JPH04505613A - leukocyte adhesion receptor - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] leukocyte adhesion receptor Cross-reference to related applications This application is filed in U.S. Patent Application No. 07/133, filed December 15, 1987, This is a continuation-in-part application of No. 399.

field of invention The present invention relates to leukocyte adhesion receptor p150,95. The present invention further includes: Concerning the cloning of the DNA sequence encoding the α-subunit of this molecule. Ru. This invention has state support in part. The state has certain rights to this invention. Ru.

■Deposit ΩE residence in 1 The immune system protects animals from foreign invaders such as bacteria, viruses, etc. . An excellent evaluation of defense systems is given by Eisen, H.W. H, W, ) (Microbiology, 3rd edition , Harper & Row, Philadelphia; Pennsylvania (1980), pp. 290-295 and 381-381. (page 418). Immunity that can protect animals from foreign invaders The performance of the system depends in large part on the presence and function of blood cells known as leukocytes. do. The ability of white blood cells to provide this protection is due to the fact that these cells It was found that it is necessary to attach to the cellular matrix and the extracellular matrix.

For example, white blood cells may migrate from the circulation to areas of inflammation or progression. It must be able to attach to endothelial cells so that it can adhere to it. Yet again , they must attach to antigen-providing cells so that a normal immune response can occur. No. They are virally infected (or tumor) so that lysis of cells can occur. It must also be able to attach to appropriate target cells. Furthermore, white blood cells , seeds so that they can effectively phagocytose and clean microorganisms and cell debris. can attach to various activated proteins (e.g. 1C3b - the activated form of the third component of complement). I have to come. Leukocyte adhesion is a requirement for a properly functioning host defense system. Ru. The host "recognizes" the transplanted tissue as foreign and mounts an immune response against it. Suppression of this defense system is desirable in cases such as transplantation. Therefore Thus, leukocyte adhesion is also involved in the rejection of transplanted tissues and organs. sand Thus, understanding leukocyte adhesion can increase an animal's ability to fight infection. or suppress the animal's ability to reject the transplanted tissue. can.

In recent years, leukocyte surface molecules associated with mediating leukocyte adhesion have been identified in hybridomas. identified using technology. That is, it is bound to the leukocyte surface and has the above-mentioned adhesion relationship. Human T-cells (Davignon, D. D.) et al., Proceedings Sub National Academy Sub Sci. Nshiz Niinisei (PrcK.

Natl, A cad, S ci, U S A) Yu8: 4535-4 539 (1981)) and mouse lung cells (Springer, T. inger, T.) et al., European Journal Sub-Immunology ( E ur, J, I mmunol, ) Shadow: 301-306 (1979 ))) were identified (Sbringer, T. S pringer, T, et al. (F ed, P roc, ) ■ 2660-2663 (1985)). child The molecules recognized by these antibodies are linked to adhesion receptor molecules that are associated with lymphocyte function. Chain antigen-1 family-CLymphocyte Function-Assoc Antigen-1 family) J (or rLFA-1 family) It consists of a set of leukocyte adhesion receptors known as ``Milliy'').

The LFA-1 family of adhesion receptor molecules has three highly related cell surface Contains glycoprotein. These glycoproteins mediate cell-cell interactions in inflammation. It was found that it mediates. The glycoprotein is rLFA-IJ (lymphocyte function-related antigen). -1), referred to as rMac lj and rp150,95J. LFA-1 is It is found on the surface of most red blood cells (Sbringer, T.A. Nger, T., A.) et al., Im/Logical Levine (rmmu) Nol, Rev.) 68: 111-135 (1982)), Mac-1 and and p150,95 are primarily found in macrophages, granulocytes and other large granular cells. It is seen in the Npa ball (Springer, T, A, et al., Im/Logical Reviews (Immunol, Rev,) 68 :111 135 (1982): Kaiser, G. et al., European Journal Sub-Immunology (Eur, J. Immun. ol, ) 15:1142 1147 (1985)).

The LFA-1 glycoprotein family each non-covalently associates with the β-subunit. It consists of a heterodimer containing several α-subunits. of the family It has been found that the α-subunits are different from each other, with CDI la, C They are called D1lb and CD1lc. The glycolylated α-subunits are each , has a molecular weight of approximately 180.170 and 150 kd. In contrast, adhesive that the β-subunits of the LFA-1 family of receptors are identical and It was found to have a molecular weight of 95 kd (Sánchez-Madrid, F. anchez-Madrid, F, et al., Journal Sub E. Kiss Helimental - Medici 7 (J, E xper, Med,) ±5 8:1785-1803 (1983); Keizer, G.D. , G.

D.) et al., European Journal Sub-Immunology (Eur, J.

Tee (Springer, T,), Federation Proceedings (Fed, Proc,) 44:2660 2663 (1985): Sanchez - Madrid, F., et al. Null Sub Exhermental Medici 7 (J, E xper, Med, ) supra 58: 586-602 (1983)).

Glycoprotein α-subunits share extensive homogeneity with β-subunits However, precise analysis of the α-subunits of glycoproteins reveals that there is no substantial difference between them. It was shown that there is a similarity between the two. α and β-subunits of the adhesion molecule glycoprotein family An evaluation of the similarity between knits was carried out by Sanchez-Madrid, F. -Madrid, F., et al. (Journal Sub-Experimental Medicine) Shin (J, E xper.

Med, ) 158: 586 602 (1983): Journal Sabu x Kishe Rimental Medici 7 (J, Exper, Med,) 158: 1785- 1803; Miller 1, L.G., et al. Journal Sub Im/Cl G (J, Immunol,) 138:2381 2383 (1987)).

The importance of the LFA-1 family of receptors (specific α-subunits or a monoclonal protein that was able to bind to either the common β-subunit or In a study that demonstrated the ability of null antibodies to inhibit adhesion-dependent leukocyte function, (Sanchez-Madrid, F.) Drid, F.) et al., Brodinges Sub-National Academy Subsciences (Proc, Natl, Acad, Sci, USA) 79: 7489-7493 (1982); Bella, D.I. Beller, D., 1. ) et al., Journal Sub-Experimental Methods Disin (J, E xper.

156: 1000-1009 (1982).

Recently, several members of the LFA-1 adhesion protein family on the surface of leukocytes have been investigated. A group of individuals has been identified who are able to overdo the normal amount. This disease is Referred to as “leukocyte adhesion deficiency” or rLADJ, it causes chronic and intermittent infections and characterized by other clinical symptoms (Anderson, DC) <undergon, <D>, <C,) U-Federation proceedings (Fed, Proc,) 44:2671-2677 (1985): Under An-derson, D.C., et al., Journal ・Sub Infectious Diseases (J, Infect, Dis,) 15 2: 668-689 (1985)).

Leukocytes from LAD patients differ from those of normal individuals in that they are members of the LFA-1 family. Similar to what is observed when antagonized by antibodies specific for the bar showed a deficiency in vitro. LAD patients have a normal immune response I found out that I can't.

This disadvantage is due to the fact that leukocytes in LAD patients adhere to the cellular and extracellular matrix. (Anderson, D.C.) Anderson, D., C.) et al., Federation Proceedings. (Fed, Proc,) 44:2671 2677 (1985); Anderson, D. C., et al., Journal Service. Infectious Daisies (J, Infect, D is, ) 152:668-689 (1985)). These studies have shown that white blood cells Due to the lack of functional adhesion molecules on the surface of the cell, it cannot attach normally. It was found that the inflammatory response was reduced when

Therefore, i.e. leukemia that can maintain the animal's health and ability to live The ability of spheres to interact with other cells (e.g. endothelial cells) and proteins (e.g. 1C 3b) Requires that it be able to adhere to. This adhesive force is due to the white blood cell may require contact involving specific receptor molecules present on the spherical surface. Do you get it. These cell surface receptor molecules are highly related to each other I understand. Humans whose white blood cells lack these cell surface receptor molecules have Presents with chronic and intermittent infections and other clinical symptoms.

Leukocyte adhesion is associated with the process by which foreign tissue is identified and rejected, so Understanding is of great value in the fields of organ transplantation, tissue transplantation, allergy and oncology It is something.

Summary of the invention The present invention relates to leukocyte cell surface adhesion receptor molecules, and in particular to recombinant leukocyte cell surface adhesion receptor molecules. Determination of the α-subunit of the p150,95 receptor molecule by using DNA technology Concerning cloning and expression. The present invention relates to the attachment molecule itself, the molecule functional fragments of nucleic acids capable of encoding these receptor molecules (i.e., DNA, particularly cDNA), and proteins containing such nucleic acid sequences. Regarding lasmids. The present invention further provides for the production of receptor components using recombinant DNA technology. Includes methods for producing offspring.

In particular, the present invention is substantially free of natural impurities and (1) p150,95 and (2) the functional α-subunit of p150,95. A polypeptide selected from the group consisting of derivatives is provided.

Furthermore, the present invention provides (1) the α-subunit node of p150,95; and (2) selected from the group consisting of functional derivatives of the α-subuninod of p150.95 A recombinant nucleic acid molecule containing an oligonucleotide hooding a polypeptide related.

Further, the present invention provides that the anti-inflammatory drug contains (1) the α-subunit of p150.95, and (2) selected from the group consisting of functional derivatives of the α-subunit of p150,95; Administer a sufficient amount of an anti-inflammatory drug to suppress inflammation, which is characterized by consisting of A method for treating inflammation comprising administering the drug to a subject in need of such treatment.

The present invention also provides anti-inflammatory drugs for the LFA, -1 family of receptor molecules. Implementation of the above method characterized in that the β-subunit of the member belonging to including aspects.

Furthermore, the present invention provides for delayed inflammation type hypersensitivity; autoimmune disease symptoms; Reynaud's syndrome: autoimmune thyroiditis: EAE; multiple sclerosis Rheumatoid arthritis: Erythematous lupus; Organ transplant rejection: Tissue transplant rejection; Adult respiratory distress Intractable syndrome; multiple organ injury syndrome secondary to sepsis; multiple organ injury syndrome secondary to trauma Organ injury syndrome; tissue reperfusion injury; acute glomerulonephritis; reactive arthritis; acute inflammation Elemental skin diseases; central nervous system inflammatory diseases: burns; hemodialysis; leukapheresis; ulcerative Select from the group consisting of colitis; Crohn's disease; necrotizing enteritis; granulocyte infusion-related syndrome and the above method for treating inflammation characterized in that it relates to symptoms of

Brief description of the drawing Figure 1 shows reverse phase HPLC of p150,95α-subunit tryptic peptide. The separation profile is shown. 280 nm (bottom profile) and 214 nm Elution was monitored by optical density at (top profile). By the dot The peptides shown were subjected to protein microsequencing. The line that crosses the profile is The percentage of tonitrile is shown.

Figure 2 shows p150,95α-subunit cDNA clone λX47 (A) and and λX44 (B) restriction map is shown. Restriction sites are EcoRI (E), Bgl l [(B), Pst l (P), 5phl (S), Rsal (R), 5acl (Sa) and Xa+a I (X). The reading frame is indicated by a bold line.

Empty frames represent Alu arrays. The positions of two intervening sequences in λX44 are indicated.

Figure 3 shows the nucleic acid of p150,95α-subunit of cDNA clone λX47. Reotide and derived amino acid sequences are shown. N-terminal sequence and trypsin Peptide sequences are underlined.

Dasonyu is included in the signal sequence and transmembrane domain.

Partial Alu sequences in the 3° untranslated region are underlined. Polyadenyl /Gnar is surrounded by a frame.

