magnesium sulfate. The chloroform solution was concentrated under reduced pressure and recrystallized twice from chloroform / ethanol to give 20 g of colorless needle crystals. It was confirmed from the following analysis results that this crystal was 6- (n-amyloxycarbonyl) -2,3-dicyanonaphthalene. (1) Melting point 150 to 152 ° C (2) Elemental analysis value: CHN calculated value (%) 73.95 5.52 9.52 Measured value (%) 73.82 5.38 9.51 (3) NMR Spectral value: CDCl ₃ solvent δ value 8.70 (1H, br-s) 8.49 (1H, s) 8.41 (1H, s) 8.38 (1H, dd, J = 8.55, 1. 53 Hz) 8.06 (1H, d, J = 8.55 Hz) 4.43 (2H, t, J = 6.72 Hz) 1.84 (2H, quitet, J = 6.72 Hz) 1.44 (1H, m) 0.96 (3H, t, J = 6.72Hz) (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1700 cm ^{-1 due} to the C = O stretching vibration of the ester.

Synthesis Example 17 [Synthesis of n-octyl 3,4-dimethylbenzoate] 3.
40 g (0.27 mol) of 4-dimethylbenzoic acid, n-
Octanol 100 ml (0.635 mol), p-toluenesulfonic acid monohydrate 22 g (0.116 mo)
l) was added to 100 ml of benzene and dehydrated with Dean Stark followed by Molecular Sieves 3A,
Refluxed for about 6 hours. After cooling, the reaction mixture was treated in the same manner as in Synthesis Example 15 and distilled under reduced pressure to give a boiling point of 148 to 152.
60.5 g of colorless liquid was obtained at ℃ / 3mmHg. From the analysis results described below, this liquid is 3,4-dimethylbenzoic acid n
-Confirmed to be octyl. (2) NMR spectrum value: CDCl ₃ solvent δ value 7.81 (1H, br-s) 7.77 (1H, dd, J = 7.63, 1.83Hz) 7.19 (1H, d, J = 7.63 Hz) 4.29 (2H, t, J = 6.72 Hz) 2.31 (6H, s) 1.76 (2H, quintet, J = 6.72 Hz) 1.1-1.5 (10H, m) 0.88 (3H, t, J = 6.72Hz) (3) IR spectrum (coating method) is shown in FIG. 34. About 1
It has absorption at around 710 cm ⁻¹ due to the C═O stretching vibration of the ester.

Synthesis Example 18 [Synthesis of 6- (n-octyloxycarbonyl) -2,3-dicyanonaphthalene] 3,4-dimethylbenzoic acid n-
12.5 g of benzoyl peroxide was added to 500 ml of a carbon tetrachloride solution containing 52.5 g (0.2 mol) of octyl and 142.2 g (0.8 mol) of N-bromosuccinimide, and high pressure was applied for about 11 hours while refluxing in an internal irradiation tube. Mercury lamp (100
W). After allowing to cool, the reaction mixture was treated in the same manner as in Synthesis Example 16, reacted with fumaronitrile, treated, and recrystallized several times from chloroform / ethanol to give about 7 g of colorless needle crystals. It was confirmed from the following analysis results that this crystal was 6- (n-octyloxycarbonyl) -2,3-dicyanonaphthalene. (1) Melting point 142-144 ° C. (2) Elemental analysis value: C H N calculated value (%) 75.42 6.63 8.38 Measured value (%) 75.20 6.41 7.99 (3) NMR Spectral value: CDCl ₃ solvent δ value 8.70 (1H, br-s) 8.49 (1H, s) 8.42 (1H, s) 8.38 (1H, dd, J = 8.55, 1. 52 Hz) 8.06 (1H, d, J = 8.55 Hz) 4.42 (2H, t, J = 6.72 Hz) 1.83 (2H, quintet, J = 6.72 Hz) 1.2-1. 6 (10H, m) 0.89 (3H, t, J = 6.72Hz) (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1700 cm ^{-1 due} to the C = O stretching vibration of the ester.

Synthesis Example 19 [Synthesis of zinc tetra (n-amyloxycarbonyl) naphthalocyanine] 6- (n-amyloxycarbonyl)-
1.46 g of 2,3-dicyanonaphthalene (5 mmo
l), powder zinc 105 mg (1.6 mmol), ammonium molybdate 10 mg and urea 5 g about 220
The reaction was carried out while stirring well at ℃ for about 2.5 hours. After allowing to cool, 40 ml of 5% hydrochloric acid was added to the solidified reaction mixture, the mixture was loosened to some extent, and then thoroughly stirred at about 50 ° C. for 30 minutes. After stirring, the insoluble material was suction filtered and thoroughly washed with water, methanol, and then acetone. The obtained solid was subjected to Soxhlet extractor extraction for about 50 hours by using a mixed solvent of methanol / acetone (1/1) as a solvent. Next, the solvent was changed to chloroform, and Soxhlet extraction was performed for 20 hours. The obtained dark green chloroform solution was suction filtered while hot and then concentrated to dryness under reduced pressure to obtain 937 mg of glossy black crystals. It was confirmed from the following analysis results that this crystal was zinc tetra (n-amyloxycarbonyl) naphthalocyanine. (1) Melting point> 300 ° C. (stable at least at 300 ° C. or lower) (2) Elemental analysis value: C H N calculated value (%) 70.04 5.22 9.08 Measured value (%) 69.35 5.22 9.08 (3) The electronic spectrum (CHCl ₃ solution) is shown in FIG. 36. (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1700 cm ^{-1 due} to the C = O stretching vibration of the ester.

Synthesis Example 20 [Synthesis of chloroaluminum tetra (n-octyloxycarbonyl) naphthalocyanine] 6- (n-octyloxycarbonyl) -2,3-dicyanonaphthalene 1.67
g (5 mmol), aluminum chloride 213 mg (1.
6 mmol), 10 mg of ammonium molybdate and 5 g of urea were reacted at about 220 ° C. for about 2.5 hours while thoroughly stirring. After allowing to cool, 40 ml of methanol was added to the solidified reaction mixture to loosen it to some extent, and then about 50 ° C.
I stirred well for 30 minutes. After stirring, the insoluble matter was suction filtered and thoroughly washed with methanol and then acetone. Impurities were extracted from the obtained solids in a Soxhlet extractor using methanol as a solvent for about 100 hours and then using acetone for about 50 hours. next,
Soxhlet extraction was changed to about 2 by changing the solvent to chloroform.
It was run for 0 hours. The resulting dark green chloroform solution was suction filtered while hot and then concentrated to dryness under reduced pressure to obtain 243 mg of glossy black crystals. It was confirmed from the following analysis results that this crystal was chloroaluminum tetra (n-octyloxycarbonyl) naphthalocyanine. (1) Melting point> 300 ° C. (stable at least at 300 ° C. or lower) (2) Elemental analysis value: C H N Cl calculated value (%) 72.06 6.34 8.00 2.53 Measured value (%) 71. 81 6.27 7.74 2.07 (3) The electronic spectrum (CHCl ₃ solution) is shown in FIG. 38. (4) IR spectrum (KBr method) is shown in FIG. It has an absorption at around 1700 cm ^{-1 due} to the C = O stretching vibration of the ester.

Synthesis Example 21 [Synthesis of 6-chloro-2,3-dicyanoquinoxaline]
5 g (46.3 mmol) of diaminomaleonitrile, 5 g (41.5 mmol) of anhydrous magnesium sulfate and 15 g (170.3 mmol) of active manganese dioxide were added to 300 ml of ethyl acetate, and ultrasonic irradiation was performed at about 45 ° C. for 30 hours. The reaction mixture was filtered and washed thoroughly with ethyl acetate. The pale yellow mother liquor was concentrated and separated and purified using silica gel-column chromatography (developed with hexane / ethyl acetate = 75/25) to give 2.90 g (59
%) Of diiminosuccinonitrile was obtained as colorless crystals. Diiminosuccinonitrile 0.5g (4.7mm
ol) and 4-chloro-1,2-phenylenediamine 0.
67 g (4.7 mmol) of the mixture is gradually added into 10 ml of trifluoroacetic acid at about 20 ° C. over 30 minutes,
After stirring at room temperature for 8 hours, the mixture was left overnight. 50 ml of water was added to the reaction mixture, and the precipitated solid was filtered and thoroughly washed with water. The obtained solid was dried under reduced pressure and then subjected to silica gel column chromatography (hexane / ethyl acetate (75/2
5) Development of 6-chloro-2 as colorless crystals by recrystallization from chloroform / ethanol.
0.6 g (59%) of 3-dicyanoquinoxaline was obtained. (1) NMR spectrum value: CDCl ₃ solvent δ value 8.28 (1H, d, J = 2.13 Hz) 8.23 (1H, d, J = 9.16 Hz) 8.04 (1H, dd, J =) 9.16, 2.13 Hz) (2) Melting point 188-189 ° C. (3) IR spectrum (KBr method) is shown in FIG.

