JPH04500306A - Polypeptide similar to t-PA, its production method and use - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] A polypeptide similar to t-PA, its production method and use The present invention relates to a polypeptide similar to t-PA A novel t-FA-like polypeptide with an activator, its production method, and diseases. The invention relates to the use of said compounds in controlling pests.

Human developed tissues - plasminogen activator (t-PA) is a 527-amino It is a polypeptide consisting of an acid and a molecular weight of approximately 68 kD (pHn1ca et al. j983, Nature 301. 214-221 and Ny et al., 1984, Proc, Natl, Acad, Sci, tlSA81% 5355-535 9) (see Figures 1a to 1c). Molecules contain many distinct molecules that serve different functions. It includes the so-called domain. The N-terminus is a protein homologous to fibronectin. It is formed by a finger region. Continued , with numerous growth factors I; followed by regions of homology. Following that, Two ring domains follow. - a decomposition unit capable of decomposing a heavy chain molecule into two chains; After this, the protease domain is organized, which contains the active center and other Has homology to serine proteases.

Numerous properties make tissue-glasminogen activator an important molecule: t-PA has a strong affinity for fibrin, and plasminogen activation Phosphorus dependent; as a protease, t-PA separates plasminogen into plasmin. After decomposition, plasmin again breaks down fibrin into decomposition products. t-P, A is Lasminoke〉・Can be suppressed by inhibitory factors. Furthermore, tPA is relatively short It has a long half-life; the molecule is rapidly degraded in the liver.

This factor indicates that tPA acts as a plasminogen specifically against blood coagulation in vivo. activates it to plasmin and causes regeneration of vascular flow by degrading fibrin. cause people to feel bad. Therefore, tPA can be used in fibrinolytic therapy, e.g. Can be used due to heart infarction.

By the way, although it has the amino acid sequence of tPA or a sequence derived therefrom, l- 6 A tPA-like polypeptide in which tribebutide is replaced by the tripeptide RGD. The peptide was found to have improved properties.

Sequences derived from tPA include naturally occurring allelic and synthetic variants. and these have more than 90% consistency with natural tPA in the initial structure. It has glasminogen activation effect.

The novel polypeptides can each be individually synthesized in tPA, especially if the overall length of the molecule remains unchanged. One or more RGD (-A r g-G l y-A, sp).

Particularly advantageous are polypeptides having the tripeptide RGD in positions 1t130-132. It's Chido. Furthermore, advantageously, in addition to the RGD sequence at positions 130-132, A polypeptide containing two other additional RGD tripeptides.

Furthermore, the present invention provides that the DNA sequence coated on the altered polypeptide , and a vector having this DNA sequence.

Novel polypeptides can be produced by methods known in genetic technology.

The starting point for the t-structures described herein is a cDNA clone (hereinafter referred to as pUCtPA), which has the hooded sequence of tPA and Contains the 5' and 3' untranslated ranges.゛Diaper array and print After the P r sequence, the mature protein with 5er(1) starts and P r o It ends after (527).

pUctPA is isolated from nicht uterine tissue as follows. Isolated and two, one! Rewritten to t14cDNA. This cDN After charging A into commercially available cloning vector pUC9, one c DN, A - The method used in this case where the library is attached is: If you defeat Maniatis and others, Mo1ecular C1゜ning, C5)! − It is listed in the company publication. with a radiolabeled oligonucleotide probe Gene bank “screening” was often used during the J1 described method. It is. By this method, the cD containing the coding site and the delimited range NA clones can be isolated.

A portion of the DNA sequence of pUC9tPA can be easily obtained using restriction enzymes. Wear. In some cases, chemically synthesized oligonucleotides, adapters or or gene fragments that are linked to a novel polypeptide. It can be used to clone DNA sequences. Gene fragment or clone the synthetic NA sequence into a vector, such as the commercially available B7-SUMID pBR32. 2, pUC8 or 9, pUC18 mori, < is 19, M　3　m　p　 Introduction into M13mplQ or M13mplQ can be carried out by known methods. Ma In addition, the gene or gene fragment may be suitably chemically synthesized or produced in bacteria, bacteria, or control sites isolated from eukaryotic cells or their viruses. This control site allows expression of the protein. The resulting hybrid Transforming or transferring the plasmid into a suitable host organism is similarly It is publicly known, and is written in 6. Additionally, the hybrid plasmid is "can have a corresponding signal sequence that allows secretion of the polypeptide into the protein."