Figure 4 shows the homologous repeats and mediators in the p150,95α-subunit gene. Indicates the existing array. Panel A shows the presence of homologous tandem repeats. Common residues are frames surrounded by r[VS BJ indicates the position of intervening sequence B. bivalent yang The putative coordination of the ionic binding site is shown. The protein behind the metal ion binding site Lorin is indicated by an arrow. Panel B shows the incompletely spliced λ Intervening sequences IVS A and IVSB detected in the X44 cDNA clone The nucleotide sequence is shown. The encrypted area and the non-encrypted area are separated by a diagonal line. There is. The deduced amino acid sequence of the coding region is shown.

Figure 5 shows the known drugs of valve albumin, trobronin C and calmodulin. p150,9 compared to the sequence of the lucium and/or magnesium binding site. The putative cation binding sequence of the 5α-subunit is shown.

Figure 6 shows the α chain of the p150.95 molecule, platelet glycoprotein Ub/IIIa, and vitrone. Compare the homology with α chain of cutin receptor and fibronectin receptor. Ru. In addition to the cysteine residues circled, the p150.95α-subunit and The same points as other α-subunits and G are enclosed in a frame. RGD-receptor α-sa The cleavage site for the unit is indicated by an arrowhead.

FIG. 7 shows the complete p150, as deduced from sequencing of cDNA clones. A representative schematic diagram of 95 molecules is shown.

Description of preferred specific examples 1. Properties of leukocyte adhesion proteins of the LFA-1 family Three leukocyte adhesion proteins Mac 1. p150.95, and LFA-1 are involved in the function and function of leukocyte subdivisions. and expression are different. Mac-1 and p15'0.95 on neutrophils and monocytes expressed in (Springer, T.A.) , ) et al., Biochemistry of Macrophages acrophages) (CIBA Symposium) m) 118); Pitman, London, pp. 102-12 6 (1986)). During the differentiation of blood monocytes into tissue macrophages, p 150.95 expression is greatly increased and Mac-1 expression is decreased (Swartin , Schwart ing, R, et al., Brad : 974-983 (1985): Hogg, N. et al. European Journal Sub-Immunology (Eur, J, Im++uno1 ．． ) 16: 240-248 (1986)). p150°95 is a certain type It is also expressed on activated T and 8928 cells, but it is not expressed on these cells in the blood. It does not appear (Kaligaris-Cappio) , F. et al., Blood 66:1035-1042 (1985 ): Miller, L. J. et al., J.L. t-Sub Immunology (J, Imw+uno1.) 137: 2891-2 900 (1986); Keizer, D.G. Journal Sub-Immunology (J, rmmunol, ) ±38:31 30-3136 (1987)).

Mac-i and p150,95 are mobilized to the cell surface by inflammatory mediators Expressed in intracellular antral compartments in circulating neutrophils and monocytes (Todd, A. Todd, R.F., Journal Sub-Clinical In Vestigation (J, CIin, Invest, ), Yu4: 1280-1290 (1984): Suzulinger. T.A. (S prin) Ger, T., A.) et al., Biochemistry of macrophages (Biochem istryof Macrophages) (Ciba Symposium (CIB) A S ymposium) 118), bit 7:/(Pitman), London, pp. 102-126 (1986); Lanier, L. anier, 　　　　　　　　L　　　, Rosie (Eur, J, Immunol,) 15 Near 13-718 (19 85); Yancey, K. B. et al., Journal - Sub-Immunology (J, Immunol,) 135: 465-470 (1985)). This mobilization is associated with increased adhesion (Anderlin, Di - Anderson, D, C, et al., Ann, Rev.

Med, 38:175-194 (1987)).

Monoclonal antibodies against Mac-1 or p150,95 inhibit neutrophil aggregation and and inhibits adhesion to endothelial cells, protein-coated surfaces, bacteria, protozoan parasites, and fungi. Conquer (H6rlan.

J, M, et al., Blood (Tanzanri ρdan 6: 167-178 (1985); Springer, T.A., et al., Macropha B iochemistry of Macrophages (CIBA Φ Symposium (CI B A S symposium) l 18) , Pitman, London, pp. 102-126 (19 86); Dana, N. et al., Journal Sub-Immunology ( J, I+muno1. ) 137:3259 (1986); Bullock, W., D. et al., Journal Sub-Experimenter Le Medicine (J, Exper, Med,) 165: 195- 210 (1987); Mogser, D.M., et al. Journal Sub-Immunology (J, Immut+o1.) 135: 27 85-2789 (1985)).

Mac-1 is also the receptor for complement component 1C3b (Bella, D. ・Beller, D, I, et al., Journal Sub Exhermen Tal Medicine (J, Expert, Med,) 156: 1000-1 009 (1982)). Detergent soluble Mac-1 and p150.95 are 1C 3b-Sepharose I did it (Micklem, K, 'J,) et al., Biochemical Journal (Biochem, J,) 231:233 2 36 (1985)).

LFA-1 is present on all leukocytes except a subset of macrophages.

Monoclonal antibody blocking studies have shown that LFA~1 induces T-lymphocyte-mediated killing, T important in helper lymphocyte responses, spontaneous death, and antibody-dependent death. I found out (Springer, T, A, ), Ann, Rev, Immunol, 5:223-252 (198 7)). Adhesion to target cells is blocked by antibodies against LFA-1 It is. Functional studies have shown that LFA-1 interacts with several ligands. It was suggested that one of the ligands was FCAM-1 ( Rothlein, R. et al., Journal Sub Im. J. Immunol. 137:1270 1274 (1986)).

Certain cytotoxic T lymphocyte clones produce similar amounts of p150,95 and LFA-1. I found out that it appears. for LFA-1 and p150°95α-subunit. monoclonal antibodies that kill such CTL clones to the same extent. additive in their inhibitory effect (Kaiser, G. Dee (Keizer)

G, D, et al., Journal Sub-Immunology (J, I mmunol, ) Dotan Shadow: 3130-3136 (1987)). Furthermore, p150,95 It was found that antibodies against the α subunit suppressed monocyte adhesion to the endothelium (Fig. Keizer, G.D., et al., European Japan Nal sub-immunology (Eur, J, Immunol, ) 17:1317-1322 (1987)).

Some of the various methods for cloning the U, p150,95α-subunit can be used to clone the p150,95α-subunit gene.

One such method contains the p150,95α-subunit gene. (induced from p150,95α-subunit expressing cells) analysis of a shuttle vector library of cDNA inserts do. Such analysis involves transfecting cells via the vector and then performed by assaying for p150,95α-subunit expression. Ru. A preferred method for cloning the p150,95α-subunit gene is , requires determining the amino acid sequence of the p150,95α-subunit molecule. do. To accomplish this study, the p150,95α-subunit molecule was Separation from producer cells by noclonal antibody affinity chromatography prepared and preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis (r sDs-pAGEJ) and electroelution. (Miller).

Miller, L., J. et al., Journal Sub Immunology G (J, I+omuno1.) 138: 2381-2383 (1987) , this document is incorporated herein by reference). α-subunit molecule for example via cyanogen bromide or papain, bovine mottribucin or are fragmented via proteases such as trypsin (Oike, Wa). Oike, Y, et al., Journal Sub Biologica/lz-chem Story (J, Biol, Chem,) 257: 9751-9758 (19 82): Liu, C. et al., International Journal Sa. Bu Peptide and Protein Research (Int, J, Pept, Pr Res, ) 21: 209-215 (1983)). Preferably , the α-subunit is proteolytically digested by trypsin. obtained Peptides are separated by reverse phase HPLC and amino acid sequenced. this research To achieve this, the protein is preferably analyzed by an automated sequencer. Ru. It is possible to determine the entire amino acid sequence of the p150.95α-subunit. However, it is preferred to sequence peptide fragments of the molecule.

As used herein, sequences of amino acid residues in peptides are referred to in their commonly used indicated by the use of three-letter names, or by their one-letter names. Ru. A list of these three-letter and one-letter names is a list of biochemistry (Bio) chemistry) (Lehninger, A. ), Aus Publinochards, New York, New York (1970) ) can be found in text such as If such an array is listed vertically , the amino-terminal residue is intended to be at the top of the list, and the carboxy-terminal residue of the peptide The terminal residue is intended to be at the bottom of the list. Similarly, listed horizontally , the amine end is intended to be on the left end, while the carboxy end The edge is intended to be on the far right.

Amino acid residues in a peptide may be separated by hyphens. This kind of high is intended only to facilitate display of arrays.

As a simply illustrative example, -G　Iy　-A　Ia　-S　er　-P　he　- Amino acid sequence In this case, the Ala residue is connected to the carboxy group of Gly, and the ser residue is connected to the carboxy group of the Ala residue. It is shown to be connected to the carboxy group and to the amino group of the Phe residue. Further applicable The amino acid sequence shown is tetrapeptide Gly-Ala-Ser- Indicates that Phe is included. The representation represents the amino acid sequence in this one tetra Although not intended to be limited to peptides, (1) their amino terminus or carbo A tetrapep with one or more amino acids linked to either the xy-terminus (2) l or linked to both its amine terminus and its carboxy terminus. (3) a tetrapeptide with more amino acid residues; (3) a tetrapeptide with more amino acid residues; It is intended to include tetrapeptides without groups.

After sequencing one or more suitable peptide fragments, they can be DNA sequences that can be coded are tested. Since the gene food changes, 1. More than one codon can be used to code for a specific amino acid (Watson, J.D. (Watson)

J, D.), Molecular Biology of Genes f the Gene) 3rd edition, W. A. Benjamin, Inc. Ited (W, A, B enjawin, Ine,), men mouth/pa C. A. (1977), pp. 356-357). peptide fragment analyzed and encoded by the oligonucleotide with the lowest degree of alteration. Identify the sequence of amino acids obtained. It is encoded by only a single codon Preferably, this is done by identifying sequences containing amino acids that contain the same amino acids.

In some cases, an amino acid sequence is encoded by only a single oligonucleotide. However, often the amino acid sequence is the same as any set of similar oligonucleotides. can be coded by the code. Importantly, all of the members of this set are peptides. contains an oligonucleotide capable of encoding a fragment. and therefore the same oligonucleotide as the gene encoding the peptide fragment. potentially contains a nucleotide sequence, but is one member of the set. The cell contains a nucleotide sequence that is identical to that of the gene.

This member is present in the set and even in the presence of other members of this set D Since it is possible to hybridize to NA, the peptide-encoding gene The same method uses a single oligonucleotide to clone the gene. Unfractionated sets of oligonucleotides can be used.

Can encode fragments of the p150,95α-subunit gene (or such an oligonucleotide or set of oligonucleotides) a suitable oligonucleotide or combination of oligonucleotides that are specifically complementary). was identified (using the methods described above), synthesized, and produced the p150,95α-subunit. DNA derived from human cells capable of expressing the target gene or more Preferably, the cDNA, type I, is harvested by means well known to those skilled in the art. Ibrigated. The technique of nucleic acid hybridization was developed by Maniatis and Tes. Maniatis, T. et al. (Molecular Cloning, A Lab. Latry-7Ninal (Molecular Cloning.

A Laboratory Manual), Cold Spring Harbor ・Laboratories (Cold Spring Harbor ries), Cold Spring Harbor 1 Niyoke (1982)), and Haymes, B., D., et al. Tsuku Acid Hybridization, A Practical Abloh f( Nucleic Acid Hybridization, A Practica IRI, Press, Washington DC (19 No. 85 No. 85, and this document is cited herein as reference material. . The source of the DNA or cDNA used was p150.95α-subunit, Preferably, it is enriched with respect to sequence. Such enrichment is associated with high levels of p1 By extracting RNA from cells producing 50,95α-subunit, It can be most easily obtained from the obtained cDNA. An example of such cells is hair B lymphocytes from an individual suffering from Lie-Sell leukemia.