Synthetic Example 22 [Synthesis of dihydroxysilicon-tetrachloroquinoxalocyanine] Under a nitrogen atmosphere, 6 ml of a methanol solution of sodium methoxide prepared by adding 0.12 g (5.4 mmol) of metal nalium to 72 ml of anhydrous methanol was prepared. -Chloro-2,3-dicyanoquinoxaline 5.97 g (2
7.8 mmol) was added, and anhydrous ammonia gas was bubbled for about 1 hour at room temperature while stirring well. Further, the mixture was refluxed for about 3 hours while bubbling anhydrous ammonia gas. After cooling, the contents were filtered, washed thoroughly with methanol, and dried under reduced pressure to give 6-chloro-
5.23 g of an isoindoline derivative of 2,3-dicyanoquinoxaline was obtained. This isoindoline derivative is
It was used for the next reaction without further purification. Under a nitrogen atmosphere,
5.1 g (22.0 mmo) of the above isoindoline derivative
1) Silicon tetrachloride was added to a suspension of 108 ml of anhydrous quinoline.
0 ml (90 mmol) was added and the mixture was refluxed for about 3 hours. After allowing to cool, the reaction mixture was poured into 300 ml of methanol and left overnight at room temperature. The deposited solid was filtered, thoroughly washed with methanol, and then dried under reduced pressure to obtain a black solid quantitatively. 6 g of this black solid was added to ethanol (10
0 ml), further 100 ml of ammonia water was added, and the mixture was refluxed for about 5 hours. After cooling, the content was filtered, washed thoroughly with methanol, and dried under reduced pressure to obtain 4.5 g of a black solid. This black solid, considered to be dihydroxysilicon-tetrachloroquinoxalocyanine, was used in the next reaction without further purification.

Synthesis Example 23 [Synthesis of bis (tributylsiloxy) silicon-tetrachloroquinoxalocyanine] 1 g (1.09 mmo) of dihydroxysilicon-tetrachloroquinoxalocyanine
l) and 2 ml of tributylsilanol (9.24 mmo
l) was stirred in 20 ml of quinoline at 200 ° C. for 4 hours. After allowing to cool, the reaction mixture was poured into 100 ml of methanol, stirred well and allowed to stand. The precipitated solid was filtered and thoroughly washed with methanol. Of the solid, only the soluble one was dissolved out using hot chloroform, and the chloroform solution was recrystallized from alumina column chromatography and then chloroform-methanol to obtain 108 mg of dark green crystals. From the electronic spectrum (FIG. 41), it was confirmed that this dark green crystal was bis (tributylsiloxy) silicon-tetrachloroquinoxalocyanine. Elemental analysis value: CHNCl calculated value (%) 58.35 5.05 17.01 10.76 Analytical value (%) 58.51 5.08 17.32 10.99

Synthesis Example 24 [Synthesis of bis (tributylsiloxy) silicon-octabromophenanthracyanine] Using 4-bromophenylacetonitrile as a raw material (Synthetic)
Metals, Vol. 9, 329-340 (1984).
)) And 1 g (0.62 mmol) of dihydroxysilicon-octabromophenanthracyanin and 1 ml (4.62 mmol) of tributylsilanol synthesized according to the method described in Synthesis Examples 3, 4 and 5 and 20 ml of quinoline.
The mixture was stirred at 200 ° C. for 5 hours. After allowing to cool, the reaction mixture was poured into 100 ml of methanol, stirred well and allowed to stand. The precipitated solid was filtered and thoroughly washed with methanol. Only the soluble one of the solids was dissolved out with hot chloroform and recrystallized from chloroform to obtain 482 mg of dark green crystals. It was confirmed from the following analysis results that the dark green crystals were bis (tributylsiloxy) silicon-octabromophenanthracyanin. Elemental analysis value: CHNBr calculated value (%) 52.77 3.92 5.59 31.91 analytical value (%) 52.54 3.87 5.46 32.11

Synthesis Example 25 [Synthesis of bis (tributylsiloxy) silicon-octabromoanthracyanin] Document (Monatshft
e fur Chemie Volume 117, 475-48
P. 9 (1986), J. pract. Chem. Third
29, S 365-373 (1987) and Khi.
m. Geterotsikl. Soedin 274-
Dihydroxysilicon-octabromoanthracyanine can be obtained from 9,10-dibromo-2,3-dicyanoanthracene synthesized according to the method described in page 278 (1972) according to Synthesis Examples 3, 4 and 5. .. Dihydroxysilicon-octabromoanthracyanin 1g
(0.62 mmol) and 1 ml of tributylsilanol
(4.62 mmol) in 20 ml of quinoline at 200 ° C
It was stirred for 5 hours. After allowing to cool, the reaction mixture was poured into 100 ml of methanol, stirred well and allowed to stand. The precipitated solid was filtered and thoroughly washed with methanol. Only the soluble one of the solids was dissolved out using hot chloroform and recrystallized from chloroform to obtain 378 mg of black brown crystals. It was confirmed from the analysis results below that the black brown crystals were bis (tributylsiloxy) silicon-octabromoanthracyanin. Elemental analysis value: CHNBr calculated value (%) 52.77 3.92 5.59 31.91 analytical value (%) 52.94 4.01 5.78 32.20

Synthesis Example 26 [Synthesis of bis (tributylsiloxy) silicon-tetrabromo (1,2-naphthalocyanine)] Document (Che
m. Ber. 121, 1479-1486 (19
1988)).
Synthesis Examples 3, 4 and 5 from 1,2-dicyanonaphthalene
Dihydroxysilicon-tetrabromo (1,2
-Naphthalocyanine). Dihydroxy silicone-
Tetrabromo (1,2-naphthalocyanine) 1 g (0.
92 mmol) and 2 ml of tributylsilanol (9.
24 mmol) was stirred in 20 ml of quinoline at 200 ° C. for 4 hours. After allowing to cool, the reaction mixture was mixed with methanol 10
It was poured into 0 ml, stirred well and left to stand. The precipitated solid was filtered and thoroughly washed with methanol. Only the soluble one of the solids was dissolved out using hot chloroform and recrystallized from chloroform to obtain 405 mg of black green crystals. From the following analysis results, it was confirmed that the black green crystals were bis (tributylsiloxy) silicon-tetrabromo (1,2-naphthalocyanine). Elemental analysis value: C H N Br calculated value (%) 58.14 5.02 7.53 21.49 Analytical value (%) 57.83 4.93 7.36 21.18

Synthesis Example 27 [Synthesis of bis (tributylsiloxy) silicon-tetrabromoquinolocyanine] Document (USP 4,459,40
9 (1984) and Khim. Geterotsik
l. Soedin pp. 274-278 (1972))
6-Bromo-2,3-synthesized by referring to the described method
By treating dicyanoquinoline according to Synthesis Examples 3, 4 and 5, dihydroxysilicon-tetrabromoquinolocyanine was obtained. 1 g (0.91 mmol) of dihydroxysilicon-tetrabromoquinocyanine and 2 ml (9.24 mmol) of tributylsilanol were stirred in 20 ml of quinoline at 200 ° C. for 5 hours.
After allowing to cool, the reaction mixture was poured into 100 ml of methanol, stirred well and allowed to stand. The precipitated solid was filtered and thoroughly washed with methanol. Only the soluble one of this solid was dissolved out with hot chloroform and recrystallized from chloroform to give a black green crystal of 45
2 mg was obtained. From the electronic spectrum (FIG. 42), it was confirmed that this black-green crystal was bis (tributylsiloxy) silicon-tetrabromoquinocyanine. Elemental analysis value: CHNBr calculated value (%) 54.77 4.73 11.27 21.43 Analysis value (%) 54.85 4.76 11.34 21.27

Synthesis Example 28 [Synthesis of 2,3-dicyano-6- (3 ', 5'-dimethoxycarbonylphenylthio) naphthalene] 10 g of 6-bromo-2,3-dicyanonaphthalene obtained in Synthesis Example 2
(38.9 mmol) and 3,5-dimethoxycarbonylphenylthiolated copper (I) 12.9 g (44.7 mmo).
l) was stirred in 200 ml of quinoline at 160 ° C. for 10 hours. After left to cool, the contents are methanol / water (1/1) 6
Poured into 00 ml and left overnight. The deposited precipitate was filtered and thoroughly washed with methanol. The obtained solid was transferred to a Soxhlet extractor and extracted with acetone for 20 hours. After concentrating the acetone solution, methanol was added, and the precipitated solid was filtered and thoroughly washed with methanol. The obtained solid is subjected to silica gel column chromatography (developing solvent:
Purification with ethyl acetate) followed by recrystallisation from acetone gave 4.32 g of colorless crystals. This crystal shows that 2,3-dicyano-6-
It was found to be (3 ', 5'-dimethoxycarbonylphenylthio) naphthalene. (1) Melting point 222-224 ° C. (2) Elemental analysis value: C H N S calculation value (%) 65.66 3.51 6.96 7.97 Analysis value (%) 65.93 3.60 7.18 8.02 (3) NMR spectrum value: CDCl ₃ solvent δ value: 8.71 (1H, t, J = 1.53 Hz) 8.35 (2H, d, J = 1.53 Hz) 8.29 (1H, br-s) 8.16 (1H, br-s) 7.88 (1H, d, J = 8.55Hz) 7.66 (1H, br-s) 7.58 (1H, dd, J = 8. 55, 1.83 Hz) 3.96 (6H, s) (4) IR spectrum (KBr method) is shown in FIG.

Example 1 [Sodium Naphthalocyanine Tetracarboxylate Zinc [Exemplified Compound No. 126]]] 100 mg (8.10 × 10 ⁻⁵ mol) of the compound obtained in Synthesis Example 19
120% in 1.2 ml% NaOH and 1 ml ethanol
After stirring at C for 7 hours, the mixture was concentrated under reduced pressure. The residue was transferred to a Soxhlet extractor and extracted with methanol.
The methanol solution was concentrated and then purified by reverse-phase short column chromatography (developing solvent: methanol) to give sodium zinc naphthalocyanine tetracarboxylate [Exemplified Compound No. 126] 52 mg was obtained. The electronic spectrum of this compound is shown in FIG.