In the case of expression in mammals, the gene to be expressed, in this case the mutated tP, A-cDNA as mouse metallotianin promoting factor or virus SV40 Vectors can be used that place the promoter four times below. Methionine start codon and t The presence of the PA gene leader/pro sequence is necessary for expression. It is. In addition, the target may be found either as shrimpsomes or as integrated into the genome. A clone containing a copy of the vector is isolated. Particularly preferred is milk lI ! 1>Z> through recombination and expression of heterogeneous genes based on heel viruses. Bakte Association of prokaryotic sequences encoded for cell replication and antibiotic resistance Therefore, it is possible to construct a so-called "shuttle" vector. Plasmid construction and expansion Reproduction takes place initially in bacterial cells; subsequently in eukaryotic cells, e.g. mice. Conversion to the fibroblast cell line C127 takes place. Of course, other cell lines, such as enzymes, Insect cells and other mammalian cells such as CHO cells, L cells and 293 cells It can also be used to express.

This eukaryotic expression system is a state in which products are effectively secreted in many cases in their natural form. It has the advantage of being

Furthermore, two eukaryotic expression systems have the ability to post-translationally modify products.

Thus, tissue-plasminogen activator remains regulated in eukaryotic cells upon expression. The lycoside side chain is obtained adjacent to amino acids 117,184 and 448 (Asn).

Bacteria are not in a state to synthesize glycond side chains. Bacteria in many cases eukaryotic proteins expressed in A, such as tPA and derivatized therefrom according to the present invention. The polypeptides produced in cells occur as denatured inclusion bodies and undergo protein chemical must be restored. Furthermore, bacteria often use the initiator amino acid methio It is in a state where the protein is separated from the finished protein. By using the secretion system, this Difficulties can be avoided.

However, based on the degeneration of the genetic code, for the expression of novel polypeptides; Utilizes a chemically synthesized gene with a different DNA sequence, e.g. It is even possible to do so.

Purification of novel polypeptides can be achieved by affinity chromatography using known methods. and separation from the medium by ion-exchange chromatography .

The polypeptide obtained according to the present invention has at least the following improvements: also has properties: clot specificity, half-life, inhibitory factor binding, proteolytic activity, It can therefore be used for thrombolysis. In this case, this polypeptide is Human tissue - Shows improved properties relative to glasminogen activator.

The subject of the invention therefore provides that at least one of the novel polypeptides may optionally be It is also a pharmaceutical product contained in a pharmaceutically acceptable carrier or binder. Also , this drug combines a novel protein with another fibrinolytic drug, such as prokinase, combinations with rokinase or streptokinase or their derivatives, etc. and in combination with another pharmacological protein, such as superoxide dismutase. can have Other features of the invention are described in detail in the following examples. Ru.

In terms of gene technology, for example, Handbuch von Maniati s and others, Mo1ecular Co1cl Spring Harbor Lab oratory, l　982 is pointed out.

Example 1 Human tissues - Isolation of cDNA clones for plasminogen activator a) Preparation of RNA tPA-producing human uterine tissue 309 was treated with 6 moles of guanidinium and sodium citrate. 5 mmol (pH 7°0), 0.1 mol of 2-mercaptoethanol, Sarcosi Ultra-Tarlux ([1tra - turrax.). Centrifuge coarse cell debris at 300 rpm I let go. RNA was centrifuged through 5.7 mol of CsCl solution. The mixture was allowed to settle overnight at 4500 rpm. Subsequently, polyA+ containing RNA flux The protein was purified by abfinity chromatography on oligo(dT)-cellulose. It was separated.

b) Production of cDNA bank The enzyme reverse transcriptase (AMV) and oligo(dT) 12-18 were used as primers. Poly80-RNA was rewritten into single-stranded cDNA using Second strand synthesis was performed using Escherichia coli DAN polymerase I. double 574 c For DNA, 5alI phosphorylation was performed using the enzyme T4-DNA ligase. The car is attached. Commercially available plasmid pUC9 with restriction enzymes linearize into Two DNAs are joined to each other, resulting in a hybrid Transforming CaCl2-treated, competent cells of Escherichia coli strain HBIOI I changed it.