Techniques such as those described above or similar can be applied to human aldehyde dehydrogenase (Fus et al. Hsu, L, C, et al., Proceedings Sub National ・Academy Sub-Sciences Ninisei (Proe, Natl, Acad, S et, U S A), 82: 3771-3775 (1 985no, Fibronectin (Suzuki, S, et al., E ur.

Mo1. Biol, Organ, J. 4: 25192524 (1985 )), human estrogen receptor gene (Walter, P. P,) et al., Proceedings Sub-National Academy Sub-Sa. Iensis Ninisei (Proc, Natl, Acad, Sci , U S'A) 827889-7893 (1985)), tissue-type plasmino Gen activator (Pennica, D, et al., NE) Ichi + (N ature) 3 alkaline phosphatase Aiura's DNA (cam, W (K am, W, N et al., Prontinges Sub National Academy of Sub-Sciences (Proc, Natl, A cad, Sci, U.S.A. 82:8715-8719 (1985)) successfully made it possible to clone the gene for

Using the genetic code (Watson, J.D. ), Molecular Biology of Genes he Gene) 3rd edition, W. A. Benjamin, Inc. Do (W, A, B en-jamin, I nc,), Menlo Park , CA (1977)) to identify one or more different oligonucleotides. and each of them is associated with the p150,95α-subunit tryptic peptide. It would be possible to code Chido. Certain oligonucleotides are actually real is likely to constitute the p150,95α-subunit-encoding sequence of , due to abnormal base pairing relationships and in eukaryotic cells (to code for specific amino acids) ) can be assessed by considering how often a particular codon is actually used . Such "codon usage rules" are based on Reis, R. et al., Journal of Sub-Molecular Biology (J, Molec, Bio I, ) 183: 1-12 (1985). Wraith's p150,95α-subunit tryptic peptide using the “codon usage rules”. The theoretically “most possible” nucleotide sequence that could encode the nucleotide sequence A single oligonucleotide or a set of oligonucleotides containing the same determined.

A theoretical possibility that could encode a p150,95α-subunit fragment an oligonucleotide or set of oligonucleotides containing the "most possible" sequence of Nucleotides are known to hybridize to the "most possible" sequence or set of sequences. of complementary oligonucleotides or pairs of oligonucleotides capable of Used to identify sequences. Oligonucleotides containing such complementary sequences Cleotide was used as a probe to detect the p150,95α-subunit gene. can be identified and isolated (Maniatis.

Maniatis, T. et al., Molecular Cloning A. Laboratory-7=, Al (Molecular Cloning A Lab oratorYManual), Cold Spring Harbor Breath, Co. Old Spring Harbor-12 York (1982)).

Thus, i.e., the actual p150,95α-subunit peptide sequence Identification identifies the theoretically “most likely” peptide that could encode such a peptide. A capable J DNA sequence or set of such sequences can be identified. this by constructing oligonucleotides complementary to the theoretical sequence (or , the set of oligonucleotides that are complementary to the "most possible" set of oligonucleotides. by constructing the p150,95α-subunit gene. A DNA molecule (also known as obtains a set of DNA molecules).

'The most possible Jp150,95α-subunit tryptic peptide Single-stranded oligonucleotide molecules complementary to sequences that are It was synthesized using the method described by Elagaje, R CB. ) et al., Journal of Sub-Biological Chemistry (J, Biol, C. hem, ) 254: 5765 5780 (1979); Maniatis, T. - (Maniatis, T.) et al., Molecular mechanisms in the control of gene expression (Molecular Mechanisms in the Control of Gene Expression), Neil Rich, DMP (N 1erlich, D., P., et al., eds., Academy Press, New York (1976): Wu, R, et al., Prog, N.ucl. , A aid Res.

Molec, Biol, 21:101 141 (1978);) - Lana, 7-/ Niichi G (K horana, R, G,), Science (S science) ) 203: 614-625 (1979)). Furthermore, DNA synthesis is automated This can be achieved by using a generator.

p150,95 from eukaryotic DNA preparations hypothesized to contain this gene. It is possible to clone the α-subunit gene. p150.95α-sa To identify and clone the gene encoding the buunit protein, DN A or more preferably a cDNA library is added to the oligonucleotide library described above. Screen for abilities that can be hybridized by -b .

A suitable NA preparation (e.g., thorn/muscle DNA) can be cleaved enzymatically. or optionally sheared and ligated into a recombinant vector. Then, these recombinant vectors Measuring the ability of the vector to hybridize to the above oligonucleotide probe . Methods for hybridizing include, for example, Maniatis, T. atis, T.), Molecular Cloning A Laboratory Manual Molecular Clonin A Laboratory Manua l), Cold Spring Harbor Press, Cold Spring Harbor Press Barr, New York (1982) or Hames, B.T. B, T, et al., Nuclei Tsuk Acid Hybridization A. Practical approach (Nucleic Ac1d Hybridiza) tion a Practical Approach).

Disclosed in IRL Press, Offsford, UK (, 1, 985). It is. Next, he discovered the possibility of such hybridization. Analyzing the vectors to determine the p150.95α-subunit sequences they contain Measure the length and properties of. Based solely on statistical considerations, p150,95α -Genes that encode subunit molecules are 18 nucleotides. Using oligonucleotide probes with can be unambiguously identified (through screening).

The cloned p150,95α-subunit gene obtained by the above method is , operably linked to an expression vector and introduced into a prokaryotic or eukaryotic cell to produce p15 0,95α-subuni-nod protein can be produced. Such manufacturing method According to Maniatis, T. et al., the above-mentioned literature disclosed and well known to those skilled in the art.

Expression of the p160,95α-subunit The present invention relates, in part, to expression of the p150,95α-subunit. From the discovery of the c'DNA sequence encoding 95 molecules of α-subunit nodes, be guided. This sequence (or a fragment of this sequence) into a functional promoter α of p150.95 in cells or microorganisms by operatively linking - The subunits (or their functional derivatives) can be expressed.

D, Nucleic acid molecules such as NA contain nucleotides that contain transcriptional and translational regulatory information. Nucleotides that contain a double-domain sequence and such a sequence doubles or doubles into a polypeptide. [expressing] a polypeptide when ``operably linked'' to a leotide sequence. It is said that it is possible. Operable linkage is between the regulatory DNA sequence and the protein being expressed. A linkage in which DNA sequences that are linked together in such a way that the gene can be expressed.

The predetermined nature of the regulatory regions necessary for gene expression is determined by microorganisms. may vary, but generally in prokaryotes (directs the initiation of RNA transcription) A promoter and a DNA sequence that signals the start of protein synthesis when transcribed into RNA. should contain columns. Regulatory regions in eukaryotic cells generally control the initiation of RNA synthesis. Contains sufficient promoter region to direct.

Two DNA sequences (e.g. promonitor region sequence and p150.95α-substitute unit-encoding sequence), the nature of the bond between two DNA sequences is (1) (2) p150,95α-subunit - interferes with the ability of the promoter region sequence to transcribe the coated sequence. or (3) can be transcribed by the promoter region sequence. p150.95α-subunit, if it does not interfere with the ability of the to-encoding sequence to said to be operationally combined. Therefore, the promoter region operably linked to a DNA sequence when the target is capable of causing transcription of the DNA sequence will be done.

The present invention relates to the p150,95α-subunit (also known as concerning the expression of their functional derivatives). Prokaryotic cells (e.g. Escherichia coli (E, coli), Bacillus subtilis (or their functional derivatives) ) to express the p150,95α-subunit in a functional prokaryotic promoter. It is necessary to operably link the to-encoded sequences. Promotions like this The controller may be constitutive or more preferably regulatable (i.e., inducible or repressive). It can be extrinsic. Examples of constitutive promoters include batatenitur acetyl Examples include the CAT promoter of transferase. Inducible prokaryotic promo Examples of promoters include the major right and left promoters of the grouper teriophane λ. (PL and pm), “Phantom of Escherichia co’J (E, coli)”, binary, − Prisoner 11 sphere needle and shadow 1 promoter, α-amylase (Urmanen, Ai (U) 1manen, I, et al., Journal Sub-Bacteriology (J, B acteriol,) Kamidan Uni 176-182 (1985)) and BA Chillus subtilis (B, 5ubtilis) σ-28-Special - (Gilman, M Z) (Gilman.

M, Z, et al., Gene (1984), Bacillus (B) acil 1us) bacteriophage promoter (glyxan.

G ryczan, T, J, Molecular biology of Bacillus species The Molecular Biology of the Bacillus li), Academic Press.

Incophorentinod, Niyoke (1982)), and Streptomycetes Strept. myces promoter (War, J.M. , d, J, M,) et al. (Mo1. Gen, Genet, ) 203:468 478 (1986)) can be mentioned. Prokaryotic promoters were prepared by Glick, B.R. .

R, XJ, Ind. Microbiol, L: 277 282 (1987)): Cenat iempo, Y (Biosimii) iochimie) 68:505-516 (1986); G ottesman.

S.) (Ann, Rev. Genet, and: 415-442 (19814)) Therefore, it is disclosed.

Proper expression in prokaryotic cells requires a liposome binding site upstream of the gene-coding sequence. It requires the existence of a position. Such liposome binding sites include, for example, gold, Gold, L, et al. (Ann, Rev, M 1cro-biol, 35:365-404 (1981)).

expression in eukaryotic cells such as yeast, fungi, mammalian cells, or plant cells. If desired, a promoter that can be transcribed in such eukaryotic hosts may be used. It would be necessary to have one. Preferred eukaryotic promoters include mouse metallothio Nein r gene promoter (Hamer, D., et al., J.D.) Nullal Sub-Molecular and Applied Numerology (J, Mo1. A ppl, G en, )-(McKnight, Varnish (M c K night, S, ), Cell 31: 355-365 (19 82)); SV40 early promoter (B enoist , C, et al., Nature (London) 304-310 (1981)); Yeast gene promoter (Shikon J. Ohnston, S., A., et al., Proceedings. Inges Sub National Academy Sub Sciences (Ninisei) ) (Proc, Natl, Acad, Sci, (USA)) 79: 697m -6975 (1982); Silver, P.A. (S1lver, P, A , ) et al., Proceedings Sub National Academy Sub Science Shizu (Ninisei) (Proc, Natl, Acad, Sci, (USA)) 81:5951-5955 (1984)).

As is widely known, eukaryotic mRNA translation encodes the first methionine. Starts with the codon that is present. For this, eukaryotic promoters and p150,95α- DNA sequences encoding the subunits (or their functional derivatives) The intervening codon (i.e., AUG ) does not contain. The presence of such a codon (AUG codon or pL50, 95) fusion protein when it is in the same reading frame as the DNA sequence encoding or (a sequence whose AUG code encodes p150.95) a frameshift mutation occurs when the sequence is not in the same reading frame as the column).

When operably linked to a functional promoter, the p150,95 protein (or A DNA sequence encoding a functional derivative of exchange, transfection, conjugation, [JF41t-8 go, electronic Either by troporation (electropora-t1on), etc. Preferably, it is also introduced into the recipient cell.

p150,95α-subunit-encoding sequence and operatively linked promoter A vector can be a non-replicating DNA (or RNA) molecule, either of which can be a linear molecule, or a more preferably can be introduced into the recipient cell as a closed covalent circular molecule. child Molecules such as p150,95α-subunit Expression of the double/to polypeptide can occur through transient expression of the introduced sequences.

On the other hand, permanent expression can occur through integration of introduced sequences into the host chromosome. Ru.

Preferably, the introduced sequence is a plasmid capable of autonomous replication in the recipient host. or will be incorporated into a viral vector.