Example 2 [Bis (triethylsiloxy) silicon naphthalocyanine sodium tetracarboxylate [Exemplified Compound No. 12
Synthesis of 1]] To a sodium methoxide-methanol solution prepared by adding 0.1 g (4.35 mmol) of metallic sodium to 20 ml of anhydrous methanol, 2 g (8.47 mm) of 6-methoxycarbonyl-2,3-dicyanonaphthalene was added.
ol) was added and anhydrous ammonia gas was bubbled for about 1 hour at room temperature while stirring well. The mixture was refluxed for about 3 hours while bubbling anhydrous ammonia gas. After cooling, the precipitated yellow solid was filtered, washed thoroughly with methanol, and dried under reduced pressure to give 6-carbamoyl-1,3-diiminobenzo [f] isoindoline as a yellow solid, 1.785 g.
(88%) obtained. This 6-carbamoyl-1,3-
The IR spectrum of diiminobenzo [f] isoindoline is shown in FIG. 6-carbamoyl-1,3-diiminobenzo [f] isoindoline was used in the next reaction without further purification. 6-carbamoyl-1,3-diiminobenzo [f] isoindoline 500 mg (2.10 mm
Ol) in 10 ml of anhydrous quinoline, 1.8 ml of silicon tetrachloride was added, and the mixture was stirred at 220 ° C. for 3 hours, and most of the silicon tetrachloride was distilled off under reduced pressure. After cooling down,
Add 40 ml of ethanol and 20 ml of concentrated aqueous ammonia, and add 5
Reflux for hours. After cooling, the black-green solid was filtered, thoroughly washed with methanol, and dried under reduced pressure to obtain 934 mg of a black-green solid. This black-green solid is considered to be a solid containing dihydroxysilicon-tetracarbamoylnaphthalocyanine from the electronic spectrum shown in FIG. 46, but dihydroxysilicon-tetracarbamoylnaphthalocyanine was used in the next reaction without further purification. Using. Dihydroxysilicon-tetracarbamoylnaphthalocyanine 600 mg (6.34 × 10 ⁻⁴ mol) in quinoline 10 ml suspension, triethylsilanol 2 ml
Was added and the mixture was stirred at 200 ° C. for 3 hours. After the reaction, most of the quinoline was distilled off under reduced pressure. 1% on the balance obtained
Add 17 ml of NaOH aqueous solution and 24 ml of ethanol,
Refluxed for 5 hours. The reaction mixture was filtered while hot and washed thoroughly with methanol and acetone. After concentrating the collected mother liquor, reverse phase chromatography (developing solvent: methanol)
The target bis (triethylsiloxy) silicon naphthalocyanine sodium tetracarboxylate [Exemplified Compound No. 121 mg] as a green solid was obtained. The electronic spectrum is shown in FIG.

Example 3 [Bis (tributylsiloxy) silicon-sodium tetraphenylthionaphthalocyanine sulfonate [Exemplified Compound No. 6] Synthesis] Bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine 100 m
g (6.23 × 10 ⁻⁵ mol) of chlorosulfonic acid 6 m
The 1 solution was heated at 100 ° C. for 2 hours. After cooling, the reaction was quenched by adding about 25 g of ice while cooling with an ice bath.
After standing at room temperature for 4 hours, the precipitated solid was filtered. Of the obtained black-brown solid, only the one soluble in distilled water was dissolved. 20% NaO was added to the obtained acidic brown aqueous solution.
The solution was neutralized with an aqueous H solution and then concentrated under reduced pressure. The residue was transferred to a Soxhlet extractor and extracted with methanol for about 30 hours. The obtained methanol solution was concentrated and then purified by reverse phase chromatography (developing solvent: methanol). The methanol solution was concentrated, acetone was added to precipitate black green crystals, which was filtered and dried under reduced pressure.
mg of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine sodium sulfonate [Exemplified Compound No. 6] was obtained. The electronic spectrum is shown in FIG.

Example 4 [Bis (tributylsiloxy) silicon-sodium tetraphenylthionaphthalocyanine octacarboxylate [Exemplified Compound No. 1] Synthesis] Bis (tributylsiloxy) silicon-tetrabromonaphthalocyanine 500
mg (3.36 × 10 ⁻⁴ mol), 418 mg (1.4) of copper (I) 3,5-dimethoxycarbonylphenyl thiolate
5 × 10 ⁻³ mol) of quinoline in 8 ml suspension at 140 ° C.
It was stirred for 16 hours. After cooling down, methanol / water (1
(1) 40 ml was added, and the mixture was left at room temperature overnight. The precipitated solid was filtered, washed with methanol, and dried under reduced pressure to obtain 798 mg of a green solid. This green solid 100m
g 2% NaOH aqueous solution 10 ml and ethanol 10 m
The mixture was stirred at 90 ° C. for 2 hours in a mixed solution of 1 l. After cooling down,
It was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. The obtained residue was separated and purified from reverse phase chromatography (developing solvent: methanol) to give sodium bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine octacarboxylate [Exemplified Compound No. 1] 76 mg was obtained as black green crystals. The electron spectrum is shown in FIG.
Shown in.

Example 5 [Bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine sodium octacarboxylate [Exemplified Compound No. 41]] Bis (tributylsiloxy) silicon-tetrachloroquinoxalocyanine 5
00 mg (3.80 × 10 ⁻⁴ mol), 3,5-dimethoxycarbonylphenylthiolated copper (I) 418 mg
A suspension of (1.45 × 10 ⁻³ mol) of quinoline in 8 ml was stirred at 200 ° C. for 10 hours. After cooling, 40 ml of methanol / water (1/1) was added, and the mixture was left at room temperature overnight.
The precipitated solid was filtered, washed with methanol, and dried under reduced pressure to obtain 670 mg of a blue-green solid. 100 mg of this blue-green solid was stirred at 90 ° C. for 2 hours in a mixed solution of 10 ml of 2% NaOH aqueous solution and 10 ml of ethanol. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. The obtained residue was separated and purified from reverse phase chromatography (developing solvent: methanol) to give sodium bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine octacarboxylate [Exemplified Compound No.
41] 51 mg was obtained as black-green crystals. The electronic spectrum is shown in FIG.

Example 6 [Bis (tributylsiloxy) silicon-octaphenylthiophenanthracyanine sodium hexadecacarboxylate [Exemplified Compound No. 62]] Bis (tributylsiloxy) silicon-octabromophenanthracyanine 500 mg (2.50 × 10 ⁻⁴ mol), 3,5
-Dimethoxycarbonylphenylthiolated copper (I) 418
A suspension of mg (1.45 × 10 ⁻³ mol) of quinoline in 8 ml was stirred at 140 ° C. for 16 hours. After cooling, 40 ml of methanol / water (1/1) was added, and the mixture was left at room temperature overnight. The precipitated solid was filtered, washed with methanol, and dried under reduced pressure to obtain 798 mg of a green solid. 100 mg of this green solid was stirred in a mixed solution of 10 ml of 2% NaOH aqueous solution and 10 ml of ethanol at 90 ° C. for 2 hours. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. The obtained residue was separated and purified from reverse phase chromatography (developing solvent: methanol) to give bis (tributylsiloxy) silicon-octaphenylthiophenanthracyanine hexadecacarboxylate sodium [Exemplified Compound No. 62] 48 mg was obtained as black green crystals.

Example 7 [Bis (tributylsiloxy) silicon-octaphenylthioanthracyanin sodium hexadecacarboxylate [Exemplified Compound No. 82]] Bis (tributylsiloxy) silicon-octabromoanthracyanin 5
00 mg (2.50 × 10 ⁻⁴ mol), 3,5-dimethoxycarbonylphenyl copper thionide (I) 418 mg
A suspension of (1.45 × 10 ⁻³ mol) of quinoline in 8 ml was stirred at 150 ° C. for 14 hours. After cooling, 40 ml of methanol / water (1/1) was added, and the mixture was left at room temperature overnight.
The precipitated solid was filtered, washed with methanol, and dried under reduced pressure to obtain 824 mg of dark brown solid. 100 mg of this dark brown solid was stirred at 90 ° C. for 2 hours in a mixed solution of 10 ml of 2% NaOH aqueous solution and 10 ml of ethanol. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. By separating and purifying the obtained residue from reverse phase chromatography (developing solvent: methanol), sodium bis (tributylsiloxy) silicon-octaphenylthioanthracyanin hexadecacarboxylate [Exemplified Compound N
o. 82] 53 mg was obtained as black brown crystals.

Example 8 [Bis (tributylsiloxy) silicon-tetraphenylthio (1,2-naphthalocyanine) octacarboxylate sodium [Exemplified Compound No. 101]]] Bis (tributylsiloxy) silicon-tetrabromo (1,
2-Naphthalocyanine 500 mg (3.36 × 10 ⁻⁴ m
ol), 3,5-dimethoxycarbonylphenylthiolated copper (I) (418 mg, 1.45 × 10 ⁻³ mol) in quinoline (8 ml) was stirred at 140 ° C. for 20 hours.
After cooling, 40 ml of methanol / water (1/1) was added, and the mixture was left at room temperature overnight. The precipitated solid was filtered, washed with methanol, and dried under reduced pressure to obtain 745 mg of a green solid. 100 mg of this green solid was stirred in a mixed solution of 10 ml of 2% NaOH aqueous solution and 10 ml of ethanol at 90 ° C. for 2 hours. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. By separating and purifying the obtained residue from reverse phase chromatography (developing solvent: methanol), sodium bis (tributylsiloxy) silicon-tetraphenylthio (1,2-naphthalocyanine) octacarboxylate [Exemplified Compound No. ． 101] 61 mg was obtained as black green crystals.

