JPH04304889A - Expression controlled vector, microorganism having the vector and production of valuable substance using the microorganism - Google Patents

Abstract

PURPOSE:To obtain an expression controlled vector pNU550 capable of producing a useful exogenote product when bonded with an exogenote by linking a lac repressor originated from E.coli to the downstream of MWP promoter originated from Bacillus brevis. CONSTITUTION:A DNA containing an MWP promoter region of Bacillus brevis 47 (FERM P-7224) is cut with a restriction enzyme. A lac repressor gene originated from E.coli is linked to the downstream of the above fragment to obtain an expression controlled vector pNU550 expressed by the restriction enzyme map of fig.1. The expression controlled vector pNU550 is treated with a restriction enzyme and bonded to a gene of an exogenote product such as human salivary gland amylase gene or alpha-amylase gene of Bacillus licheniformis to effect the transformation of a host and obtain an expression controlled vector pNU550-X for the production of a useful exogenote product (e.g. human salivary gland amylase).

Description

[Detailed description of the invention]

0001

[Industrial Application Field] The present invention relates to biotechnology, and more specifically, the present invention relates to a novel expression control vector and a vector obtained by linking a foreign gene to an expression control vector, which is carried in Bacillus brevis. The present invention relates to a microorganism comprising at least one microorganism, and a method for producing the product, which is characterized by culturing the microorganism, producing and accumulating a foreign gene product in the culture, and collecting the product.

0002

[Prior art] Udaka et al.
We found that there are many strains of Bacillus brevis that do not produce protease, and one of them, Bacillus brevis,
Brevis 47 (FERM P-7224: Japanese Patent Application Publication No. 1983)
-58074, Japanese Patent Application Laid-Open No. 62-201589)
et al., J. Bacteriol. ,167,1239(1
987); Norihiro Tsukagoshi, Journal of the Japanese Society of Agricultural Chemistry, 61, 68,
(1987) and Japanese Patent Application Laid-Open No. 62-201583, respectively.
and middle wall protei
) gene promoter and the MW protein (middle wa protein), which is one of the major extracellular proteins.
A secretion vector was created using the region encoding the signal peptide of ll protein), and α-amylase (Japanese Unexamined Patent Publication No. 62-201583, H. Yamagata et al., J. Bacteriol.
．． , 169, 1239 (1987) and the secretion of porcine pepsinogen (Shigezo Udaka, Japanese Society of Agricultural Chemistry, 1985 Conference Abstracts, p. 837-838; Norihiro Tsukagoshi, Journal of the Japanese Society of Agricultural Chemistry, 61, 68 (1987)). production has been successful.

[0003] Takagi et.
), which is the same strain as Agric.Biol.
．． Cem. , 58, 2779-2380 (1989), and Yamagata et al.'s high secretion production of human EGF (Proc.N
ath. Acad. Sci. USA, 86, 3589-
3539 (1989)).

0004

[Problem to be solved by the invention] The productivity of foreign gene products using Bacillus brevis as a host bacterium has been dramatically improved compared to the production amount before applying genetic recombination technology and the system using E. coli as a host bacterium. However, further technological development is required to supply industrially useful substances at low cost. Conventionally, vectors used in systems using Bacillus brevis as host bacteria are Staphylococcus
It is based on pUB110 derived from B. cus aureus, and requires the presence of drugs such as antibiotics in order to maintain it stably within Bacillus brevis.It is also a high-copy plasmid, so a large amount of genes can be generated in a short period of time. It was frequently observed that for the expression to occur, severe damage to the host bacterium, Bacillus brevis, resulted in less production of the gene product. In addition, some foreign gene products have a negative effect on the growth of the host bacterium, Bacillus brevis, and the growth may be inhibited at the same time as the production of the gene product, resulting in less production of the gene product. It is speculated.

[0005] Therefore, if a host-vector system that is compatible and compatible with the host bacterium and can artificially control the growth of the bacterium and the timing of production of foreign gene products is developed, the growth of the host bacterium will be good. , it becomes possible to set conditions that increase the amount of foreign gene product produced.

[0006]

[Means for Solving the Problems] In addition to the above-mentioned industry needs, Bacillus brevis can be used as a highly versatile host, Bacillus brevis can be used to freeze and preserve competent bacteria, and In view of the ease of transformation using electric pulse methods, etc., we focused on the industrial utility of Bacillus brevis and developed vectors that are stable in Bacillus brevis and capable of artificially controlling the production of foreign gene products. As a result of intensive study, we succeeded in constructing a highly effective vector by inserting the E. coli lac operator gene and the E. coli repressor structural gene into a part of a plasmid that can be expressed in Bacillus brevis, thereby completing the present invention. .