A wide variety of vectors can be used for this purpose. Certain plasmids or An important factor when selecting a viral vector is the vector containing These recipient cells can be easily recognized and selected from vector-free recipient cells. desired vector copy number in a particular host; and different types of hosts. The question is whether it is desirable to be able to "shuttle" vectors between cells. It will be done. Preferred prokaryotic vectors include vectors in Escherichia coli. (e.g., pBR3 22, Co1E1, pscol, pAcyc184, π■x). A program like this Lasmids include, for example, Maniatis, T. ) et al. (Molecular Cloning, A Laboratory 9 Manual (Mole cular Cloning, A Laboratory Manual), code Cold Spring Harbor Press, Cold Spring Harbor, New - York (1982)). Bacillus ) plasmids include pc194, pc221, I) TI27, etc. Ru. Such plasmids include Gryczan, T. , ) (The Molecular Biology of Bacilli ogy of the Bacilli), Akademi'Tsuku Press, Newyo (1982), pp. 307-329). appropriate As a Streptomyces plasmid, p' IJ101 (Kendal, K.G.

K, J, et al., Journal of Sub-Hacteriology (J, B actor) iol, ), Kanjirudan: 4177-4183 (1987)) and φC31 (chi Chatter.

K. F. et al., 6th International Society of Actinobacteriaceae Biology Streptomyces bacterium such as Sympo 86), pp. 45-54) Examples include phages. Pseudomonas plasmids were produced by John, J.E. John, J. F. et al. (Reviews of sub-infectious diseases) Jizz (Rev, rnfect, Dis,) 8: 693-704 (19 86 Ri and Izaki, Kei (Izaki, K, ) J pn, J, B acteriol.

Danshu: 729-742 (1978)).

Preferred eukaryotic plasmids include BPV, Vaccinia, 5v40.2 micron Examples include 2-micron circles and their derivatives. . Such plasmids are well known to those skilled in the art (Botstein, D. Botstein, D.) et al., MiaIIli Wntr, Syn+p, 1 Uni 265-274 (1982): Brooch, B roa Ch.

J, R.), Molecular biology of yeasts and phylomyces: life cycle and genetics (The Mo1ecular B iology or the Yea’st S accharomyces Laboratory, Cold Spring Harbor , New York, pp. 445-470 (1981); Broch, J.A. Breach, J, R, Cell 28:203 20 4 (1982), Bollon, D., P. et al., J. , CIin, Hematol.

0nco1. 10: 39-48 (1980):'? Niatis, Tea ( Maniatis, T.), Cell Biology Comprehensive To Rites, Volume 3, Gene Express, pp. 7712-608 (1 980no.

The present invention provides the nucleic acid and protein of the α-subunit of one molecule of pL50.95 receptor. Provide an array. The present invention provides a system for producing p150,95α-subunit molecules. Enables the use of alternative DN A technology.

As further described below, one embodiment of the invention provides p1 as an anti-inflammatory agent. Concerning the use of 50.95 molecules of the α-subunit by itself. Preferred ingredients In the example, the α-subunit of the p150.95 molecule is separated by its β-subunit, will be used in combination with Such combinations can be made using various methods. may be performed. For example, the β-subunit of p150.95 is may be produced separately from the 95α-subunit, and then the two molecules are brought together. May be mixed with However, the p150,95 heterodimeric receptor molecule p150,95 in the same host cell to facilitate their self-assembly into It is preferred to produce both the α and β-subunits of. p150.95 The β-subunit (common to LFA-1 and Mac-1) is a or by recombinant DNA technology (Kishimoto, T.K. moto.

Cell 48: 68'l 690 (1987) can be produced. Cloning of the β-subunit of p150.95 0 pending U.S. patent applications assigned to 1Q and filed on February 26, 1989 No. 19,440 further disclosed.

One embodiment of the present invention is that one molecule of p150.95 receptor α-subunit)l+- Concerning the discovery of nucleic acid and protein sequences. This finding may act as an antagonist of cell adhesion. recombinant D to produce a functional derivative of p150,95α-subunit, Enables use of NA technology.

As used herein, "antagonist of cell adhesion" refers to cell-cell or cell-cell adhesion. is meant to represent any molecule capable of inhibiting the cell-substrate attachment process. . Specific compounds are identified as antagonists by assaying monocyte adhesion to endothelial cells. It can be determined whether or not. Suitable assays for cell adhesion are e.g. Kaiser, G.D., which is cited as a material in the specification. izer.

G, D, et al. (European Journal Sub-Immunology (Eur.

J. Immunol.) 17:1317 1322 (1987)). There is. Antagonists of cell adhesion can be used as anti-inflammatory agents.

As used herein, the "function" of the α-subunit of p150.95 is defined as ``derivatives'' are substantially identical in biological activity to the α-subunit of p150.95. A compound that has some biological activity (either functional or structural). biological life An example of this is binding to the β-subunit of the LFA family of glycoproteins. anti-α-subunit against p150,95α-subunit. 1) The ability to competitively inhibit the binding of 150.95 antibody. It will be done. when both molecules have substantially the same structure or when both molecules have the same biological activity. A molecule is said to be "substantially identical" to another molecule if it has the same It will be done. I) As a "functional derivative" of the α-subunit of 150.95, p1 Both “fragments” and “mutants” of 50,95α-subuniyh are listed. Lalel. The term "fragment of the α-subunit of rp150,95" means that Meant to represent a polypeptide subset of molecules.

The term rp150,95 α-subunit mutant strain is defined as rp150,95 α-subunit mutant. The α-subunit of p150,95 is identical to the activity of p150,95, or provided that it has at least one biological activity that is inhibitory to the activity. , represents a molecule that is substantially identical in structure to the whole molecule or its fragments. It means to do something. Therefore, the molecules are identical in their activity to p150,95. or a small number of biologically active substances that are inhibitory to such activities. one or more molecules not found in the other molecules, provided that one of the molecules The sequence of amino acid residues in two or more molecules containing more than one amino acid α-subunit p, as used herein, is not the same. It is considered to be a "mutant strain" of 150.95. Thus, for example, p150 found (or not found) in the α-subunit of ゜95 or Compounds lacking (or containing) the above amino acid residues are is identical (or inhibitory) to the biological activity of the α-subunit of p150,95 If it has the biological activity of various p150,95 α-subunits, It can be considered.

The term “biological activity J” refers to “catalytic J activity and “structural” activity (i.e. p150.9 5 β-subunit or anti-α-subunit p150.95 antibody. ability to bind to other molecules).

The present invention provides methods for producing functional derivatives of the α-subunit of the p150,95 molecule. provide law. To obtain such derivatives, the p150.95α-subunit a DNA, RNA or (more preferably) cDNA sequence encoding a target. Only natural mutagenesis is necessary. Mutagenesis can be arbitrary or site-specific It may be either. Additionally, mutagenesis can be spontaneous or may be induced using chemical, radioactive or recombinant techniques.

Chemical mutagens include base analogs (e.g. 5-bromouracil, or 2-aminopurine); deaminating agents (e.g. nitrous acid, hydroxylamine alkylating agents (e.g. methyl methanesulfonate, nitrosaguanidine, etc.); ): or intercolating drugs (e.g., acridine orange, bromide) ethidium, psoralen, etc.). Radiation-induced mutations are caused by ultraviolet, gamma , X-rays, etc. How to mutagenize nucleic acid molecules Miller, J.H. (for molecular biology) Experiments in Molecular B iol ogy), Cold Spring Harbor Laboratory, Cold Spring Ng Barber, New York (1972)) and Silhebian T. Jie. Lee (S1lhavy, T, J,) et al. (Gene fusion experiment (Exper iments with Gene Fusions), Cold Spring Harbor Laboratory, Cold Spring Barber, Two Knee York <1 984)).

Site-directed mutagenesis encodes the p150,95α-subunit It can be used to generate specific mutations at desired sites in nucleic acids. That is, Such methods generally involve the production of synthetic oligonucleotides having the desired defined DNA sequence. Requires cleotide synthesis. To synthesize such oligonucleotides The method is described by Itakura, K. et al. (Ann, Rev. , Biochem, 53: 323-356 (1984)) has been done. p150,95α-subunit protein or its functional derivative. The encoding nucleic acid molecules are generally M2S, φX1, in which the -heavy chains can be separated from each other. The subcloned vector is subcloned onto a double-stranded vector such as 74. Then the vector The single strands are incubated in the presence of synthetic oligonucleotides. oligonucle p150,95α-subunit as the otide DNA is controllably defined. - Construct oligonucleotides that can base pair with any region of the encoding nucleic acid can do.

When base pairing occurs between the oligonucleotide and the single-stranded plasmid, the DNA A polymerase is used to extend the oligonucleotide, resulting in a double-stranded DNA molecule. and then sealed by DNA ligase. This double strand D When an NA molecule is introduced into a cell, semi-conserved DNA? Made by JE, oligonu The DNA sequence of the cleotide fragment corresponds to the p150.95α-subunit code. This will result in the production of progeny molecules that are incorporated into the coded sequence.

Therefore, point mutations in specific sites in the p150,95-encoding sequence and introducing exogenous DNA sequences or normally present in such sequences. Containing mutations or sequences where it is desired to create a nucleotide deletion (or missing) oligonucleotide fragments and then use the method described above. Have them do it.

Such mutations or exogenous DNA sequences can be added to the p150,95α-subunit. - D of the region in which mutagenesis is desired for introduction into a specific region of the encoding nucleic acid; mutated or exogenous by adjacent DNA sequences that are complementary to the NA sequence. It is necessary to enclose the DNA sequence. (Jenkins, F. , F, et al., Bioessays 5:244-24 7 (1986); Delfler, W. angebante hemy international nai edijon in english Shu (Angew, Chem, Int, Ed, Engl,) 23:91 9'-931 (1984): Kaina, B., Biologisi 4 elephants :513-531 (1980); Kunkel, Proceedings. Sub National Academy Sub Sciences (Ninisei) (P roc, Natl, Acad, Sci, (USA)) 82: 488 492 (19&5): Nisbet, I.T., et al. Gene Anal, -Technology (Gene Anal, Tech,) 2 : 23 29 (1985) Hines, J.C. ,) et al., Gene mutations are carried out through the application of recombinant DNA technology. It can be done. For example, pl, a nucleic acid molecule coating a 50,95α-subunit The nucleotide sequence of is an oligonucleotide that can be recognized by a restriction endonuclease. Can be scanned to identify cleotide sites. Then end-nuku like this Reases can be used to specifically cleave nucleic acid sequences at recognized sites. p1 50,95 - recognizes (and cleaves at) two positions in the coding sequence. p150.95-encoded by using a restriction endonuclease that Fragments of sequences can be excised. On the other hand, for this purpose two different endonucleases can be used. Odor of presence of DNA ligase p150.95α-sub The unit-encoding sequence is resealed (to remove the excised fragment). ) can form a single array. Appropriate restriction endonuclease recognition If the site is not present in the p150.95α-subunit-hooded sequence, this Sites such as can be introduced into the sequence by site-directed mutagenesis as described above.

On the other hand, mutations cleave the p150,95α-subunit-encoding sequence; Nibbing the free end with the exonuclease This can be done by j. Such treatment not only removes deletions but also Frameshifts and other types of mutations can be performed. this technology further added a novel restriction exonuclease site to the p150,95α-subunit • Enables introduction into node-encoding sequences. restriction endonuclease , methods for using DNA ligases and exonucleases, e.g. Maniatis, T. et al. (Molecular Claws) Molecular Ctoning, A Laboratory Manual .

A Laboratory' Manual), Cold Spring No. 1- Barr Laboratory, Cold Spring Harbor, New York (198 2)).