Example 9 [Bis (tributylsiloxy) silicon-sodium tetraphenylthioquinocyanocyanine octacarboxylate [Exemplified Compound No. 21] Synthesis] Bis (tributylsiloxy) silicon-tetrabromoquinolocyanine 500 mg
(3.35 × 10 ⁻⁴ mol), 3,5-dimethoxycarbonylphenyl copper thionide 418 mg (1.45 ×)
10 ^-3 mol) of quinoline in 8 ml suspension at 140 ° C
Stirred for 8 hours. After cooling down, methanol / water (1 /
1) 40 ml was added and left overnight at room temperature. When the precipitated solid was filtered, washed with methanol and dried under reduced pressure,
642 mg of a green solid was obtained. This green solid 100m
g 2% NaOH aqueous solution 10 ml and ethanol 10 m
The mixture was stirred at 90 ° C. for 2 hours in a mixed solution of 1 l. After cooling down,
It was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. The obtained residue was separated and purified from reverse-phase chromatography (developing solvent: methanol) to give sodium bis (tributylsiloxy) silicon-tetraphenylthioquinolocyanine octacarboxylate [Exemplified Compound No. 21] 68 mg was obtained as black green crystals. The electron spectrum is shown in FIG.
Shown in.

Example 10 [Bis (trihydroxyneopentoxy) silicon-tetraphenylthionaphthalocyanine sodium octacarboxylate [Exemplified Compound No. Synthesis of 11]] 2,3-dicyano-6- (3 ', 5'-dimethoxycarbonylphenylthio) naphthalene was used as a raw material, and Synthesis Examples 3 and 4 were performed.
By treating in the same manner as in Steps 1 and 5, a dihydroxysilicon-tetraphenylthionaphthalocyanine octacarbamoyl compound was obtained. 50 mg of this compound (3.22 ×
10 ^-5 mol) and pentaerythritol 68 mg (5
X 10 ^-4 mol) was stirred in 5 ml of quinoline at 200 ° C for 4 hours. After the reaction, the content was concentrated under reduced pressure, and 5 ml of ethanol and 5 ml of 2% NaOH aqueous solution were added to 90
Stirred at ℃ for 3 hours. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. By separating and purifying the obtained residue from reverse phase chromatography (developing solvent: methanol), bis (trihydroxyneopentoxy) silicon-
Sodium tetraphenylthionaphthalocyanine octacarboxylate [Exemplified Compound No. 11] 18 mg was obtained as black green crystals. The electronic spectrum is shown in FIG.

Example 11 [Bis (tripropylsiloxy) silicon-tetraethylthionaphthalocyanine sodium tetracarboxylate [Exemplified Compound No. 16] Synthesis] Bis (tripropylsiloxy) silicon-tetrakis [2- (2 ', 2', 4 ', 4'-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine 2 obtained in Synthesis Example 12
0 mg of ethanol 5 ml and 2% NaOH aqueous solution 5 m
1 was added and the mixture was stirred at 90 ° C. for 3 hours. After allowing to cool, it was neutralized with concentrated hydrochloric acid and concentrated under reduced pressure. The obtained residue was separated and purified from reverse phase chromatography (developing solvent: methanol) to give sodium bis (tripropylsiloxy) silicon-tetraethylthionaphthalocyanine tetracarboxylate [Exemplified Compound No. 16] 9 mg was obtained as black green crystals. The electron spectrum is shown in FIG.

Test Example 1 [Measurement of fluorescence quantum yield] 1, 1 ', 3, 3, 3', 3 '
-Hexamethylindotricarbocyanine perchlorate or Oxazine-720 was used as a reference substance in the near-infrared region and was used in the literature (J. Photochem.
obiol, A .; Chemistry, Volume 45, 11
7-121 (1988)), the fluorescence quantum yields of the tetraazaporphins obtained in Examples 1 to 11 and the tetraazaporphin of the present invention obtained by the same method. I asked. The results are shown in Tables 10-12. As is clear from Tables 10 to 12, all the fluorescent labeling dyes of the present invention show a sufficient fluorescence quantum yield.

[0075]

[Table 10]

[0076]

[Table 11]

[0077]

[Table 12]

Example 12 Bis (tributylsiloxy) silicon-sodium tetraphenylthionaphthalocyanine octacarboxylate [Exemplified Compound No. 1] 10 mg (4.69 × 10 ⁻⁶ mo
A solution of l) in 10 ml of methanol was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. The obtained residue is anhydrous DMF
(Dimethylformamide) Only what is soluble in 30 ml is dissolved, N, N-dimethylaminopyridine 0.1 mg
(8.14 × 10 ⁻⁷ mol) and 0.35 mg (4.60 × 10 ⁻⁶ mol) of 1,3-propanediol were added, and 1 mg (4 .85 × 10 ^-6 mo
1) was added and stirring was continued at room temperature for 5 hours. After adding 1 ml of 0.2 M Na ₂ CO ₃ buffer (pH 9.3) to the reaction mixture, the mixture was concentrated under reduced pressure. When the obtained residue was separated and purified by reverse phase chromatography, 5 mg of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt was obtained. The electron spectrum is shown in FIG.

Example 13 Bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine sodium octacarboxylate [Exemplified Compound No. 41] 10 mg (4.67 × 10 ⁻⁶
10 ml of a methanol solution (mol) was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. The obtained residue was dissolved only in 30 ml of anhydrous DMF, and dissolved in 0.1 mg of N, N-dimethylaminopyridine (8.14 × 10 ⁻⁷ mo).
1) and 0.35 mg of 1,3-propanediol (4.
60 × 10 ⁻⁶ mol) and stirred well to give 1,3-dicyclohexylcarbodiimide (DCC) 1
mg (4.85 × 10 ⁻⁶ mol) was added, and stirring was continued at room temperature for 5 hours. After adding 1 ml of 0.2 M Na ₂ CO ₃ buffer (pH 9.3) to the reaction mixture, the mixture was concentrated under reduced pressure. The obtained residue was separated and purified by reverse phase chromatography to obtain 4 mg of bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt. The electronic spectrum is shown in FIG.

Example 14 Bis (tributylsiloxy) silicon-octaphenylthiophenanthracyanine sodium hexadecacarboxylate [Exemplified Compound No. 62] 10 mg (3.04 x 1
A solution of 0 ^-6 mol) in 10 ml of methanol was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. The obtained residue was dissolved only in 20 ml of anhydrous DMF, and 0.1 mg of N, N-dimethylaminopyridine (8.14 × 10 ⁻⁷ m) was dissolved.
ol) and 1,3-propanediol 0.22 mg
(2.89 × 10 ⁻⁶ mol) was added, and the mixture was stirred well and 1,3-dicyclohexylcarbodiimide (DC) was added.
C) 0.64 mg (3.10 × 10 ⁻⁶ mol) was added,
Stirring was continued at room temperature for 5 hours. 0.2M in the reaction mixture
After adding 1 ml of Na ₂ CO ₃ buffer (pH 9.3), the mixture was concentrated under reduced pressure. The obtained residue was separated and purified by reverse phase chromatography to obtain 5 mg of bis (tributylsiloxy) silicon-octaphenylthiophenanthracyanine hexadecacarboxylic acid monohydroxypropyl ester pentadeca sodium salt.

Example 15 Bis (tributylsiloxy) silicon-octaphenylthioanthracyanin sodium hexadecacarboxylate [Exemplified Compound No. 82] 10 mg (3.04 × 10 ⁻⁶
10 ml of a methanol solution (mol) was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. The obtained residue was dissolved only in 20 ml of anhydrous DMF and dissolved in 0.1 mg of N, N-dimethylaminopyridine (8.14 × 10 ⁻⁷ mo).
1) and 0.22 mg of 1,3-propanediol (2.
89 × 10 ⁻⁶ mol) and stirred well, 1,3-dicyclohexylcarbodiimide (DCC)
0.64 mg (3.10 × 10 ⁻⁶ mol) was added and stirring was continued at room temperature for 4 hours. 0.2M Na _{2 in the} reaction mixture
After adding 1 ml of CO ₃ buffer (pH 9.3), the mixture was concentrated under reduced pressure. The obtained residue was separated and purified by reverse phase chromatography to obtain 4 mg of bis (tributylsiloxy) silicon-octaphenylthioanthracyanine hexadecacarboxylic acid monohydroxypropyl ester pentadeca sodium salt.

Example 16 Sodium bis (tributylsiloxy) silicon-octaphenylthio (1,2-naphthalocyanine) octacarboxylate [Exemplified Compound No. 101] 10 mg (4.6
A solution of 9 × 10 ⁻⁶ mol) in 10 ml of methanol was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. Dissolve only the obtained residue in 30 ml of anhydrous DMF.
N-dimethylaminopyridine 0.1 mg (8.14 × 1)
0 ^-7 mol) and 1,3-propanediol 0.35 m
g (4.60 × 10 ^-6 mol) was added and 1,3-dicyclohexylcarbodiimide (D
CC) 1 mg (4.85 × 10 ⁻⁶ mol) was added, and stirring was continued at room temperature for 5 hours. 0.2M Na in the reaction mixture
After adding 1 ml of ₂ CO ₃ buffer (pH 9.3), the mixture was concentrated under reduced pressure. The obtained residue was separated and purified by reverse phase chromatography to obtain 5 mg of bis (tributylsiloxy) silicon-tetraphenylthio (1,2-naphthalocyanine) octacarboxylic acid monohydroxypropyl ester hepta sodium salt.