The cells were coated with ampicillin 100 μg/m (1) on an LB plate and The temperature was maintained at 7°C.

c) Screening of cDNA banks Approximately so　o　o　00 (colonies of Then, perform the replica plate method and dissolve in 5 mol of 0°5N NaOH/NaClO. The denatured DNA is baked at 80°C for 2 hours to make it solid on the filter. Combined.

The filter was washed with 5x SET buffer (IXSET ~ NaCl 10.15 Molar, 15 mmol/HCI pH 7.4, EDTA 1 mmol), 5DSO.

1% and 5x Denhardt solution (l 00 per 50 ml x Denhardtw-Ficoll lit, polyvinylpyrrolidone 1g, B pre-hybridized for 4 hours at 68°C in SAAlt) (non-specific for nucleic acids). saturation at different binding positions).

Using a DNA synthesizer, generate tPA-DNA with 17 bases each. Produce three oligonucleotide probes; This oligonucleotide block The lobe consists of the following array: 5'TGCAGATCACTTGGTAA3'5'CCAGGCCCAGTGC CTGG3'5'TCCAGTCCGGCAGCTGC3'This probe is 5' The ends were labeled with γ-32P-ATP. Next, attach this probe to the Using hybridized filter, 6XSET% 5DS0.1%, 5 X Denhardt solution and a solution containing 10% dextrans sulfate The temperature was maintained in the solution overnight at 42°C with gentle shaking. Then this file The router was washed several times in 6XSET/5DSO, 1% at 42°C, dried and dried. Exposure to X-ray film. Activation answers (radio) are used during screening. oakLive Antwort) were isolated and further cultured. did.

One clone (hereinafter referred to as pUCtPA) contained an insert with a size of approximately 2゜lkb. The insert contains the coding site and the 5' and 3' non-containing inserts. Contains a hooded range (Figure 2). Lyse the plasmid DNA of pUCtPA. Team lysis and SDS alkali metal geography of bacterial culture and subsequent <Cs Prepared by C1 gradient centrifugation.

Example 2 Production of single-stranded tPA-hooded DNA The starting point was the plasmid puctPA described in Example 1. This can be controlled in a regulatory manner. It was cleaved using restriction enzyme 5all. The obtained fragments were separated by gel electrophoresis. Ta. 5alN containing the tPA-encoding DNA sequence was removed from the gel by electrophoresis. Elute. 30 ng of this fragment was digested with 5alI at 4°C. It was ligated with the cloned vector mp19 1100n. The volume of the binding compound is 10μ It was Q. Coupling was terminated by heating to 80°C for 5 minutes.

A 1/10 volume of this conjugate was used for transformation of qualified JMIO1 cells. used. After completion of transformation, add 0.2 molar I PTG solution 60 to the transformation mixture. Add fiQ and 20 μQ (20 mg/mQ) of XGa I; this The formulation was applied into NZYDT Topagar on NZYDT agar. I clothed it. Media NZYDT can be obtained commercially. Contains tPA-cDNA clones could be identified due to the lack of plaque and blue discoloration. DNA sequence analysis (Sanger et al., 1977, Proc, Natl, cad, sci, U sA74.5463-5467), the orientation of the tPA-cDNA was adjusted to the plasmid. I checked inside.

The cDNA of tPA was extracted from the ten-strand phage of tPA during the formation of heavy chain M13 phage. m-Pl9? oriented and contained as a cDNA component of the genome of La Sumido was called ~mptPA.

By the way, if you add bacteria of strain JMIOI or cells derived from it, When transforming with mid-mpt PA, single-chain bacterium is generated during the growth of these cells. The next step is to allow the rear phages to leave in the medium containing ten-strands of tPA-cDNA. , - heavy chain DNA can be isolated by conventional and often described methods. Otherwise, unless otherwise specified, enzyme and plasmid manufacturers are Example 3 of decomposing element and plasmid Introduction of substituents into tPA cDNA The amino acid motif RGD appears once or several times after expression of the substituted cDNA. Substitutions that result in all containing tPA at different positions in the polypeptide The group is listed. This entire polypeptide has a length of 527 amines. do. The starting point for the substituents was mptPA as described in Example 2.