Recombinant DNA technology allows the p150.95α-subunit protein (or its functional derivatives) and to produce fusion proteins consisting of novel polypeptides. obtain. This novel polypeptide is not restricted to any particular polypeptide. , a single amino acid or a set or permutation of amino acids (permutat 1 on). Such fusion molecules do not undergo frameshift mutations. DNA sequences encoding novel polypeptides can be transformed into p150,95α - ligated to a DNA sequence encoding the subunit (or a functional derivative thereof) It can be produced by p150,95α-subunit gene (also Preferred polypeptides that can be fused to eukaryotic or functional derivatives thereof include is a prokaryotic signal sequence (Gilbert).

Dubry S (Glbert, W.) et al., U.S. Patent No. 4,411,99 No. 4: K asadaban, M. et al., Proceedi Nges Sub National Academy Sub Sciences (Ninisei) (Proe.

or the stability of the p150,95α-subunit (or a functional derivative thereof); Polypeptides that increase (or decrease) biological half-life or potency are included. Ru. An excellent review of the methodology of gene fusion is given by Sylhevin T.J. (Experiment by gene fusion) ts with Gene F usages), Cold) Spring Her Barr Laboratory, Cold Spring Harbor, New York (198 4)).

Antibodies (especially monoclonal antibodies) are I) 150,95α-subuni.

can be revealed in response to immunization with fragments of Such antibodies , anti-inflammatory as it can be used to prevent the binding of some leukocytes to endothelial cells. It can be used as a medicine.

Using the above method, a fragment of p150,95α-subunit was prepared. , can be assayed to determine whether they are antagonists of cell adhesion. Thin Fragments found to be antagonists of cell adhesion may be used as anti-inflammatory agents according to the present invention. can be used as

The present invention relates to granulocyte matrix adhesion and monocyte-endothelial cell adhesion to p150°95 receptors. derived in part from the discovery that the Inflammation of white blood cells and/or perform various inflammatory factor functions. Because cell attachment is required, drugs that inhibit cell attachment may attenuate or prevent inflammation. will prevent it.

One molecule of p150.95 receptor is present on the surface of monocytic cells.

Adhesion of monocytes to plastic surfaces or monolayers of endothelial cells is induced by p150.95. It is mediated. Furthermore, the ability of monocytes to phagocytose foreign material is dependent on p1 It was found to be mediated by the 50.95 receptor. The receptor is a simple It is implied that it has a role in chemokinesis and chemotaxis of the bulb. .

Ability of a single p150.95 receptor molecule to bind naturally bound ligand Drugs that interfere with pL50,95 can impair all of the pL50,95-dependent functions listed above. It is. Therefore, these drugs serve as anti-inflammatory agents with respect to the present invention. obtain. Such drugs include p150,95α-subunit, p150. 95 (α and β-subunits), and p150.95 α-subunit as well. or a subunit fragment thereof. Ru. All such drugs can be used in accordance with the present invention. The anti-inflammatory drug of the present invention is , to treat inflammation caused by specific or non-specific defense/stem responses. is possible.

“Non-specific defense system reactions” are caused by white blood cells incapable of immunological memory. It is a mediated response. Such cells include lymphocytes and macrophages. Examples include ji. As used herein, inflammation refers to a non-specific defense system. caused by, mediated by, or associated with a reaction of , the inflammation is said to be caused by a non-specific defense system response. at least An example of inflammation caused in part by a nonspecific defense system response is Respiratory distress syndrome (ARDS) or complications secondary to sepsis or trauma Onset organ damage; reperfusion of myocardium or pond tissue: acute glomerulonephritis; reactive arthritis ;Skin diseases caused by acute inflammatory factors: acute suppurative meningitis or other central nervous system inflammatory diseases burns, hemodialysis: leukapheresis: ulcerative colitis: Crohn's disease; necrotising enteritis; condylar Granulocyte infusion-related syndrome: Cytokine-induced toxicity-like symptoms Inflammation related to this can be mentioned.

As used herein, the term oral specific defense system J refers to represents a component of the immune system that responds to the presence of As such a cell , lymphocytes and macrophages. Inflammation is caused by a specific defense system. produced by, mediated by, or associated with a reaction of a stem When relevant, it is said to result from a specific defense system response. specific defense Examples of inflammation caused by a health system response include rubella virus, autoimmune diseases, etc. patients, T-cells (e.g. in individuals who are "positive" in the Manto test) responses to antigens such as delayed-type hypersensitivity responses mediated by . p150,95α-subunit that can antagonize such inflammatory responses The ability of its functional derivatives to treat erythematous lupus, autoimmune thyroiditis, and experimental allergy myelitis (EAE), multiple sclerosis, some forms of diabetes, Reina Chronic inflammatory diseases such as Reynaud syndrome, rheumatoid arthritis, etc. and their therapeutic use in the treatment of autoimmune diseases.

Since p150.95 is expressed on cells that are capable of binding to endothelial tissue, , p150,95α-subunit or p150.95 (α and β - administration of subunits) provides a means to image or visualize endothelial tissue . Furthermore, this method can be used to detect p150,95 receptors on visualized tissues. Provides diagnostic information regarding the amount and distribution of bound ligand in children. Use like this In the p150,95α-subunit (or p150,95αβ receptor molecules), radioisotopes, affinity labels (e.g., biotin, avidin, ), fluorescent labels, paramagnetic atoms, etc.). this Methods for performing such labeling are well known to those skilled in the art. antibodies (or fragments), radioisotopes, enzyme labels, fluorescent labels, paramagnetic labels, high Can be detectably labeled through the use of electron density labels, toxin labels, and the like. preferable Toxin labels include diphtheria toxin, lysine and cholera toxin. child Administration of labeled molecules such as molecule to an individual will identify the site of inflammation. child Detectable labels such as Can be used. Clinical applications of antibodies in diagnostic imaging are discussed in Grossman, H. ・Nilarontsk Clinic of B (G Rossman, H, B,) Sub-North America (Urol, Cl1n, NorthAmer,) 13: 465 474 (1986), Unger, E. C. , ) et al.'s Inhesive Radiology (Invest, Radiol) ) 20: 693 700 (1985), and Kha, B.A. of monocytes that can spontaneously migrate to sites of scien inflammation. Ability depends on p150.95 (Keizer, G.D. G, D, et al., yo50.95α-subunit or p150.95 (α and and β subunit).

Similarly, the ability of monocytoid cells to adhere to endothelial cells and chemotaxis, Mokinesos, or the ability of monocytoid cells to undergo phagocytosis was found to depend on p150.95 (Kaiser, G.D. Izer, D., G.) et al., European Journal Sub-Immunology (E ur, J, I mmunol,) Sat J: 1317-1322 (1 987)). Any anti-inflammatory drug of the present invention may be used to inhibit such activity. It can be done.

ICAMs (e.g., ICAM-1) are known to be effective against certain human viruses (particularly (ICAM-1)). It is recognized by the main type of rhinoviruses that bind to M-1. these This recognition allows the virus to bind to human cells, thereby initiating a viral infection. to mediate. Therefore, a central step in the pathogenesis of viral diseases is these It is an interaction between cellular receptors and viruses.

suppressing or inhibiting the ability of a virus to bind to an ICAM molecule; Drugs that compete with or suppress the ability of viral (and especially rhino) used in the treatment of viral) infections.

One aspect of the invention is capable of interacting with ICAM-1 and Therefore, cell-virus adhesion and virus infection can be prevented or p1 that can reduce or reduce the severity or duration of such infections 50,95 and its functional derivatives.

The present invention particularly provides a solubilized form of the α-subunit of p150.95, p150, α-subunit of p150, such as a fragment of α-subunit of 95. is a functional derivative of the unit. Such drugs preferably contain CD-18 molecules. A heterodimer containing molecules related to the amylyl β-subunit can be administered to a recipient patient as a drug. The above purpose of treating viral infections is , can be achieved by a single drug or by a combination of one or more drugs.

With regard to treating viral infections, the above-mentioned drugs of the invention may be used to treat viral infections. A. Suppress or compete with the ability of the virus to bind to the M molecule. (e.g., intranasal (by means) to the recipient patient. Such doses generally include: (For each drug administered) Q, Ol　pg/to 9 patient weight ~], z9/ kg patient weight, or may be used in a larger or smaller amount. Wear.

To treat viral infections, the administration of such drugs may be "prophylactic" or It can be done "therapeutically". When administered prophylactically, the drug is effective against viral infections. Not prior to symptoms, but prior to the time of infection (i.e., before infection, at the time of infection, or is administered (immediately after infection).

Prophylactic administration of the drug prevents or reduces the resulting infection. Osamu When administered therapeutically, the drug may be used to treat the symptoms of a true viral infection (e.g. symptoms such as nasal congestion or detection of the virus in body fluids, or detection of antibodies directed against the virus in the serum of an infected patient) (or immediately after). Therapeutic administration of the drug reduces true infection and sometimes reduce its severity or duration.

V, administration of p150.95α-subunit pL50,95α-subunit The therapeutic effect is based on one p150.95 receptor molecule (α and β subunits), all p150.95 receptor molecules (α and β subunits), 150,95α-subunit molecules, or therapeutically active functional induction thereof obtained by administering the drug to a patient. These molecules can also be synthesized by can be obtained through the use of recombinant DNA technology. p150.95 receptor - or its α-subunit, fragments can be further obtained by proteolysis. I can do it. The therapeutic advantage of these molecules is that they can be used to enhance binding to carriers. or functional derivatives with additional amino acid residues added to enhance activity. can be increased through the use of The scope of the present invention includes deletion of certain amino acid residues. Functional derivatives containing modified or altered amino acid residues increase cell attachment. is intended to include such functional derivatives insofar as they exhibit the ability to enhance or suppress Ru.

Preparations containing natural impurities do not contain these products or substances normally and naturally found. A molecule of the invention is said to be "substantially free of natural impurities" if it is substantially free of natural impurities. It is said.

When administering a therapeutic molecule of the invention to a patient, the dose of drug administered is Factors such as age, weight, height, gender, usual medical conditions, previous medical history, etc. It will change depending on. Generally, about 1p9/9 to 10vi/9<9 of the patient. p150,95α-subunit (or- its functional induction It is preferable to administer the drug to the patient at a dose of amount may be administered.

The molecules of the invention may be administered intravenously, intramuscularly, subcutaneously, enterally or non-administered to a patient. Can be administered orally. Administration is by continuous infusion or by single or Due to multiple mega pills.

The anti-inflammatory drug of the present invention is administered to a recipient in an amount sufficient to suppress inflammation. be. The dose of the drug, route of administration, etc. is sufficient to reduce or prevent inflammation. minutes is said to be sufficient to suppress inflammation. Anti-inflammatory drug of the present invention before the onset of inflammation (so as to suppress expected inflammation) or after the onset of inflammation. can be administered.

A composition is defined as "pharmaceutically acceptable" if its administration can be tolerated by the recipient. It is said that it will be done. Such drugs must be administered in doses that are physiologically significant. is said to be administered in a "therapeutically effective amount." Due to the presence of drugs, Physiologically significant if it produces a detectable change in the physiology of the recipient patient. be. Molecules of the invention can be used by any known method for preparing pharmaceutically acceptable compositions. These substances or their functional derivatives may be formulated according to is mixed with a pharmaceutically acceptable carrier excipient. suitable excipients and e.g. Those formulations containing other human proteins, such as lemming serum albumin, ReIIlington’sP pharmaceutical S sciences (16th edition), edited by Osol, A. Collection, Manok, Easton, PA (1980). Effect In order to form pharmaceutically effective compositions suitable for practical administration, such The composition comprises the p150.95α-subunit or the like along with a suitable amount of a carrier excipient. will contain a therapeutically effective amount of a fragment or functional derivative of.

Additional formulation methods may be used to control the time of action.