Example 17 Bis (tributylsiloxy) silicon-sodium tetraphenylthioquinolocyanine octacarboxylate [Exemplified Compound No. 21] 10 mg (4.68 × 10 ⁻⁶ mo
A solution of l) in 10 ml of methanol was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. The obtained residue is anhydrous DMF
Only what is soluble in 30 ml is dissolved, and N, N-dimethylaminopyridine 0.1 mg (8.14 × 10 ⁻⁷ mol) and 1,3-propanediol 0.35 mg (4.60 ×)
10 ^-6 mol) and stir well for 1,3
-Dicyclohexylcarbodiimide (DCC) 1 mg
(4.85 × 10 ⁻⁶ mol) was added, and stirring was continued at room temperature for 5 hours. After adding 1 ml of 0.2 M Na ₂ CO ₃ buffer solution (pH 9.3) to the reaction mixture and concentrating under reduced pressure, bis (tributylsiloxy) silicon-tetraphenylthioquinocyanine octacarboxylic acid monohydroxypropyl ester heptasodium 4 mg of salt was obtained. The electronic spectrum is shown in FIG.

Example 18 [Synthesis of phosphorylated oligonucleotide primer] Automated DN using solid phase CED-phosphoramide method
Primer (5'-GTTTCCCA by A synthesizer)
GTCACGAC-3 ') was synthesized. Phosphorylation of the synthesized primer was performed using 50 mM Tris-HCl (pH 7.
6) Incubation was carried out at 37 ° C. for 1 hour in a 100 μl reaction solution containing 10 mM magnesium chloride, 10 mM dithiothreitol, 3 mM ATP, and T ₄ -nucleotide kinase. Phosphorylated primers were analyzed by high performance liquid chromatography (HPL) using a gel filtration column.
The peak of the phosphorylated primer separated in C) was collected and the solvent was removed by freeze-drying.

Example 19 Phosphorus obtained in Example 18 was added to 100 μl of a 0.05 mM DMF solution of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt synthesized in Example 12. 100 μl of a 0.05 mM DMF solution of the oxidized oligonucleotide primer was added, and 100 μl of a 0.05 mM DCC solution of DCC was further added, and the mixture was stirred overnight at room temperature. 100 to the reaction mixture
After adding μl 0.2 M Na ₂ CO ₃ buffer (pH 9.3), the mixture was concentrated under reduced pressure. By separating the obtained residue by HPLC, the exemplified compound No. An oligonucleotide primer labeled with 1 was obtained.

Example 20 100 μl of a 0.05 mM DMF solution of bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt synthesized in Example 13 was used. By performing the same treatment, exemplary compound No.
An oligonucleotide primer labeled with 41 was obtained.

Example 21 Bis (tributylsiloxy) silicon-octaphenylthiophenanthracyanine hexadecacarboxylic acid monohydroxypropyl ester pentadeca sodium salt synthesized in Example 14 in 100 mM 0.05 mM DMF solution
Example 1 was treated in the same manner as in Example 19 to give Exemplified Compound No. An oligonucleotide primer labeled with 62 was obtained.

Example 22 100 μl of a 0.05 mM DMF solution of bis (tributylsiloxy) silicon-octaphenylthioanthracyanin hexadecacarboxylic acid monohydroxypropyl ester pentadeca sodium salt synthesized in Example 15
Was treated in the same manner as in Example 19 to give Exemplified Compound No. An oligonucleotide primer labeled with 82 was obtained.

Example 23 Bis (tributylsiloxy) silicon-tetraphenylthio (1,2-naphthalocyanine) octacarboxylic acid monohydroxypropyl ester hepta sodium salt 0.05 mM-DMF solution 100 synthesized in Example 16
μl was treated in the same manner as in Example 19 to give Exemplified Compound No. An oligonucleotide primer labeled with 101 was obtained.

Example 24 100 μl of a 0.05 mM DMF solution of bis (tributylsiloxy) silicon-tetraphenylthioquinolocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt synthesized in Example 17 was added to Example 1
By treating in the same manner as in Example 9, Exemplified Compound No. 21
An oligonucleotide primer labeled with was obtained.

Example 25 Exemplified compound No. 1 synthesized in Example 10 11 of 0.05
By treating 100 μl of the mM-DMF solution in the same manner as in Example 19, the exemplified compound No. An oligonucleotide primer labeled with 11 was obtained.

Example 26 [Analysis of DNA base sequence] A DNA having a known base sequence was used as a sample, and tetraaza was synthesized through a linker synthesized in Examples 19 to 25 or the same as in Examples 19 to 25. Sanger reaction was carried out with each of four types of bases using a porphine-bound primer, followed by electrophoretic separation in separate lanes and analysis with a DNA sequencer equipped with a semiconductor laser. The results are summarized in Table 4. These systems optionally include nonionic surfactants as additives.

[0093]

[Table 13]

Example 27 [Tetraazaporphine-labeled primer (exemplary compound-
Synthesis of ACACAACTGTGTTCACTAGC)
In the same manner as in Examples 18 and 19, various 5′-terminal-labeled tetraazaporphine-labeled primers (Exemplified Compound No.-ACACAACTGTGTTCACT) were used.
AGC) was synthesized.

[Detection of β-globin Gene in Human DNA] PCR (Polymerase Chain Re)
of the human β-
The globin gene was detected. Sample 1: Human placenta DNA
(1 μg), exemplified compound No. -A
CACAACTGTGTTCACTAGC (300n
g), HO-CAACTTCATCCACGTTCAC
C (300 ng), nonionic surfactant and Taq
Gene amplification was performed for 20 cycles using DNA polymerase (Perkin Elmer Cetus) according to the protocol of Perkin Elmer Cetus (total volume: 100 μl). Sample 2: Human placenta DNA (1 μm
g), the same exemplified compound No. as the sample 1. -ACACAAAC
TGTGTTCACTAGC (300 ng), HO-C
AACTTCATCCACGTTCACC (300n
g), a nonionic surfactant, and a reaction solution containing no Taq DNA polymerase (prepared according to the protocol of Perkin Elmer Cetus Co., Ltd., total solution volume: 10)
0 μl). These samples (50 μl) were added to buffer A (nonionic surfactant, 50 mM NaCl, 10 mM).
mM Tris.HCl, 0.1 mM EDTA, pH
8.0 μl), and octadecylsilane resin (Microbonder Pack C
-18, Waters). As the octadecylsilane resin, a pipette tip (for 1 ml) was suspended in ethanol and superposed on a minicolumn in which glass wool that had been siliconized was packed.

After washing with buffer A (500 μl) and buffer A (500 μl) containing 5% ethanol,
Elution was performed with buffer A (500 μl) containing 10% ethanol. The pH of this eluate was adjusted to about 8, the semiconductor laser was used as an excitation light source, and the fluorescence intensity was measured by a photodiode array. As a result, the relative intensities as shown in Tables 14 to 16 were obtained. In addition, unreacted exemplary compound-
No. ACACAACTGTGTTCACTAGC is
Usually, the buffer A containing 10% ethanol did not elute at all, but the buffer A containing 15% ethanol first eluted. From these results, it was found that the β-globin gene in human DNA can be detected using the oligodeoxynucleotide of the present invention labeled with 5'-terminal tetraazaporphine.

[0097]

[Table 14]

[0098]

[Table 15]

[0099]

[Table 16]

Comparative Example 1 The phthalocyanines described in WO Patent No. 03807 (1989) were bound to the oligonucleotide primers obtained in Example 18 according to the methods of the existing patents and Examples 19 to 25 of the present application. did. Example 26 was carried out using the phthalocyanine-bonded oligonucleotide thus obtained.
The nucleotide sequence of DNA was analyzed in the same manner as in. The phthalocyanines used in this experiment are shown below. Comparative Example Compound A: Aluminum hydroxy 2,9,1
6,23-Tetraphenoxy phthalocyanine sulfonate Comparative Example Compound B: Aluminum hydroxy 2,9,1
6,23-Tetrathiophenylphthalocyanine sulfonate Comparative example compound C: Magnesium 20-phenyltetrabenztriazaporphine sulfonate Comparative example compound D: Bis (tributylsiloxy) silicon-phthalocyanine tetracarboxylic acid sodium salt The results are shown in Table 17. As shown in Table 17, with phthalocyanines, fluorescence cannot be observed at all because the semiconductor laser having an oscillation wavelength of 730 nm or more cannot excite, and measurement becomes impossible. , The accuracy was significantly reduced due to the interference of scattered light.

[0101]

[Table 17]

Comparative Example 2 The phthalocyanines of Comparative Examples A to D were prepared according to Example 27.
It was used for the detection of the β-globin gene in human DNA in the same manner as in. The results are shown in Table 18. As shown in Table 18, phthalocyanines cannot be excited by a semiconductor laser having an oscillation wavelength of 730 nm or more, and thus fluorescence is not observed at all, which makes measurement impossible.
When a semiconductor laser of nm was used, it was difficult to distinguish the relative intensities between the sample 1 and the sample 2 due to the interference of the excitation light.