- Heavyweight mptPA　O,04pmol is mpt by base exchange up to 1 to 3 times tPA: 0.5μ oligonucleotide that complements the range of DNA change React with mol (21-27mar). oligonucleotide first Phosphorylated using T4 polynucleotide kinase. typical mutation Inducing formulations are recognized from the following: Single chain mptPA DNA lμ12 (0.04 pmol) kinased oligonucleotide Creotide (contains ATP from the kinase formation reaction) 1, uff (0.5pm o1) 1Ox ligase buffer 5μa 1 mmol dNTPs 2.5μ0 (final concentration 50μM) 1 mmol ATP 4 μg (final concentration 100 μM) H2O36,5μ4 The mutagenesis formulation was incubated at 37°C for 15 minutes, then cooled to room temperature and finally 1 unit of Flenow fragment (Boehringer Mannheim) was added to Ta. After incubation for 1 hour at room temperature, 200 units of Tdi ligase (Biolabs) was added. The formulation was then incubated at 4° C. for 16 hours. Continue this 5 μg of the formulation was used for transformation of component JMI01. arising from it 7. Transfer the one-eye spot onto nitrocellulose. Afterwards, leave the filter on for 5 minutes. Washed in XSSC, air dried and baked at 80°C for 2 hours before baking. \Ibrid formation and hybridization were performed as described in Example 1. Fi Clean the router with 6XSET/SDS 011% at a temperature of 55-65℃. depending on the base i growth and length of the oligonucleotide-hybridized sample. It was done. Oligonucleotides used in the respective corresponding mutagenesis formulations Hybridized using Otide. Positive clones are autoradiographic You can see it visually.

This substitution means that the tPA-cDNA contained in mpla now contains one or The amino acid motif RGD and three other amino acid substituents at further positions encoding for a polypeptide containing, in which case this polypeptide The total number of amino acids in each peptide is 527.

The mptPA-DNA described in Example 2 was used as an oligonucleotide. C, +5'AGCAGTCACT　GGATCCCTCA　GAGC3' Cx, : 5'ACGTGGCCCG GGTATCTATT TC3' CA: 5'AACTTTTGACccccccTcAG TGGCA 3' C:5'CAGGCCGCAG CTCGAGCAGGAGGG3' using restriction enzymes between DNA fragments encoding individual protein regions. Mutations were made to generate additional recognition positions. This recognition position is Allows for deliberate excision of DNA fragments encoding white matter regions. in this way The mutated mpt PA DNA is the starting point for the following Examples 3.1-3.13. It was.

Example 1.3 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: code was used: 5'TCTGCGTTTTTATCACCTCTGCAGAT3' Washing temperature was 60°C in 6X SET/SDS O, 1% I;

The resulting positive clone was called mptPA-R,GDl and was mutated as described in Example 3. For mutagenesis, two 5' CCA using an oligonucleotide containing the following sequence: CCCGGCTCGCCTCTGAGCACA3' The wash temperature was 62°C in 5X SET/SDS O, 1%.

The resulting positive clone is mptPA-RGD2+! : Same as the description in call lf example 3 For mutagenesis, an oligonucleotide with the following sequence was used: 5 'ACCAGCAATAATCCCCCCCGGTTGCT3' The washing temperature was 60°C in 5X SET/SDS O, 1%;

The resulting positive clone is called mptPA-RGD3.

Example 34 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: code used: 5'CTGTGCTCCAATCGCCCCTGTAGC3' The washing temperature was 60°C in 6xsET15D5 0.1%.

The resulting positive clone is called mptPA-RGD4 and is cloned suddenly as described in Example 3. For mutagenesis, oligonucleotides with the following sequence were used: 5'GG TGCACTCGTCGCCTCTCTCCGCTG3' The wash temperature was 64° C. in 6×SET/SDS O,t%.

The resulting positive clone is called mptPA-RGD5.

Example 3.6 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: code was used: 5'GATGCCGTCTCCCCTCCGCCCGGC3' The wash temperature was 60°C in 5x SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD6 and was cloned as described in Example 3. For natural mutagenesis, an oligonucleotide with the following sequence was used: 'CAGGAACCGATCTCCGCGCGACCTCC3' The wash temperature was 65°C in 6X SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD7I;

Example 3.8 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: code was used: 5'GCTCTCCTGGTCACCGCGGGACGAA 3 ’ The wash temperature was 61°C in 6X SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD10.