That is, the present invention relates to a vector that can be stably expressed in Bacillus brevis and that can control the artificial production of a foreign gene product. Furthermore, the present invention provides an expression control vector obtained by linking a target foreign gene to this vector, a transformant carrying the vector, and a highly efficient production of foreign gene products by culturing the transformant. It concerns a method for producing large amounts of secretion with good quality.

The present invention will be explained in detail below.

The plasmid used for constructing the invention vector may be any plasmid as long as it can be expressed in Bacillus brevis. For example, plasmid pNU210 (J. Bacte
riol. , 171, 1010-1016 (1989)
is used effectively. Plasmids can be prepared by known methods, such as the method of Tanaka et al. (J. Bacteriol.
．． , 129, 1487-1494 (1977)).

Any promoter may be used as long as it functions in Bacillus brevis, but promoters derived from Bacillus brevis are preferred, such as the major extracellular protein gene ( MWP gene) promoter and Bacillus brevis HPD31 (FERM
Examples include the promoter of BP-1087). The DNA containing the promoter region needs to have an SD sequence, a translation start codon, etc. in addition to the above promoter.

As mentioned above, since the DNA containing the MWP promoter region of Bacillus brevis 47 is known (J. Bacteriol., 172, 1312-
1320 (199), cut the necessary parts with restriction enzymes, and use this as a subcloning vector (if E. coli is used as a transformant, pUC118,
pUC-based plasmid such as pUC119 or pBR322
(preferably a plasmid of the E. If E. coli is transformed, the DNA containing the desired promoter region will be preserved. Therefore, if necessary, by removing and preparing a plasmid from a transformant, a DNA fragment containing the desired promoter can be extracted.

The operator and repressor gene used in the expression control vector may be any gene as long as it can be expressed in Bacillus brevis, such as E. coli la
c operator, repressor gene, etc.

[0013] Furthermore, the foreign gene linked to the expression control vector of the present invention may be any gene as long as it can be expressed in Bacillus brevis; for example, the human salivary gland amylase gene, Bacillus lichenformi
Examples include the α-amylase gene of s.

[0014] As a method for constructing a plasmid, conventional methods can be used as appropriate, such as molecular cloning,
A Laboratory Manual, Cold Spring Harbor Laboratory (Molecular C
loning, A Laboratory Man
ual, Cold Spring HarborL
For example, the method described in ``Laboratory, 1982'' is exemplified.

B. A DNA fragment containing the MWP promoter region of brevis47 can be obtained by the method described above. By inserting a synthetic DNA encoding the lac operator between the promoter and SD sequence in this fragment, a DNA fragment containing the promoter, operator, and SD can be obtained (MO).

E. Plasmids carrying the E. coli lac repressor gene are known. This was treated with restriction enzymes, and the resulting repressor gene was extracted from B. brevi
Of the MWP promoters of s47, P4 and P5 promoters were linked downstream, and this was introduced into a vector from which the MWP promoter region of pNU210 had been removed, to obtain plasmid pNU550 having the lac repressor gene.

Bacillus brevis 47 (FERM P
A plasmid carrying a DNA fragment in which the Bacillus licheniformis α-amylase (BLA) gene is linked to the downstream of the MWP promoter region of Bacillus licheniformis is known (J. Bcateriol., 169).
, 1239-1245 (1987), this was treated with restriction enzymes to obtain a DNA fragment encoding the BLA gene, and the three fragments of plasmid pNU550 and MO were connected to create Bacillus.
Brevis was transformed to obtain an expression control vector pNU550-BLA in which the three fragments were correctly connected.

[0018] If the desired foreign gene is inserted into the thus prepared expression control vector pNU550 downstream of the MOMWP promoter and the signal peptide (Fig. 4) into the inframe according to a conventional method, and the microorganism is transformed, The expression of a foreign gene can be controlled by the lac operator, and a transformant can be obtained which can secrete and produce a large amount. Therefore, according to the present invention, it is possible to appropriately transform microorganisms with a desired foreign gene, and by culturing the thus obtained transformants, it is possible to obtain a large amount of the target foreign gene product. can.