[0103]

[Table 18]

Example 28 [Measurement of Relative Immunoaffinity for Antimorphin Monoclonal Antibody] {Aluminum naphthalocyanine mono [N- (p-hydroxycarbonylphenyl) sulfamoyl] sodium disulfonate (Exemplified Compound No. 128-PABA)
Synthesis of Exemplified Compound No. 128 Synthetic precursor aluminum naphthalocyanine trisulfonic acid (150 m
Ogizalyl chloride (0.75 ml) was added dropwise to a 2 ml benzene solution of g) at 25 ° C. After stirring at room temperature for 6 hours, the solvent was removed to obtain aluminum naphthalocyanine trisulfonyl chloride as a black-green solid. On the other hand, p-aminobenzoic acid (PABA) (31) was added to a solution of Na ₂ CO ₃ (61 mg) in water (1 ml) at 80 ° C.
mg) was added. After stirring at 80 ° C for 5 minutes, aluminum naphthalocyanine trisulfonyl chloride (55m
g) was added. The reaction mixture was stirred at 80 ° C. for 6 hours and the solvent was removed. The solid obtained was treated with 10% by weight of NH ₄
After diluting with methanol containing OH, concentrating again, and pulverizing with acetone, aluminum naphthalocyanine sodium mono [N- (p-hydroxycarbonylphenyl) sulfamoyl] disulfonate (Exemplified compound N
o. 128-PABA) was obtained.

{Exemplified Compound No. Synthesis of 1-PABA}
Exemplified compound No. 1 286 mg (0.13 mmol)
Was acidified with concentrated hydrochloric acid in methanol and quickly concentrated under reduced pressure to exemplify Compound No. 1 octacarboxylic acid was obtained. The obtained exemplary compound No. After the octacarboxylic acid of 1 was dried under reduced pressure, 20 ml of DMF was added and only the soluble one was dissolved to obtain a dark green DMF solution. 18 mg (0.13 mmol) of PABA was added to this solution. While cooling the solution to about 0 ° C., a solution of 0.02 ml of diethylphosphoryl cyanide (DEPC) in 3 ml of DMF was added, and 0.04 ml (0.28 ml) of triethylamine was added.
mmol) and stirred at 0 ° C. for 30 minutes,
Stirring was continued at room temperature for 3 hours. After the reaction, 1 ml of water was added and the mixture was concentrated under reduced pressure and subjected to reverse phase column chromatography.
Exemplified compound No. 1-PABA was obtained.

{Exemplified Compound No. 21-PABA Synthesis} Exemplified Compound No. 21 by using the exemplified compound No.
By treating in the same manner as in the synthesis of 1-PABA, Exemplified Compound No. 21-PABA was obtained. {Exemplified Compound No. Synthesis of 42-PABA} Exemplified Compound No. 42 by using the exemplary compound No. Exemplified compound N is obtained by treating in the same manner as in the synthesis of 1-PABA.
o. 42-PABA was obtained. {Exemplified Compound No. Synthesis of 62-PABA} Exemplified Compound No. 62 by using the exemplary compound No. 62. Exemplified compound N is obtained by treating in the same manner as in the synthesis of 1-PABA.
o. 62-PABA was obtained. {Exemplified Compound No. Synthesis of 82-PABA} Exemplified Compound No. 82, using the exemplified compound No. Exemplified compound N is obtained by treating in the same manner as in the synthesis of 1-PABA.
o. 82-PABA was obtained.

{Exemplified Compound No. Synthesis of 101-PABA} Exemplified Compound No. 101, and exemplary compound N
o. By treating in the same manner as in the synthesis of 1-PABA, Exemplified Compound No. 101-PABA was obtained. {Exemplified Compound No. Synthesis of 128-PABA-morphine} Exemplified Compound No. A DMF solution of 128-PABA and 3- (4-aminobutyl) morphine was used in the presence of triethylamine using DEPC to exemplify Compound No. 1-P
By treating in the same manner as in the synthesis of ABA, exemplary compound No. 128-PABA-morphine was obtained. {Exemplified Compound No. Synthesis of 1-PABA-morphine}
Exemplified compound No. 1-PABA was used as the exemplified compound No. 1
By treating in the same manner as in the synthesis of 28-PABA-morphine, Exemplified Compound No. 1-PABA-morphine was obtained. {Exemplified Compound No. 21-PABA-Synthesis of Morphine} Exemplified Compound No. 21-PABA is exemplified compound N
o. By treating in the same manner as in the synthesis of 128-PABA-morphine, exemplary compound No. 21-PABA-morphine was obtained.

{Exemplified Compound No. Synthesis of 42-PABA-morphine} Exemplified Compound No. 42-PABA was used as the exemplified compound No. By treating in the same manner as in the synthesis of 128-PABA-morphine, exemplary compound No. 42-P
ABA-morphine was obtained. {Exemplified Compound No. Synthesis of 62-PABA-morphine} Exemplified Compound No. 62-PABA is exemplified compound N
o. By treating in the same manner as in the synthesis of 128-PABA-morphine, exemplary compound No. 62-PABA-morphine was obtained. {Exemplified Compound No. Synthesis of 8-PABA-morphine} Exemplified Compound No. 82-PABA is exemplified compound N
o. By treating in the same manner as in the synthesis of 128-PABA-morphine, exemplary compound No. 82-PABA-morphine was obtained. {Exemplified Compound No. Synthesis of 101-PABA-morphine} Exemplified Compound No. 101-PABA was added as exemplified compound No. By treating in the same manner as in the synthesis of 128-PABA-morphine, exemplary compound No. 101-PABA
-I got morphine.

{Measurement of Relative Immunoaffinity for Antimorphin Monoclonal Antibody} The relative immunoaffinity of morphine, aminomorphine, and morphine labeled with the above-described fluorescent dye, which is associated with the antimorphin monoclonal antibody, is labeled with tritium. It was measured using a competitive reaction with morphine. The results are summarized in Table 19. From the results in Table 19, it can be seen that there is almost no difference in relative affinity due to the difference in molecular species, and there is almost no change in reactivity between morphine and monoclonal antibody even when labeled with a fluorescent dye.

[0110]

[Table 19]

[0111]

INDUSTRIAL APPLICABILITY According to the present invention, various antigens, drugs, DNA, etc., which are not affected by in-vivo substances such as heme existing in blood, and which use an inexpensive and small semiconductor laser (670-840 nm) It was possible to provide a reagent or a clinical test reagent useful for analysis, analysis of DNA base sequence, and the like.

[Brief description of drawings]

FIG. 1 is an IR spectrum (coating method) of 3,4-bis (dibromomethyl) bromobenzene.

FIG. 2 is an NMR spectrum of 6-bromo-2,3-dicyanonaphthalene in CDCl ₃ .

FIG. 3 is an IR spectrum (KBr method) of 6-bromo-2,3-dicyanonaphthalene.

FIG. 4 6-Bromo-1,3-diiminobenzo [f]
It is an IR spectrum (KBr method) of isoindoline.

FIG. 5 is an IR spectrum (KBr method) of dichlorosilicon-tetrabromonaphthalocyanine.

FIG. 6 is an electronic spectrum (tetrahydrofuran solution) of dichlorosilicon-tetrabromonaphthalocyanine.

FIG. 7 is an IR spectrum (KBr method) of dihydroxysilicon-tetrabromonaphthalocyanine.

FIG. 8 is an electronic spectrum (tetrahydrofuran solution) of dihydroxysilicon-tetrabromonaphthalocyanine.

FIG. 9 is an NMR spectrum of bis (tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 10 is an electronic spectrum (CHCl ₃ solution) of bis (tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 11 is an IR spectrum (KBr method) of bis (tri-n-propylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 12 is an NMR spectrum of bis (tri-n-butylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 13 is an electronic spectrum (CHCl ₃ solution) of bis (tri-n-butylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 14 is an IR spectrum (KBr method) of bis (tri-n-butylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 15 is an NMR spectrum of bis (tri-n-hexylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 16 is an electronic spectrum (CHCl ₃ solution) of bis (tri-n-hexylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 17 is an IR spectrum (KBr method) of bis (tri-n-hexylsiloxy) silicon-tetrabromonaphthalocyanine.

FIG. 18: Electronic spectrum of bis (triethylsiloxy) silicon-tetrabromonaphthalocyanine (CHC
l is a _{three-solution).}

FIG. 19: IR spectrum (KBr of bis (triethylsiloxy) silicon-tetrabromonaphthalocyanine
Law).

FIG. 20 is an NMR spectrum of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine.

FIG. 21 is an electronic spectrum (CH ₂ Cl ₂ solution) of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine.

FIG. 22 is an IR spectrum (KBr method) of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine.

FIG. 23 is an NMR spectrum of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2′-ethylhexyloxycarbonyl) ethylthio] naphthalocyanine.

FIG. 24 is an electronic spectrum (CHCl ₃ solution) of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2′-ethylhexyloxycarbonyl) ethylthio] naphthalocyanine.

FIG. 25 is an IR spectrum (KBr method) of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2′-ethylhexyloxycarbonyl) ethylthio] naphthalocyanine.

FIG. 26 is an NMR spectrum of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2 ′, 2 ′, 4 ′, 4′-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine.

FIG. 27: Electronic spectrum of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2 ′, 2 ′, 4 ′, 4′-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine (CHCl ₃ solution) Is.

FIG. 28 is an IR spectrum (KBr method) of bis (tri-n-propylsiloxy) silicon-tetrakis [2- (2 ′, 2 ′, 4 ′, 4′-tetramethylpentyloxycarbonyl) ethylthio] naphthalocyanine. is there.