Controlled release formulations may also contain p150.95α-subunit or fragments thereof. or through the use of polymers to conjugate or absorb functional derivatives. It can be done. Controlled derivation can be achieved using suitable macromolecules (e.g. polyester, polyamide). acid, polyvinyl, pyrrolidone, ethylene vinyl acetate, methylcellulose , carboxymethylcellulose, or protamine sulfate) and macromolecule concentrations. and by selecting a built-in method to control release. Ru. Another possible way to control the time of action by controlled release formulations is to polyester, polyamino acid, hydrogel, poly(lactic acid), or ethylene vinyl p150,95α-substances in particles of polymeric materials such as acetate copolymers. Integrating buuni-nod molecules, their fragments or their functional derivatives It is to be. On the other hand, instead of incorporating these drugs into polymeric particles, e.g. e.g. microcapsules prepared by coacervation methods or interfacial polymerization , for example, hydroxymethylcellulose or gelatin microcapsules, respectively. and in poly(methyl methacrylate) microcapsules, or e.g. Liposomes, albumin microspheres, microemulsions, nanoparties colloidal drugs such as microcapsules, and nanocapsules in microemulsions. These molecules can be included in delivery systems. method like this Remington's Pharmaceutical Science (L980).

Although the present invention has been generally described above, it is described for the purpose of explanation and is not specifically described. The same applies in connection with the following examples, which do not limit the invention insofar as possible. will be more easily understood.

Example 1 Cloning of p150.95 α-subunit gene p150.95 is normal However, hairy cell leukemia, in which leukemia cells migrate to the lungs, is not present in lymphocytes. It is expressed at high levels in B-cell tumors. Miller, L.G. (M1 ller, L, J, et al. mmunol, ) 137: 2891: 2900 (1987)) method. Hairy cell whitening by affinity chromatography using monoclonal antibodies p150°95 molecules were purified from hemorrhagic lungs. Preparative 5DS-PAGE and electroelution (bunker pillar, electroluminescence) M.W. et al., Met, E. α subunit by nzymol, Tenjo: 227-236 (1983)) were isolated (Fig. 1). A total of 214 residues were measured from 13 peptides. Ta. The peptide sequence is shown in Table 1 (residues with lower confidence are shown in parentheses). ). Regions of peptides #90a and #11'4 with the lowest codon redundancy ( (Table 1, underlined part) and select a single array, i.e. 46 and 49 nulls respectively. We designed a codon-usage preferential oligonucleotide probe for leotide (Latte, AR). Lathe, R. et al., Journal of Sub-Molecular Biology ( J. Molec, Biol.) 183:1 12 (1985)).

Stimulation with PMA (phorbol myristate acetate) for 3 days stimulates the bone marrow. Inducing high levels of p150.95 expression in the monocytic cell line HL-60 Based on the findings of Miller et al. ogy (J, I mmu, nol, ) ±37:2891-2900 (19 86)), Gubler, U, et al. (Gen e) 25:263 269 (1983)) for cDNA synthesis. PMA-stimulated HL-60 cell poly(A)” mRNA was used as a template. Ta.

Chirgwin et al. (Biochemistry) m, ) 18: 5294-5299 (1979)) PMA differentiated HL-60 cells and oligo-d(T) chromatography as Thus isolated poly(A)''-RNA (Aviv.

H,) et al., Proceedings Sub National Academy Sub Sci. Scissors (Proc, Natl, Acad, Sci,) Dan 9: 1408-1412 (1972)), total RNA was prepared. Poly(A)”-RN　A10μ9 Using Gubler, U. et al. (Gene) 25: 263-269 (1983)), the cDNA library was It was constructed.

Double-stranded cDNAs larger than 2 kb were selected by agarose gel electrophoresis. size, which was ligated to an EcoRI linker and cloned into λgtlo. Ta. Oligo-d(T) (P har-macia) and reverse T Lance Scriptase (Life Sciences) )) was used to synthesize the cDNA first strand. DNA polymerase England Biolabs (New England B 1olabs), Ribonuclease H (Boehringer Mannheim nnheiIll)) and Escherichia coli (E. coli) DNA riggers New England Biolabs Double-stranded cDNA synthesis was completed using the following methods: Smoothing and anti-methylation After reaction, a phosphorylated EcoRI linker (Niney England Biolabs) was used. (New England Biolabs) to dscDNA. Ta. After R1 digestion, 5xQ Sepharose CL4B The linker was removed in a column (Pharmacia) and ds The first two-thirds of the cDNA peak was collected. Library with long inserts dsc on a 0.8% low melting point agarose gel to select for constituents of Size-sort the DNA and transfer it to NA-45 paper (Schleicher & 7 Yule (S elect a elution on chleicher & 5chuell)) dscDNA of 2 to 7 kb was recovered by EcoRI-digested λgtlo. Ligated. Engineering/Erichia coli (E, coli) Patch on C600hf’l After caging and plating, 3.2×10” first recombinants were obtained.

Escherichia coli (E. , coli) 5 x 10' of the first recombinant were plated on C600hfl. . Place the plaque as it is on two nitrocellulose filters for amplification. Woo, S, L, C, Met.

180-182 (1977)), next edition, 6 x ssc, IX7'n Hearts ( D), 0.5% SDS, 0.05% Pi/PPi and and 1009102 tRNA overnight at 37°C. 100 Peptide #1 at 37 °C in the same solution containing g/+Q of tRNA. 14 (5-CCTCCTGTTCAGCTCCACAGGCACCCA(1,A A single sequence 46mer derived from AGTTGATGGAGACAGG-3') Hybridization was performed with oligonucleotides. 6　X　SSC , O, 1% SDS, 0.05% P i/PP i for 30 min at room temperature, then Filters were washed for 15 minutes at 50°C. - Exposure to evening autoradiography After that, the plaques that showed positive signals on the two filters were plated in successive plates. Purified by culturing and rescreening. 5X1 with 46-mar Screening of 0' recombinants resulted in a size ranging from 2.5 to 4.7 kb. Eight positive cDNA clones were obtained.

As a further confirmation, and select the clone containing the largest coding sequence 49-m identified from the N-terminal sequence of the p150,95α subunit Clones were rescreened using ar and using 30-mar.

Let's purify their DNA. B enson, S, A, et al., Bio/Technology (BioTech,) 4: 126-12 7 (1984)), their inserts were combined with peptide 90a 5'-CATCCTGG GTCAGGTCCTGGCCGCCAGACAGGGCCTGGCCAAAG TACTG-3') and N-terminal oligonucleotide probe (5'-AGC AGACTCCACCCGGAAGC, CTCTCAGCTC-3°) Color thickness adjustment sized and probed by an independent 49-mar. three black The clone was hybridized with 49-mar and a 4.7kb clone (λX47 ) also hybridized together with the N-terminal clone and selected for further studies. Ta. Regenerate the library with the fragment from the 4.7 kb cDNA clone. Another clone was obtained by screening.

Table 1 peptide sequence 60a Y F T A S L P F E K6Qb X A I G V C(L)A(F)Q N63a T T F Q L E L P V K2 OGAVYLF)lGVLGPs[sPs[sQ? 2b　V　E　D　F　X　 A L X (D) + Q N X (L) 79a X S Y L G Y S T E L A L90a L Q Y F G Q A L S G G Q D L T Q D G L V D L A V G A(R)90b F G A A L T V L G D V N G D K L T(D)V V97 T RP V L W V G V S M Q F I P A E I P (R) 114 D L P V S I N F (W) V P V E L N Q E A V X M X V E (S122 X S N P L S L A S V HQ L (Q) G F T Y S A125 a N F A T M M N F V(R) A V I S Q F Q RP S T Q F133 Y K V HN (P S P) X (+) Example 2 Nucleotide and derived amino acid sequences of p150,95α cDNA clone column The λX47 cDNA clone contained an internal EcoRI site. 670 The b'p fragment was hybridized to the N-terminal clone, while the 4.1 kb Fragment into 46-mer and 49-mer tribucinbebutide probes Hybridized. EcoRI fragment in pUC18 and pUc19 and used these subclones to (Smith, H, O,) et al. (Nucl, Ac1d, Res, 3: 2387 2398 (1976)) using the end-labeled partial digestion method of restriction map (Fig. 2A). )It was created. Subclone the fragment into M13mp18 and mp19. Messing, J (Messing, J), Met, Enzym ol, 101:20 78 (1978)), dideoxynucleotide terminal termination method. Both mirrors were sequenced using Sanger, F. Proceedings Sub National Academy Sub Sciences ・Ninisei (Proc, Natl, Acad, Sci, USA) 74: 5463 5467 (1977)) (Figure 3). All restriction sites in both directions crossed.

Sequences of several regions using oligonucleotide-activated dideoxy sequencing It was confirmed.

The nucleotide sequence of the 4,704 bρ insertion of λC57 consists of a 64 bp 5” untranslated region, followed by a putative start codon and 3492 nucleotides. Contains the entire coding sequence of Chido. The 3' untranslated region contains 1,140 nucleotides. Funcensus polyadenylation signal followed by 50 adenosylation signals. Finish with a long stretch. The Alu sequence is a nucleotide in the 3' untranslated region. It is between Chido 3893 and 4054. This region consists of consensus Alu repeats. Shows 89% homology to the right monomer unit (Deininger).

D eininger, P, L, et al., Journal Service. Bu Molecular Biology (J, Mo1ec, B iol,) Soil 11:17-33 (1981)). The Alu sequence consists of 40 thymidines, i.e. Inverted Alu array 1 bucket It will be done. Alu sequences are often found in intervening sequences, but the processed poly( A) “Rare in mRNA (Limpolska, Nis. rska. S, A. ) et al., F.E.B. Letters (F.E.B. 5 Lett. ) 2 supra 2: 208-2 1 2 (1987)). Alu repeat The presence was detected in two other independently isolated cDNA clones, but Therefore, it does not seem to be due to a defect in mRNA processing.

The amino acid sequence translated from the cDNA includes the N-terminus and the tryptic peptide sequence. Confirmed by column. The regions confirmed by amino acid sequencing are shown in Figure 3. and underline it. Only 2 of the 237 sequenced residues were found to be different. Ta. These are experimental serines that were found to be threonines by cDNA. It was an assignment (serine assignments).

p150,95α subunit N-terminal sequence (Miller, L.J. er, L. J.) et al., Journal of Sub-Immunology (J.

rm+nun1. ) 137:2891 2900 (1987)) is a nucleotide It starts from 122. The only valid translation initiation codon is found upstream of position 65 . The predicted signal peptide consists of two basic amino acids among the first five residues. Expected to contain acids, significant hydrophobic amino acids, and small cleavage site amino acids. (von Heijine, G, ), Journal of Molecular Biology (J, Mo1ec, Bi ol, ) 173: 243 251 (1984)). The mature protein consists of 1144 Contains amino acids and has a predicted Mr of 125. ’908, and degregation Consistent with previous evaluation for cosyl p150°95α chain (132,000 Mr). ing. The putative extracellular domain contains 10 potential N-glycosylation sites. It contains 1081 amino acids with . 5 or 6 of these sites sites are glycosylated, confirming that this is the extracellular domain and The rest of the mass will be explained. The hydrophobic sequence, which has characteristics of transmembrane regions, consists of 30 amino acids. Separate the extracellular domain from the hydrophilic cytoplasmic tail. First cytoplasmic domain The two residues (L’ys-Arg) act as stop-transfer signals. Can be used.

Example 3 A tandem repeat deduced amino acid sequence containing a putative divalent cation binding site. Studies on internal homology in the columns □residue 424 in the extracellular domain, respectively Three tandem homologous repeats of approximately 65 residues located between 619 and 619 (I, ■ and ■ ) (Fig. 4). Homology between repeats is between 25% and 33%. and is significant at p10-''. Identity is highest in the central part of the repeat.

In the nucleus, 33% of the residues are identical in all three repeats.