The microorganism to be transformed with a vector incorporating a foreign gene may be any microorganism belonging to Bacillus brevis, such as Bacillus brevis 4.
7 (FERM P-7224) and Bacillus brevis HPD31 (FERM BP-1087), but Bacillus brevis HPD31 is preferably used. The method for transforming Bacillus brevis may be any known method, for example, the method of Takahashi et al.
J. Bcateriol. , 156, 1130 (198
3)) or the method of Takagi et al.
ol. Chem. , 53, 3099-3100 (198
9)) etc. are exemplified.

[0020] The medium used for culturing the obtained transformant may be any medium as long as the transformant can grow and produce the desired foreign gene product.

[0021] Examples of carbon sources contained in the medium include glucose, sucrose, glycerol, starch,
Possible substances include dextrins, molasses, toxins, and organic acids. Examples of the nitrogen source contained in the medium include organic nitrogen sources such as casein, polypeptone, meat extract, yeast extract, casamino acids, and glycine, and inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, and ammonium nitrate. In addition, inorganic salts such as potassium chloride, monopotassium phosphate, dipotassium phosphate, sodium chloride, and magnesium sulfate are added to the medium as necessary. Alternatively, the culture may be performed using a synthetic medium containing mainly sugar and an inorganic nitrogen source. Bacteria exhibiting auxotrophy may be supplemented with nutritional substances necessary for their growth. Examples of such nutritional substances include amino acids, vitamins, nucleic acids, salts, and the like.

If necessary during culture, antibiotics such as penicillin, erythromycin, chloramphenicol, bacitracin, D-cycloserine, etc.
Ampicillin is added. Further, if necessary, antifoaming agents such as soybean oil, lard oil, various surfactants, etc. may be added to the medium.

[0023] The initial pH of the medium is 5.0 to 9.0,
More preferably, it is 6.5 to 7.5. The culture temperature is usually 15°C to 42°C, more preferably 24°C to 37°C, and the culture time is usually 16 to 166 hours, more preferably 24 to 96 hours.

[0024] After the cultivation is completed, the bacterial cells and the supernatant are separated by a method known per se, such as centrifugation or filtration.

If Bacillus brevis HPD31 or the like is used as a microorganism to be transformed, not only can it be easily transformed by the electric pulse method, but it also has the advantage of producing the desired product outside the microorganism. Therefore, the foreign gene product contained in the culture supernatant obtained as described above can be processed by, for example, salting out, isoelectric focusing precipitation, gel filtration, ion exchange chromatography, hydroxyapatite, high performance liquid It may be purified by chromatography or the like, and the desired foreign gene product can be easily obtained in this way.

[0026] The present invention will now be explained in more detail with reference to Examples.

[0027]

[Example 1]

[0028]

[(1) Operator introduction method] MWP promoter region (J. Bcateriol., 171, 1010
, 1016 (1989)) has plasmid pNU21.
After digesting 0 with the restriction enzyme ApaLI, Klenow Fr.
The ends were made blunt with agment, and a BamHI linker was added using ligase. Then BamHI and EcoRI
A 206 bp fragment was recovered. This fragment was inserted into the EcoRI site of pUC119 to obtain plasmid pHTO1 (ie, pHT1). 5'TGGAATTGTGACCGGTAACAATT
3' and 5'AATTGTTACCGGTCACAAT
Two TCCA 3' DNAs were prepared using a DNA synthesizer, the 5'OH ends were phosphorylated with T4 Plynucleotide kinase, and then annealed to prepare a synthetic operator.

[0029] Plasmid pHTO1 (pHT1) was transformed into Ss
After partial digestion with pI, treatment with alkaline phosphatase,
Insert the composition operator, E. coli JM10
3 was transformed. A plasmid was extracted from the transformant, the DNA base sequence was determined, and plasmid pHTO2 (that is, pHT2) inserted at the correct position and in the correct direction was obtained (FIGS. 2 and 3).

[0030]

[(2) Construction of promoter/operator (MO)]
In order to utilize only the strongest P2 promoter among the MWP tandem promoters, the following operation was performed. Figure 3-2
NcoI sites (C
CATGG), site-specific mutagenesis was performed.Site-specific mutagenesis was performed by PCR method.

[0031]

[(I) Introduction of NcoI site at 267-272] pN
MfiI-EcoRI fragment of U210 (1-3
11, Figure 3) as pUC119 BamHI-EcoR
A plasmid pUC119-MWV inserted into I was obtained. Synthetic DNA primer 5'GTTTTTTCGTGTGC
pUC119-MW made into a single strand by heat denaturation of CATGGTATTAAAC3' and M13 primer (5'CAGGAAACAGCTATGAC3' (manufactured by Takara Shuzo))
By annealing with V, a complementary strand was synthesized using DNA polymerase (MWV-Nco).