Example 3.9 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: Code used: 5'GCTGCAGGTCCCCCCGGGGA, AGGCA 3’ The wash temperature was 65°C in 5X SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD11.

Example 3, 10 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: t::5'AGTGTCTCCATTACACAGCATG3' The wash temperature was 55°C in 6X SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD12.

Example 3.11 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: code used: 5'TGGGGCCCGTCGCCCCGAGTGTC3' The wash temperature was 60°C in 6x SET/SDS O, 1%.

The resulting positive clone was called mpLPA-RGD13.

Example 3.12 For mutagenesis as described in Example 3, oligonucleotides with the following sequences were used: 5'CGAATCGCCCCCGGCAGGCGTC3'Cleaning temperature was 55° C. in 5×SET/SDS O, 1%.

The resulting positive clone was called mptPA-RGD14.

Example 3, 13 For mutagenesis, oligonucleotides with the following sequences were used as described in No. 3. The cleaning temperature was: 5'GGTCGCATGTCGCCACGAATCC. , 58°C in 6x SET/SDS o,i%.

The resulting positive clone was called mptPA-RGD15.

Example 4 Construction of Vectors for Expression of Modified tPA-DNA Monkey Virus SV40D NA was digested with restriction enzymes BamHI and BclI, and 0.24. gel the kb fragment It was prepared by electrophoresis (Fig. 5). End with 4 desoxynucleotides DNA in the presence of rephosphates dATP, dCTP, dGTP and dTTP Filled with Flenow fragment of polymerase I. Next, use the X h o I linker. At the same time, the commercially available vector pUc18 was combined with the enzyme SmaI. Both became linear. Next, a xhoI linker was attached in the same manner. this vector (pUC18XhoN) was linearized with XhoI, and alkaline phosphorus treated with fatase and a 0.24 kb Xhol-SV40 fragment (see above) 2=, psvpA was generated.

psVpA-DNA was preparatively digested with XhoI and cleaved as described above. The polymerase was incubated in the presence of four dNTPs; 0.24k The fragment of b was isolated by gel.

At the same time, CL28X and pB2-2 (Reddy et al., 1987, DNA Eukaryotic expression vector C generated by ligation of 6.461-472) L28XhoBPV was partially cut with the restriction enzyme XbaI, i.e. temporarily Degradation was limited to only one of the two Xbal recognition sequences and the product was kept at a constant temperature (Figure 6). Next This formulation of was reacted with Klenowolimerase and dNTPs as described. I;. Subsequently, the linear molecules were isolated by gel electrophoresis.

Next, the linear pCL28XhoBPV fragment and the pretreated 0,2 A ligation with a 4kb fragment was performed. Characteristics of MinilisaLe After transformation and screening, the SV40 fragment was inserted into the approximately 0.15 kB XhoI position. A clone with the previous Xba position placed in the 3' direction of the A (“0CL28XhoBPV-5VpolyA”) is the ``early'' It has the SV40 transcription stop signal of the gene.

Bluff of pCL28XhoBPV-SVpolyA.

The mid-DNA was linearized with the restriction enzyme XhoI and alkaline phosphatase. treated with At the same time, mpt PAGD 115 was added to restriction enzyme S a 1. A fragment with a size of 2.1 kb was isolated. T4-riga two fragments were bonded to each other using enzyme. Transformation and minirisat (formerly H41ysat After e), a clone containing only one mutated tPA-DNA in the correct orientation is The vector was isolated: pCL28BPV-tPA-RGDi-15゜ Example 5 Cell line transfer and establishment C127I cells (J, Virol, F! 5 (1978) 298; ATC Ccatalogue of cell 1ines and hybrido mas 5th edition, 1985, p. 142) together with the BPV expression plasmid. Calcium-coprecipitation method (Virology 52 (1972)/456, DN A cloning; Volume ■; D, Ij, Glover IRL Press Co., Ltd., pp. 143 et seq. and p. 213 (1985)).

5×105 C127I cells were transferred to DEM (Dulbecco’s M odified Eagles Medium) + l 0% Fe2 (Foe The seeds were seeded in a 60rr+m vetri dish in a 60rr+m veterinary dish.