The function of leukocyte adhesion proteins depends on divalent cations. In CTL-mediated killing The LFA-1-dependent adhesion process is Mg'' dependent.

Ca'' is insufficient to be attached, but it can be synthesized using a low concentration of Mg''. (Maltz, E (M a, rtz, E, ), Journal Sub-Section Biol Biology (J, Ce11. Biol,) 84: 584-598 ( (1980)), suggesting one or more divalent cation binding sites. Similar Mg” dependence and synergy between Ca'' and Mg'' Rothlein, R. et al., Journal Sub Extract Verimental Medicine (J, Expert, Med,)! 63: 1132- 1149 (1986)) and an artificial membrane containing the ligand molecule ICAM-1. This is seen with regard to the adhesion of lymphocytes to the bilayer. Furthermore, Mac 1 and p The binding of 150.95 to the ligand 1C3b is divalent cation dependent (La. Wright, S., D. et al., Proceedings. ・Sub National Academy Sub Sciences Ninisei (Pr oc, N at 1.　A　Cad.

Sci. USA) 80:5699-5703 (1983)): Minocrem.

K.J. (M1cklea+, K, J,) et al., Biochemical ・Journal (Biochem, J.) 231:233 236 (1985)) .

Ca” and Mg” binding proteins, valbumin, troponin C and calmodi The three-dimensional structure of tulin reveals that the metal is sequentially bonded between two α-helices. The amino acid side chain that coordinates the metal and the peptide-bonded carbonyl oxygen are the same. (Kretsinger, R. J. Biol. , Chem,) 248: 3313 332'6 (1973)); Hertz Herzberg, O, et al., Nature 3 13:653-659 (1985));

Henschen, A., et al., Annals Sub New York A. Academy Sub Sciences (Ann, N, Y, Acad, Sci, ) 408: 28-43 (1983)). This metal ion bond structure is r　E　 It is called "F/%nd". Some of the divalent cation binding sites are Ca” specific. However, others such as the two in Troponin C are Ca” or Mg’ ” can be linked to the center of the p150,95α subunit homology repeat. A strongly conserved region of , which shows significant identity with these metal binding sequences (5 figure). Oxygen-containing side groups exist at coordinate bond positions +X, +Y, +2 and -X. There is partial conservation of the glycerol residue present and adjacent to the +Z position.

Example 4 Intervening sequences separate homologous repeats 4, further by hybridization with a 1 kb EcoRI fragment. A p150,95α subunit cDNA clone was selected. 37 blacks isolated and compared by 5au3AI digestion and Southern blotting. Ta. Most of the clones have a restriction map that matches the restriction map of the origin clone (λX47). A limited fragment was obtained, but the cDNA clone of 4,4 kb (λx44) was different. It showed the pattern. Is the comparison of the limit ma/□knob between λX47 and λX44 5"? We clarified the difference up to the 1.8 kb Pst I site (Fig. 2B). ,λX Sequencing of this part of 44 was found in the two that were not found in the originating λX47 clone. (Fig. 4B). l 20 bp insert (in Figure 2B) IVS B) corresponds to the Alu sequence in 4 lengths (A Iu-ku). Loan BLURI [86% identity] (Deininger, P.L. Ninger, P., L., et al., Journal Sub-Molecular Base Iology (J, Molec, Biol.) 151:17 33 (1981-no.

Translation of Alu sequences into proteins is extremely rare (e.g. crow, I. w. aras, T., W.) et al., Nature 325: 54 5-549 (1987); Sharma, Nis, et al. Science 235:1489 1492 (1987)). proof Some of the evidence suggests that the 120bρ insert coincides with a non-spliced intervening sequence. This suggests that The in-frame terminal codons with the precoding sequence are located in this region. seen within. Furthermore, consensus donor and acceptor splices The signaling signal flanks the insert (1982). 230b not present in λX47 Additional sequences of p were detected at the 5' end of λX44 (IVS A and IVS in Figure 2B). written).

This sequence is flanked by a possible 3' splice site (ggacag/G). Ru. This insert is in the coding sequence because it interferes with tryptic peptide #60b. impossible. Therefore, cDNA clone λX44 is incompletely spliced. It is thought to be derived from p150,95α subunit mRNA. This conclusion Surprisingly, the result was that whole-cell poly(A)” mRNA was used for cDNA synthesis. isn't it.

The 120bp intron in λX44 can be separated into homologous repeats ■ and ■. This suggests that the mechanism (Breathnach, R. ) et al., Ann, Rev. B iochem, 50: 349 383 (1 981')). The other putative intron is 155 atlas before the first homologous repeat. A amino acid number is produced. This area has some differences relative to each other and to the tandem repeats of the pond. It can consist of two tandem repeats showing homology (10%-21%), but this homology is , not statistically significant.

Example 5 Homology to RGD receptor p150,9'5α subunit yh sequence to platelet glycoprotein Ub/IIIaα subunit complete sequences for vitronectin and fibronectin receptors. compared to the partial carboxyterminal sequence of the tar α subunit (Argraves, W. Niss (A rgraves, W, S,) et al., Journal Service Biological Chemistry (J, Biol.

Suzuki, S, U, F0 Seedinges Sub National Academy Me Sub Sciences (Proc, Natl, Acad, Sci,) 83 :8.614-, f3618 (1986)), leukocyte adhesion protein and RGD (Ar g-Gly, -Asp) to examine the structural relationship between the receptor α subunit. (Figure 6). Sequences are ALl, G, N and GE, NALl, GN programs (Intelligenetics (Rintel Igenet 1cs)) I lined them up. p150,95α subunit and three RGD receptor α subunits The overall homology between the two units is 19%-20%, a highly statistical It was significant (p<10-'').

The N-terminal 148 amino acids of the p150,95α subunit are 25% homology. The most curved sequence is 1 present in the p1.5.0.95α chain. It shows that the next region of 26 amino acids is not present in b. This is p15 0. ．． 95α subunit (1144 residues) and nb (1008 residues) The introduction of gaps in the Ib sequence reveals most of the length differences between I need.

A region of 268 residues with 33% homology immediately follows the gap. this territory The three putative divalent cation binding sites of the p150.95α subunit and and three homologous metal ion binding sites in nb. Wide range of phases between both mirrors The longest region of homology (431-604 residues, 41% identity) consists of three tandem projections. This is in close agreement with the divalent cation binding site described above. ffb/I [[a glycoprotein, α subunit of fibronectin receptor and vitronectin receptor The corresponding EF hand-like motif in is also proposed to bind divalent cations. It has been proposed. The conformation of gpnb/II[a is calcium ion depends on the existence of Kunicki, T. J. et al., Blood 58: 268-278 (1981)), nb Binds radioactive calcium (Fujimura, K.) et al., Haemostasis 50: 251a (1983 No. The high conservation between p150,95α and nb in this region suggests that p150,95 Supports the suggestion that tandem repeats in the α subunit are metal ion binding domains do. Furthermore, the high conservation of this region is explained in more detail below. , suggesting that it may function in ligand binding. Putative divalent cation bond The region containing the binding site has a low cysteine content (1.1%, residue 336 -619), 1. : Preregion not present but present in p150,95α (0%, residues 149-336). The regions before and after the extracellular domain are each They contain 4.1% and 26% cysteine residues, respectively. p150,95αsa Fifteen of the 21 cysteines in the unit are protected in IIb.

In contrast to p150,95α subunit 2, fibronectin and vitrone The alpha subunit of the cutin receptor and gpffb/IIIa are precursor proteins. Consists of two disulfide-bonded chains (heavy and light) formed by a decomposition process (A rgraves, W, S,) et al., Journal of Sub-Biological Chemistry (J, Bro[, Che n+, ) 261: 12922-12924 (1986)); tin cow, varnish ( Suzuki, S, et al., Proceedings Sub National Association Academy of Sub-Sciences Ninisei (Proe.

Natl, Acad, Sci, USA) 83: 8614 8618 (198 6)): Charo, I.F. et al., Proceedin Guess Op Nashikonanoi Academy Sub Sciences Ninisei (P Roe.

Natl, Acad, Sci, USA) 83: 8351-8355 (198 6)).

N-terminal sequencing of the light chain shows that proteolytic cleavage (arrowhead in Figure 6) after the Lys-Arg sequence in the receptor and vitronectin receptor, and Occurs after Set-A rg in nb. Possible additional cleavage sites The Lys-A rg sequence consists of 15 sequences opposite the N-terminus of IIb/I [[a yields a residue of The cleavage site in the three RGD receptor α subunits is 26 at different positions within a non-homologous stretch of ~35 amino acids. This non-homologous region is associated with a lack of proteolytic processing of the p150,95α subunit. , is deleted in the 95α subunit (gap after residue 998) (sugirin Gar. Springar, T.A., et al., Journal Sub. Immunology (J, Tmmunol, ) 136:240 245 (1986)) : Miller, L.J., et al., Jahna Le Sub Immunology (J, I +uuno1.) Sat 37: 289 1-2900 (1987)).

Significant regions of homology are found in the inner two-thirds of the transmembrane region, with two basic stops. Contains untranslated amino acids (residues 1096-1116).

This string of 21 residues is identical in all four α subunits10 The overall homology is between 62% and 67%. Within the transmembrane domain The exceptional basic residue of is also conserved in all four α subunits. p15 The transmembrane region of the β subunit of 0.95 and the chicken integrin band ■ are 7 0% identical (Kishimoto, T, K ) et al., Cell 48: 681-690 (1987)). Both α and The high conservation of the transmembrane sequences of the α and β subunits suggests that This region has other cellular components or involves signal transduction. This suggests that some important interactions may occur.

Example 6 Evolutionary relationship of adhesion receptors vitronectin receptor, fibronectin receptor and 11b/I [[ Previous comparisons of aα subunit cDNA sequences showed that these RGD receptors are mutually exclusive. (Suzuki, S) ,) et al., Proceedings Sub National Academy Sub Saie Nciz Ninisei (Proc, Natl, Acad, Sci, UsA) 83:8614 8618 (1986)). The present invention utilizes typical leukocyte adhesion proteins. α subunit and RGD receptor α subunit, Indicates a wide range of relationships.

The two subfamilies of RGD receptors have different β subunits, defined based on. These include fibronectin receptors, integrins and the VLA family with five different α subunits and two different nb/I [Ia and the vitronectin receptor (Hynes, R, O8), etc. Cell 48:549-554 (1987)). Three α subunits evolved from a single primordial gene together with the leukocyte adhesion receptor subfamily with There are 10 different α subunits that appear to have evolved. Overall, three services family showed indegrin (Hynes, R.O.G.Hynes, R, O, et al., Cell 48:549 554 (1987)). Droso When the position of D. rosophi.la. N-terminal amino acid sequence homology of (Leptin, M).

M.) et al., EMBOJ Journal (EMBOJ) 6: 1037- 1043 (1987)) indicates that this gene family evolved over 700 million years ago. suggest what happened.

Two subfamilies of β subunits that bind extracellular matrix components are The β subunits (37% and 45%) of leukocyte adhesion receptors are similar to each other (44%). %). However, a comparison of the available α subunit sequences ( Figure 6) shows that the extracellular matrix receptor α subunit is p150.95α. more similar to each other (27% to 33%) than to subunits (18% to 20%) reveal that there is a gender. Furthermore, Mac-1α subunit N-terminus sequence (Miller, L. J., et al., Gisena) Le Sub-Immunol C17-(J, Immunol, ) (1987)) is a leukemia globular-attached α-subunits or α-subunits of other subfamilies rather than each other (40 % to 50%) suggests that it is highly related.

Extracellular matrix receptors bind to the sequence RGD within their ligands . Close homology suggests that leukocyte adhesion proteins may recognize RGD-like sequences. Ru. However, this peptide does not support LFA-1-dependent attachment or Mlc-1 Because they do not inhibit C3b receptor function, such recognition sequences At least slightly distinct from the hexapeptide containing the ROD sequence in Chin. must be separated.