FIG. 29 is an IR spectrum (coating method) of methyl 3,4-dimethylbenzoate.

FIG. 30 is an IR spectrum (KBr method) of methyl 3,4-bis (dibromomethyl) benzoate.

FIG. 31 is an IR spectrum (KBr method) of 6-methoxycarbonyl-2,3-dicyanonaphthalene.

FIG. 32. I of n-amyl 3,4-dimethylbenzoate
It is an R spectrum (coating method).

FIG. 33: 6- (n-amyloxycarbonyl) -2,
IR spectrum of 3-dicyanonaphthalene (KBr method)
Is.

FIG. 34 is an IR spectrum (coating method) of n-octyl 3,4-dimethylbenzoate.

FIG. 35: 6- (n-octyloxycarbonyl)-
IR spectrum of 2,3-dicyanonaphthalene (KBr
Law).

FIG. 36: Zinc tetra (n-amyloxycarbonyl)
Electronic spectrum of naphthalocyanine (CHCl ₃ solution)
Is.

FIG. 37: Zinc tetra (n-amyloxycarbonyl)
It is an IR spectrum (KBr method) of naphthalocyanine.

FIG. 38 is an electronic spectrum (CHCl ₃ solution) of chloroaluminum tetra (n-octyloxycarbonyl) naphthalocyanine.

FIG. 39 is an IR spectrum (KBr method) of chloroaluminum tetra (n-octyloxycarbonyl) naphthalocyanine.

FIG. 40 is an IR spectrum (KBr method) of 6-chloro-2,3-dicyanoquinoxaline.

FIG. 41: Electronic spectrum of bis (tributylsiloxy) silicon-tetrachloroquinoxalocyanine (CH
Cl ₃ solution).

FIG. 42: Electronic spectrum of bis (tributylsiloxy) silicon-tetrabromoquinocyanine (CHCl
₃ solution).

FIG. 43 is an IR spectrum (KBr method) of 2,3-dicyano-6- (3 ′, 5′-dimethoxycarbonylphenylthio) naphthalene.

FIG. 44. Exemplified Compound No. It is an electronic spectrum of 126 (in ethanol).

FIG. 45: IR spectrum of 6-carbamoyl-1,3-diiminobenzo [f] isoindoline (KBr method)
Is.

FIG. 46: Electronic spectrum of dihydroxysilicon-tetracarbamoylnaphthalocyanine (quinoline solution)
Is.

FIG. 47: Bis (triethylsiloxy) silicon naphthalocyanine sodium tetracarboxylate [Exemplified Compound No. 121] is an electronic spectrum (methanol solution).

FIG. 48: Bis (tributylsiloxy) silicon-sodium tetraphenylthionaphthalocyanine sulfonate [Exemplified Compound No. 6] is an electronic spectrum (methanol solution).

FIG. 49 Bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine sodium octacarboxylate [Exemplified Compound No. 1] is an electronic spectrum of [1] (methanol solution).

FIG. 50: Bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine sodium octacarboxylate [Exemplified Compound No. 41] is an electronic spectrum (methanol solution).

FIG. 51: Bis (tributylsiloxy) silicon-sodium tetraphenylthioquinolocyanine octacarboxylate [Exemplified Compound No. 21] is an electronic spectrum (methanol solution).

FIG. 52 is a sodium bis (trihydroxyneopentoxy) silicon-tetraphenylthionaphthalocyanine octacarboxylate [Exemplified Compound No. 11] is an electronic spectrum (methanol solution).

FIG. 53 Bis (tripropylsiloxy) silicon-
Sodium tetraethylthionaphthalocyanine tetracarboxylate [Exemplified Compound No. 16] is an electronic spectrum (methanol solution).

FIG. 54 is an electronic spectrum (methanol solution) of bis (tributylsiloxy) silicon-tetraphenylthionaphthalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt.

FIG. 55 is an electronic spectrum (methanol solution) of bis (tributylsiloxy) silicon-tetraphenylthioquinoxalocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt.

FIG. 56 is an electronic spectrum (methanol solution) of bis (tributylsiloxy) silicon-tetraphenylthioquinolocyanine octacarboxylic acid monohydroxypropyl ester hepta sodium salt.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] April 23, 1992

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 8

[Correction method] Change

[Correction content]

[Procedure Amendment 2]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 9

[Correction method] Change

[Correction content]

[Procedure 3]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 10

[Correction method] Change

[Correction content]

[Procedure amendment 4]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 11

[Correction method] Change

[Correction content]

[Procedure Amendment 5]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 12

[Correction method] Change

[Correction content]

[Procedure correction 6]

[Document name to be amended] Statement

[Name of item to be corrected] Claim 15

[Correction method] Change

[Correction content]

[Procedure Amendment 7]

[Document name to be amended] Statement

[Correction target item name] 0010

[Correction method] Change

[Correction content]

(3) A reagent containing the fluorescent labeling dye according to (2) above. (4) A reagent containing the fluorescent labeling dye according to (2) above and a nonionic surfactant. (5) A biological substance labeled with the fluorescent labeling dye according to the above (2). (6) A reagent containing the labeled biological substance according to (5) above. (7) A reagent containing the labeled substance of biological origin as described in (5) above and a nonionic surfactant. (8) The biological substance according to (5) above or the reagent according to (6) or (7) above, wherein the biological substance is an antigen, an antibody or a nucleotide. (9) The biological substance or reagent according to the above (8), wherein the antigen is a drug. (10) The above (8), wherein the antibody is a monoclonal antibody
The biological material or reagent as described. (11) The biological substance or reagent according to (8) above, wherein the nucleotide is an oligonucleotide or a polynucleotide. (12) The nucleotide is ATP, CTP, GTP, T
TP, UTP, dATP, dCTP, dGTP, dTT
P, dUTP, ddATP, ddCTP, ddGTP,
The biological substance or reagent according to (8) above, which is ddTTP, ddUTP, or a derivative thereof. (13) A fluorescence analysis method, which comprises using the fluorescent labeling dye according to (2) as a fluorescent label. (14) The fluorescence analysis method according to (13), wherein a semiconductor laser having a wavelength of 670 to 840 nm is used as a light source. (15) The fluorescence analysis method according to (13) or (14), wherein the labeled biological substance according to (5) is used.

[Procedure Amendment 8]

[Document name to be amended] Statement

[Correction target item name] 0012

[Correction method] Change

[Correction content]

In the compound of the general formula (I) according to the present invention, R
Specific examples of the alkyl group which may have a hydrophilic substituent of ¹ , R ² and R ³ include a methyl group, an ethyl group, a propyl group, a butyl group, a pentyl group, a hexyl group, a heptyl group,
Octyl group, nonyl group, decyl group, dodecyl group, tetradecyl group, hexadecyl group, octadecyl group, eicosyl group, docosyl group and other straight-chain, branched and cyclic groups or these, hydroxyl group, carboxylic acid group, sulfonic acid group , An aryl group which may have a hydrophilic substituent such as a phosphoric acid group and which may have a hydrophilic substituent is a phenyl group, a biphenyl group, a terphenyl group, a cumenyl group, a furyl group or a thienyl group. , A pyrrolyl group or a hydroxyl group, a carboxylic acid group, a sulfonic acid group, a group having a hydrophilic substituent such as a phosphoric acid group bonded thereto, and the aralkyl group which may have a hydrophilic substituent is a benzyl group, There is a phenethyl group or a group in which a hydrophilic substituent such as a hydroxyl group, a carboxylic acid group, a sulfonic acid group, or a phosphoric acid group is bonded, and examples of the acyl group which may have a hydrophilic substituent Are formyl, acetyl, propionyl, butyryl, valeryl group, pivaloyl group, hexanoyl group, octanoyl group, a lauroyl group,
There are linear, branched and cyclic groups such as palmitoyl group and stearoyl group or groups having a hydrophilic substituent such as a hydroxyl group, a carboxylic acid group, a sulfonic acid group and a phosphoric acid group bonded thereto, and a hydrophilic substituent is Examples of the silyl group that may have include trimethylsilyl group, triethylsilyl group, tripropylsilyl group, tributylsilyl group, triamylsilyl group, trihexylsilyl group, dimethylphenylsilyl group, diphenylmethylsilyl group, triphenylsilyl group. There is a silyl group having a linear, branched or cyclic group such as or a group in which a hydrophilic substituent such as a hydroxyl group, a carboxylic acid group, a sulfonic acid group or a phosphoric acid group is bonded to the silyl group. Examples of the phosphorus atom-containing group that may be used include a phosphoric acid residue and a phosphoric acid ester.