The next day, this medium was mixed with 25 mmol Hepes + lO% Fe2. a replaced with M E S (Modified Eagles Mediui +) Ca phosphate co-precipitate using loμy CsCl purified plasmid DNA. was formed and this coprecipitate was carefully applied onto <Cl27N cells. this cell The temperature was maintained at 37° C. and 7% CO2 for 4 hours. This was followed by glycerin shock treatment. This significantly increases the efficiency of import. For this, 4 hours after application of the precipitate The medium was removed from the cells. The cells were collected at 15% per 60 mm Petri dish. Griserif / HB S (DNA c1oning Vol. 2, p. 152) 2 It was kept constant at room temperature for 3 minutes together with mQ. Take the glycerin/HBS solution and cellulase (Ze l l l rase) in DMEM 3 m 4 + FC 5 l 0 Washed with %. The cells were mixed with DMEM + FC5l 0% at 37°C; 0027 The temperature was maintained at %. Take out D M E M + F CS10% 3 times in one week 62 to 3 weeks after the transfer containing the BPV genome. The collected cells are recognized as transformed cells, so-called 7-on (Foci). I was able to

7 cells expressing the tPA-mutant protein described above were placed in a casein-agar-overlay. Confirmed by (5asein-^gar-Over +ay) (see above) did. 37°C; cloudy casein after 2-3 hours of incubation at 7% CO2 - cold The amount of degradation could be observed in the sky at the positions where tPA-expressing cells were present. mosquito Zane - After removing the agar, this is it! The cells existing in the “cloning cylinder” ( Cloning-cy l 1 nder)” method (DNA cl oning Vol. 2, p. 220). Subsequently, the obtained cell line was subjected to D by standard methods. It was highly cultured in MEM + FC5 10%.

For production, cell lines were maintained in serum-free DMEM after achieving confluency. . Thus obtained l; t-FA mutant protein from serum-free cell culture medium supernatant. The quality can now be characterized and purified.

As mentioned above, for the agar overlay test (Agar 0vsrlay Te5t), The next solution is required. Overlay - Agarose 1) 8% Magermilch solution in H2O at 100°C Boil for 0 minutes and then cool in a 37° C. water bath.

2) A 2% solution of low melting point agarose in PH3 was heated at 37° by autoclave method. Cool in a water bath at C. Subsequently, add 2x concentrated DMEM in a l:1 ratio. 3) Dissolve 0.64 m9 of plasminogen in 1 m2 of H2O. Solution 2 16 mQ, solution 1 4 mQ and glasminogen Q, 4 mQ together. Obtain the overlay agarose by pouring in a pot. After mixing this Keep in a 37°C water bath.

To perform the test, cells were washed twice with serum-free medium in a vetri dish at 60 rpm. Purify. Next, carefully add 2 m (l) of each “overlay-agarose” to the Pipette into the liquid dish. Cooling and Solidification of Agarose I; Petri Dishes Leave at room temperature. Subsequently, under addition of 0027% for 2 to 3 hours at 37° C. Maintain the temperature at a constant temperature and measure the amount and number of decomposed substances.

Example 6 From the serum-free cell culture supernatant obtained in Example 5, the t-FA mutant protein erythrinat after sterile filtration and addition of 0.01% Tween 80. Pushin-inhibitor Sepharose (ETI-Sepharose, 1cm x 3cm) ) was isolated by affinity chromatography. affinity matrix For the production of CNB r activated Sepharose 4B ETl 5 per mQ mg was combined. The gel material was treated with 20 mmol Na phosphate before application of the cell supernatant. , 115 mol of NaC1O, 0.01% Twaen 80, equilibrated at pH 7.0. I let it happen. After application, the gel material is soaked in the same loose solution to remove non-specifically bound material. Treated with buffer solution. Subsequently, specific binding and desorption of the mutant protein are performed using glycerin. Arginine 0.1 mol/MCI, ΦTveen80 0.01% , pH3.0. Combine the eluate and add caustic soda solution The pH was adjusted to 5.0 with 0.1 mol.

Thus, the following polypeptides differing from tPA shown in sections 1a-dcI as follows: Tido was obtained: 6.01 8G, 9D146G.