Example 7 Ligand binding site of adhesion receptor The α and β subunits of the p150,95 molecule, i.e. the main structure, have not been fully disclosed. Figure 7 shows the overall characteristics of the first component of the leukocyte adhesion glycoprotein family 17-. A summary is given below. Overall, this structure is very similar to that of RGD receptors. ing. In addition to the high homology of the β subunits, four tandem protein-rich antibodies All 56 cysteines located throughout the summer and extracellular domain In all three β subunits (Tamkun, J.D. '(Tamkun, J, W, et al., Cell (Mudan) 46:27. l- 282 (1986); K. ishimoto, T. , K. et al., Cell 48:681-690 (1987)): Fitz. Fitzgerald, L.A. et al., Journa Le Sub Biological Chemistry (J, Biol, Chem,) 2dan2 : 3936-393.9 (1987)). p150,95α subunit A divalent cation-binding site identical to that in the α-substance of the platelet IIb/nIa complex unit, found in vitronectin receptors (suzuki, varnish (Suz) uki, S,) et al., Proceedings Sub National Academy ・Sub Sciences Ninisei (Proc, Natl, Acad, S ci, U S A) g3: 8614-8618 (1986)), and fibronectin receptor (Argraveis, W. Graves, W, S, et al., Nyanal Sub-Biological Chemistry Story (J’, B iol, Chem,) 1 Random soil: 12922-1 2924 (1986)). Generally, such high compatibility in prominent structural features Protein families of the same sex and identity have similar three-dimensional structures and functions. do. This is due to whether the ligand is an extracellular matrix protein or a leukocyte adhesion protein. , whether as in the case of cell surface molecules or when these proteins bind ligands. suggests that it functions very similarly to .

The present invention brings out related properties depending on the results of the white blood cell surface. Characterized by receptors. These results are listed below. p150. The overall characteristics of the 95 molecule α and β subunits are outlined in FIG.

First, the alpha subunit of leukocyte receptors appears to control Gant specificity. It will be done. Mac-1, but not LFA-1, appears to bind ligand 1C3b. - Madrid, F. et al., Proceedings. Inges Sub-National Academy of Sciences Ninisei ( Proc, Natl, Acad, S’ci, U.S.A.) 7 ships + 7489-7493 (1983); Sanchez Madrid, F. ez-Madrid, F.) et al., Journal Sub-Cow Suberimengo Tal ・Medimbe J, Expert, Med, ) 158: 1785-1803 (1 Moxibustion (983)), both molecules are present on PMA differentiated U937 cells, but 3Ma LFA-1, but not c-1, mediates homotropic attachment. Mediate (Miller, L.J.) Journal sub im/mouth’;-(J, rmmunol,) 137: 2 891-2900 (1986)). Mac-1 and LFA-1 share a common β-sub Since the units are shared, the α subunit must control ligand specificity. do not have. Similarly, the vitronectin receptor and U b / III a l [ The combination is an important feature of these receptors, as they share a common β subunit. Isomerism must be controlled by the α subunit. These findings suggest that α This strongly suggests that the subunit contacts the Gantt, but similarly the β subunit Do not exclude interference by knits. Interference by the β subunit is caused by the α subunit is important in maintaining the conformation of the β subunit, is important in maintaining the conformation of the α subunit. , the β subunit contributes to the Gantt binding site (hemo.

Bennett, J., S., et al., Journal Sub-Based. Iological Chemistry (J, Biol, Che+s,) 25 Uni8049 -8054 (1982); Gardner, J.M. , M, ) et al.: 439-448 (1985); Santoro, S antoro, S, A, et al., Cell 48: 867-873 (1987)).

Second, many receptors bind many different ligands and have many binding sites. suggests the existence of Platelet glycoprotein I[b/II[a].

Fibrinogen, Fibronectin, Vitronectin, Fono Willbran (Pitera, R) (Py Tela, R, et al., Science 23 U. 1559- 1562 (1986)). One of the recognition sequences in fibrinogen is RGD. (Plow, E.

F.) et al., Journal of Biological Chemistry (J.

Biol, Chem, ) 259: 5386-5391 (1984); Timo Nons, Nis (Tim+nons, S,) et al., Proceedings Sub Na. National Academy of Sciences Sub-Sciences (Proe, N. atl.

Acad, Sci, USA) 8:4935-4939 (1984)), the evidence is Suggests that RGD and non-RGD recognition sequences competitively bind to regions other than different regions. (S antoro, S, A, et al., Cell ( Ridan) 1 noon: 867-873 (1987)). LFA-1 is a cell surface molecule ICA binds at least one other ligand different from M-1 and ICAM-1 (Rothlein, R, et al., Journal Sub I Munology (J, f+auno1.)l 37: 1270-1274 (1 986)). Mac-1 and p150,95 bind the ligand 1C3b, but , also mediates fc3b-free cell-cell adhesion. Mac-1 and p150. 95, adhesion of neutrophils and monocytes to endothelial cells and artificial matrices (Sbringer, T.A. (S. Pringer, T., A.) et al., Macrophage biogenesis Biochemistry of Macrophages (Chiba Singh posium (CI B A S ymposium) 118), Pitman, Ro 102-126 (1986)) and killer T receptors to target cells. p150 in lymphocyte attachment. '95 Function (Keizer, G.D. er, G, D, et al., Journal Sub-Immunology (J, [mmuno 138:3130 3136 (1987)). Furthermore, 1 Mac-1α and β subs to differentially suppress C3b binding and cell attachment The ability of monoclonal antibodies to distinguish between epitopes on Suggesting a different binding site (Anderson, DC) , DC, et al., Journal Sub-Immunology (J, rmmunol, ) 137:15-27 (1986); Dana, N. et al. Null Sub Immunology (J, I mmunol,) 13 Uni 325 9 (1987)).

Third, tandem duplication is an evolutionarily preferred way to generate many binding sites. Ru. Examples include eight tandem repeats at its N-terminus that are believed to bind the ligand. Contains low-density riboprotein receptor (Yamamoto 2T) Cell 39: 27-38 (1984)), Stuff containing five tandem repeats that bind IgG aphylococcus aureus protein A (aphylococcus aureus) (Uhlen, M.) et al., Journal Sub-Biological Chemist Lee (J. Biol. Chem.) 259: 1695 1702 (1984 )).

Fourth, leukocyte adhesion receptors and extracellular matrix receptors and ligands The interaction with is dependent on the presence of divalent cations as mentioned above. divalent cation is a chemical that influences receptor conformation in the absence of ligand. ・/Kunicki, T, J, et al., Brad (Bl ood) 58: 268 278 (1981), therefore the ligand binding site could indirectly influence the conformation of However, the most A simple interpretation is that the divalent cation-binding site and the ligand-binding site are the same. This means that divalent cations are required because they overlap. -Together , these considerations suggest that the tandem homology repeats in the α subunit imply many binding sites. It suggests that it will.

Fifth, the D (aspartic acid) residue in the ligand sequence RGD and the divalent cation Coordination bonds with molecules contribute to ligand binding. p150゜95, Ub/[la and The putative metal-binding sites of the and vitronectin receptor alpha subunits, is seen at the -Z coordination bond in the classical Ca'' and Mg'' bonded EF hunt loops. It is incomplete because it lacks glutamic acid (Figures 5 and 6). substitute , a hydrophobic residue is found at this position. In the classical metal binding loop, five The coordinating residues are in the loop itself, but the group forming the -Z coordinating bond is Rutamic acid is in the α-helical segment 71- of the following 9-11 residues (Kretzinger , Kretsinger, R.H., et al., Journal Sub ・Biological Chemistry (J, B iol.

Ratsuhatsu L) Mata 48: 3313-3326 (1973>). However, adhesion In the receptor, a proline residue is found at a position corresponding to the center of this helix ( (arrow in Figure 4A), this region must have a different non-α helical structure. to show that

The sequence Gly-Ala-Pro (GAP) is derived from pL50,95 and ■b/I Highly conserved in tandem repeats of both α subunits of I[a, p150.95 and and two less homologous in IIb/Ila) more N-terminal repeats. (Figure 6). This is similar to the residue at the -X coordination linkage in the adhesion receptor. The C-terminus of the different central structures is linked by the aspartic acid in the ligand RGD sequence. This suggests leaving the -Z coordination bond of the metal exposed and useful for combinations. Guru Tamic acid, similar with only one larger methylene group or D-aspartic acid The position of the aspartate carboxyl group is determined in RGD since the body is inert. (Rt+oslahti, E, et al., Cell ( Summer l) Sat A 517-518 (L, 986)). In contrast, for L-arginine Substitution of D-arginine has little effect.

The presence of aspartic acid and adjacent glycine residues ligates as well as the metal-binding loop. , the glycine residue adjacent to aspartic acid in RGD is This is important (Figure 5). does not contain RGD but binds to Ilb/I[[a and fibrilliogen peptides that can compete for the binding of ROD sequences were identified. (S antoro et al., Cell 48:867-9 83 (1987)). This dodecapeptide HHLGGAKQAGDV has a GD configuration. Contains columns. The result of ligating the D residue in the Gantt with a divalent cation is that Consists of structural/functional studies on peptides that bind to attachment receptors. Sara There are at least three different receptors found in both chickens and humans. Uncommon conservation of RGD recognition among 1aht i, E, ) et al., Cell 44: 517-518 ( (1986); Hynes, R.

0,), Cell (Ride) Dota: 549-554 (1987)), the metal is a ligand. This supports the result that there is a coordination bond with Both receptor and ligand Sensitive complementary mutants change the structure of the receptor site over evolutionary time This is not expected with respect to protein-protein interactions, as it appears to do so. metal and interactions would greatly force the evolution of the ligand structure.

Although the invention has been described in particular embodiments thereof, further modifications are possible and this application provides Generally covers any variations, uses or adaptations consistent with the principles of the invention and apply to the essential features described herein and subject to the appended claims. Certain deviations from this description according to known or customary practice within the art to which the invention pertains It also includes deviations from

i-! t Fl(,LIRE　3 FIC Hi’RE3 (eont+nue+jl divalent cation binding site 1) 150,95ct 446VDVDTD, GSTDLVL510GD V N G D K L T D V V 1573 Q D X, T Q D G L V D L A V Valve Albumin CD 50 Engineering D E D K’S G F I E E D EEF 89 G D S D G D G K Engineering GVDE Calmodulin I 19 F D K D G N G T Engineering TTKEXI 55VDA D GNGT Engineering NFPEIII 9 2 E’ D K D G N G Y Engineering S AAEIV 128 A N Engineering DGDGEVNYEE) o Honin 26 F’ D A D G G G D Engineering 5VKE62 V D E D G S G T Engineering D r E E 102 F D RN A D G Y X D P E E138 G D K N N D G RI D F D E coordination bond axis +X +Y +Z - Y-X-ZFIG, 5 FIGURE 6 enemy”HA::;lcomyo=ko;:[]脣之::Q:dan::”g::::;:ro: Wealth (] $nini::::::::::i ninini::EJI m? 1Σ], 1 iEE]:::D;:a::2:IF;[E:o:口:’IDi:E42Ei: GgEEiEE; International search report

Claims (4)

[Claims] (1) The α-subunit of p150,95 or its mechanism should be used in patients who require treatment. Viral sensitization characterized by administering an effective amount of a composition containing a functional derivative. How to treat stains. (2) The p150,95α-subunit is related to the β chain of the CD-18 family. The method according to claim (1). (3) The method according to claim (1), wherein the viral infection is a rhinovirus infection. (4) The method according to claim (2), wherein the viral infection is a rhinovirus infection.