[Procedure Amendment 9]

[Document name to be amended] Statement

[Correction target item name] 0013

[Correction method] Change

[Correction content]

Specific examples of the saturated or unsaturated linear, branched or cyclic hydrocarbon group represented by Q in the substituent XQ include a methyl group, an ethyl group, a propyl group, an isopropyl group and a butyl group. , Isobutyl group, sec-butyl group, tert-butyl group, pentyl group, isopentyl group, neopentyl group, hexyl group, heptyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, vinyl group, 1-propenyl group Group, allyl group, isopropenyl group, 1-butenyl group, 2-butenyl group, 2-pentenyl group, ethynyl group, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cyclohexenyl group, phenyl group, tolyl group, Xylyl group, mesityl group, cumenyl group, benzyl group, phenethyl group, naphthyl group, etc. Specific examples of the group, a furyl group, a thienyl group, a pyrrolyl group. Examples of the anion represented by Z include Cl ⁻ , Br ⁻ , I ⁻ , and Cl.
O ₄ ⁻ , SO ₄ ²⁻ , PO ₄ ^3−, etc., and examples of the cation represented by Z are H ⁺ , Li ⁺ , Na ⁺ , K ⁺ , M.
g ²⁺ , Ca ²⁺ , ammonium ion, etc., and the cationic group represented by E is

[Chemical 5] (However, R ⁴ and R ⁵ are an alkyl group which may have a hydrophilic substituent shown by R ¹ , R ² , and R ³ , an aryl group which may have a hydrophilic substituent, and a hydrophilic group. And the same meaning as an aralkyl group which may have a substituent), and examples of the anionic group represented by E include —COO ⁻ , —OSO ₃ ^— , and —.
Examples of the condensed polycyclic aromatic ring in which two or more aromatic rings represented by A are condensed include naphthalene ring, anthracene ring, phenanthrene ring, quinoline ring, quinoxaline ring, and OPO ₃ ⁻ and —SO ₃ ⁻ . There is a chrysene ring or the like, and the bonding position thereof is not particularly limited.

[Procedure Amendment 10]

[Document name to be amended] Statement

[Correction target item name] 0056

[Correction method] Change

[Correction content]

Synthetic Example 22 [Synthesis of dihydroxysilicon-tetrachloroquinoxalocyanine] Under a nitrogen atmosphere, 6 ml of a methanol solution of sodium methoxide prepared by adding 0.12 g (5.4 mmol) of metallic sodium to 72 ml of anhydrous methanol was prepared. −
Chloro-2,3-dicyanoquinoxaline 5.97 g (2
7.8 mmol) was added, and anhydrous ammonia gas was bubbled for about 1 hour at room temperature while stirring well. Further, the mixture was refluxed for about 3 hours while bubbling anhydrous ammonia gas. After cooling, the contents were filtered, washed thoroughly with methanol, and dried under reduced pressure to give 6-chloro-
5.23 g of an isoindoline derivative of 2,3-dicyanoquinoxaline was obtained. This isoindoline derivative is
It was used for the next reaction without further purification. Under a nitrogen atmosphere,
5.1 g (22.0 mmo) of the above isoindoline derivative
1) Silicon tetrachloride was added to a suspension of 108 ml of anhydrous quinoline.
0 ml (90 mmol) was added and the mixture was refluxed for about 3 hours. After allowing to cool, the reaction mixture was poured into 300 ml of methanol and left overnight at room temperature. The deposited solid was filtered, thoroughly washed with methanol, and then dried under reduced pressure to obtain a black solid quantitatively. 6 g of this black solid was added to ethanol (10
0 ml), further 100 ml of ammonia water was added, and the mixture was refluxed for about 5 hours. After cooling, the content was filtered, washed thoroughly with methanol, and dried under reduced pressure to obtain 4.5 g of a black solid. This black solid, considered to be dihydroxysilicon-tetrachloroquinoxalocyanine, was used in the next reaction without further purification.

[Procedure Amendment 11]

[Document name to be amended] Statement

[Correction target item name] 0063

[Correction method] Change

[Correction content]

Example 1 [Sodium Naphthalocyanine Tetracarboxylate Zinc [Exemplified Compound No. 126]]] 100 mg (8.10 × 10 ⁻⁵ mol) of the compound obtained in Synthesis Example 19
% Aqueous NaOH solution 1.2 ml and ethanol 1 ml,
After stirring at 120 ° C. for 7 hours, the mixture was concentrated under reduced pressure. The residue was transferred to a Soxhlet extractor and extracted with methanol. The methanol solution was concentrated and then purified by reverse-phase short column chromatography (developing solvent: methanol) to give sodium zinc naphthalocyanine tetracarboxylate [Exemplified Compound No. 126] 52 mg was obtained.
The electronic spectrum of this compound is shown in FIG.

[Procedure Amendment 12]

[Document name to be amended] Statement

[Correction target item name] 0092

[Correction method] Change

[Correction content]

Example 26 [Analysis of DNA base sequence] A DNA having a known base sequence was used as a sample, and tetraaza was synthesized through a linker synthesized in Examples 19 to 25 or the same as in Examples 19 to 25. Sanger reaction was carried out with each of four types of bases using a porphine-bound primer, followed by electrophoretic separation in separate lanes and analysis with a DNA sequencer equipped with a semiconductor laser. The results are summarized in Table 13. These systems optionally include nonionic surfactants as additives.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (31) Priority claim number Japanese Patent Application No. 3-268016 (32) Priority date Hei 3 (1991) October 17 (33) Priority claim country Japan (JP)

Claims (15)

[Claims] 1. A compound represented by the general formula (I): [In the general formula (I), M is H ₂ , Mg, Al, Si, P, Zn, Ga, Ge.
Or it indicates Sc, Y is a halogen atom, -OR ^1, -NR ² ₂ or -SR
³ (wherein R ¹ , R ² and R ³ are each independently a hydrogen atom, an alkyl group which may have a hydrophilic substituent, an aryl group which may have a hydrophilic substituent, a hydrophilic substituent, An aralkyl group which may have, an acyl group which may have a hydrophilic substituent, a silyl group which may have a hydrophilic substituent, or a phosphorus atom-containing group which may have a hydrophilic substituent. And p is an integer of 0 to 2 which represents the number of bonds of Y to M, and A is a condensed polycyclic aromatic compound in which two or more aromatic rings having m substituents XQ are condensed. Represents a group ring, X represents an oxygen atom or a sulfur atom, Q represents a saturated or unsaturated hydrocarbon group or a heterocyclic group, and m represents, for 4 A's, 1 to 4 independently. A positive integer, 4 n independently represent an integer of 0 or more for 4 A, and 4n (the sum of 4 n Represents an integer of 1 or more, and the 4n substituents (EZ) are each independently and independently, a condensed polycyclic aromatic ring constituting A and /
Or is bound to Q, E and Z are E when Z is an anion, E is a cationic group, Z is
Is a cation, E is an anionic group, and when Z is absent, E is a polyethylene glycol residue, a polyether residue,
Shows a binding group containing a polyamine residue, a polyalcohol residue or a polycarboxylic acid residue]. 2. A compound represented by the general formula (II): [In the general formula (II), M is H ₂ , Mg, Al, Si, P, Zn, Ga, Ge.
Or it indicates Sc, Y is a halogen atom, -OR ^1, -NR ² ₂ or -SR
³ (wherein R ¹ , R ² and R ³ are each independently a hydrogen atom, an alkyl group which may have a hydrophilic substituent, an aryl group which may have a hydrophilic substituent, a hydrophilic substituent, An aralkyl group which may have, an acyl group which may have a hydrophilic substituent, a silyl group which may have a hydrophilic substituent, or a phosphorus atom-containing group which may have a hydrophilic substituent. And p represents an integer of 0 to 2 representing the number of bonds of Y to M, and A represents two or more aromatic rings optionally having m substituents XQ or Q. shows the condensed condensed polycyclic aromatic ring, X represents an oxygen atom, a sulfur atom, a nitrogen atom, phosphorus atom, a silicon atom, a selenium atom, NH · CO, NH · PO 2, N
H ・ SO ₂ , O ・ CO, O ・ SO ₂ , O ・ PO ₂ , S ・ C
_{O, S · SO 2, S} · PO 2, CO, indicates SO ₂ or PO _2, Q is a hydrocarbon group or a heterocyclic group, saturated or unsaturated, m, for four A, respectively Independently represent an integer of 1 to 4, 4 n independently represent an integer of 0 or more for 4 A, 4n (a total of 4 n) represents an integer of 1 or more, The 4n substituents (EZ) are each independently and independently, a condensed polycyclic aromatic ring constituting A and /
Or is bound to Q, E and Z are E when Z is an anion, E is a cationic group, and Z is
Is a cation, E is an anionic group, and when Z is absent, E is a polyethylene glycol residue, a polyether residue,
Showing a linking group containing a polyamine residue, a polyalcohol residue or a polycarboxylic acid residue]. 3. A reagent containing the fluorescent labeling dye according to claim 2. 4. A reagent containing the fluorescent labeling dye according to claim 2 and a nonionic surfactant. 5. An organism-derived substance labeled with the fluorescent labeling dye according to claim 2. 6. A reagent containing the labeled biological substance according to claim 5. 7. A reagent containing the labeled biological substance according to claim 5 and a nonionic surfactant. 8. The biological substance according to claim 5, or the reagent according to claim 6 or 7, wherein the biological substance is an antigen, an antibody or a nucleotide. 9. The biological substance or reagent according to claim 8, wherein the antigen is a drug. 10. The biological substance or reagent according to claim 8, wherein the antibody is a monoclonal antibody. 11. The biological substance or reagent according to claim 8, wherein the nucleotide is an oligonucleotide or a polynucleotide. 12. The nucleotides are ATP, CTP, GT
P, TTP, UTP, dATP, dCTP, dGTP,
dTTP, dUTP, ddATP, ddCTP, ddG
The biological substance or reagent according to claim 8, which is TP, ddTTP, ddUTP, or a derivative thereof. 13. A fluorescence analysis method, wherein the fluorescent labeling dye according to claim 2 is used as a fluorescent label. 14. The fluorescence analysis method according to claim 13, wherein a semiconductor laser having a wavelength of 670 to 840 nm is used as a light source. 15. The fluorescence analysis method according to claim 13 or 14, wherein the labeled biological substance according to claim 6 is used.