1775.2633° 6.02 28G, 29D, 46G.

177s, 2635 6.03 31G, 32D, 46G.

177S, 263S 6.04 103D, 46G.

1775.263S 6.05 109R, llID, 46G.

177S, 263S 6-06 131G, 46G.

177s, 263S 6.07 301R1303D, 46G, 177s, 2635 6.08 384c, 385D, 46c.

177s, 263S 6.09 398R, 399G, 46G11773.263S 6.10 458R, 46G, 177 S, 263 S 6.11 463G, 464D, 46G1177S, 263S 6.12 475R146G1 177s, 263S 6.13 523G, 524D, 46G, 1775, 2635 The numbers indicate the amino acids for which the polypeptide deviates from the tPA shown in Figures 1a-d. The symbol represents the position of the mutant protein at the position indicated by the number. represents an amino acid that

Example 7 Characterization of oligosaccharide content The mutant protein 5 to 10μ9 obtained in Example 6 was subjected to 5DS-gel electrophoresis. separated and subsequently transferred onto nitrocellulose.・Tveen20 0.1% , pH 74 (2 mmol phosphate, 1150 mmol NaC) After saturation with Grinophonia amplicifolia (pH 7,4), the membrane was Peroxidase binding of Griffonia Simplicifolia) The mixture was kept at constant temperature for 2 hours together with the combined lectin. Unbound substances are buffered with TBS. solution (Tris lO mmol, NaC 1150 mmol, pH 7.4). After that, nitrocellulose was mixed with 50 mmol of Tris, 1150 mmol of NaC, H 5- in 2O20.02% and 4-chloro-1-naphthol 0.5 mg/mQ The temperature was kept constant for 10 minutes. A positive reaction can be visually confirmed in 5 minutes by the protein band turning blue. I could see it. This reaction is then carried out by transferring the nitrocellulose membrane into water. I stopped it.

The oligosaccharide is bonded to the β-linked sub-terminal galactose group as shown in Figure 8. It has an α-linked galactose group. In this case, the α-galactose group It is located at lactose 6' (see Figure 8 for the number of the II group). Another subterminal The lactose group is substituted by sialic acid or other α-linked Replaced by galactose.

FIG. 1a a: ThrAlaG1uS*rGlyAlaG1uCysThrAsnTrp AmSerSerAlaLeuAlaGmysPro-FIG, 1b aH5ar)-1isProTrpGlnAIaAIal-ρ-AlaLysH i included Shi45erProGClueGluArgPhe-FIG, 1c a: ProGlnAlaAsnLeu +-1isAspAlaCysGln GlyAspSarGlyGIyProLeuValCyskeu - FIG. 1d B:#gProI:nci- FICi, 2/9 FIG, 3/9 FIG, 4/9 FIG, 5/9 international search report llTm1l-Ii4-mu-ca*snMep to T1EP991]1OiG-r l++or1116Ml iiW1wh*+ ltafu CT/El’ 891 01040 - International research report

Claims (7)

[Claims] 1. In the tPA-like polypeptide, the polypeptide has the amino acid sequence of tPA. sequence or a sequence derived therefrom, in which the tripeptides 1 to 6 are A tPA-like port characterized in that it is replaced by the tripeptide RGD. Ripeptide. 2. A DNA sequence encoding a polypeptide according to claim 1. 3. A vector having a gene sequence encoding the polypeptide according to claim 1. Tar. 4. A genetic technology method for producing a peptide sequence according to claim 1, comprising: A gene encoding a peptide sequence according to claim 1 in a host organism. The peptide sequence according to claim 1, characterized in that a peptide sequence according to claim 1 is introduced for expression. Genetic technology methods for producing. 5. In a medicament, at least one polypeptide according to claim 1 is used as a pharmaceutical A pharmaceutical product characterized in that it is contained in a carrier or binder that is compatible with. 6. from at least one polypeptide according to claim 1 and another fibrinolytic agent. The medicament according to claim 5, containing a combination of. 7. having the amino acid sequence of tPA or a sequence derived therefrom, in which case tPA-like tripeptides 1-6 are replaced by tripeptide RGD peptide sequence in a host organism. tPA, characterized in that one gene encoding the tPA is introduced for expression. Methods for producing similar polypeptides.