[0032]

[(II) Introduction of NcoI site from 466 to 471] Synthetic DNA primer 5'GATTAACAACACCA
p using TGGAATTG3' and M13 primer RV.
Using HTO2 (pHT2) as a template, the target DNA fragment was obtained in the same manner as above (MWV-Nco).

[0033]

[(III) Construction of promoter/operator] The previously obtained DNA fragment (MWV-Nco) was combined with PstI, Nco
Digestion with I yielded a 19.3 bp fragment. Also the D obtained above
The NA fragment (MWV-Nco) was digested with NcoI and BamHI to obtain a 111 bp fragment. These two fragments and p
A plasmid obtained by previously cutting UC119 with PstI and BamHI was treated with ligase to create plasmid pU.
C119-M12 was obtained.

Furthermore, in order to remove the P1 promoter region, pUC119-M12 was digested with RsaI and then digested with BamHI.
206 bp obtained by adding a linker and digesting with BamHI
The fragment was introduced into the BamHI site of pUC119 to obtain plasmid pUC119-MO. Its promoter/
The operator area is shown in Figure 4.

[0035]

[(3) Method for introducing repressor] Known plasmid pM containing the E. coli lac repressor gene (lacI)
C9 (Proc. Natl. Acd. Sci. USA,
80, 3015-3019 (1983)) as raw material,
Plasmid p
JTO1 was prepared.

[0036] The la of pJTO1 thus prepared
In order to connect the promoter region of cI with the promoter region of MWP, a BspHI site (TCATGA) was introduced near the translation initiation codon ATG of both genes by site-specific mutation. The mutation is “The Amersh
am oligonucleotide-direct
ed in vitro mutagenesi
s system" (manufactured by Amersham).

[0037] First, in order to subclon the 5' upstream of lacI into M13, pJTO1 was cut with ApaLI, then blunt-ended, a BamHI linker was added, and the BamHI-EcoR1 fragment (418 bp) was inserted into M13.
inserted into the mp19EcoRI-BamHI site (m
p19-lacIF). Using this single-stranded DNA as a template, a synthetic probe 5'GGGTGGTGATCATGAA
Mutation treatment was performed at ACCA3' to obtain mp19-lacIF-BspH into which a BspHI site was introduced. On the other hand, BspHI was added to the translation start site of the MWP promoter region.
To introduce the site, the Ec of pHTO1 (pHT1)
oRI-BamHI206bp M13mp18Eco
It was inserted into the RI-BamHI site. Plasmid M13
Synthetic probe 5'CTT using mp18MWP as a template
Bsp at TTTCATGACCTTGTGTTC3'
mp18-MWP-BspH into which the HI site was introduced was obtained.

[0038] Previously obtained mp19-lacIF-BspH
E. After amplification in coli GM119 (mp19
-lacIF-BspH/E. coli GM119
), which was cut with ApaLI and BspHI to give 332b
A DNA fragment of p was recovered. On the other hand, pJTO1 was Apa
Cut with LI-HindIII to obtain 800bp DNA
Fragments were recovered. In addition, mp18-MW obtained by the above
P-BspH was cleaved with EcoRI and BspHI, and 2
A DNA fragment of 0.05 bp was obtained. Next, these three types of D
NA fragment and EcoRI-HindIII of pUC19
pUC-MWP-lac
I was obtained (Fig. 7).

[0039] The obtained pUC-MWP-lacI was
After cutting with ndIII, the ends were blunt-ended with Klonow Fragment, and further cut with EcoRI to obtain a fragment of about 1.5 kb. This fragment was introduced into a plasmid in which pNU210 was cut with AvaII, blunt-ended, and further cut with EcoRI. The obtained plasmid was cut with EcoRI to make it blunt-ended, and after adding a BamHI linker,
Cut with mHI, perform ligase reaction, and plasmid p
NU550 was obtained (Figure 8).

[0040]

[(4) pNU550-human salivary gland amylase gene (
Construction of foreign gene X)] Human salivary gland amylase (HAM)
Y) Plasmid pTS7 (Appl. Microbio
l. Biothnol. , 34, 297-302 (19
90)) was cut with ApaLI-HindIII and MW
DNA containing part of the P signal sequence and the amylase gene
A fragment of 1.6 kb was obtained.

On the other hand, pUC119-MO was treated with BamHI-
A 204 bp DNA fragment containing part of the promoter, operator and signal was obtained by cutting with ApaLI. These fragments were inserted into pUC19 BamHI-HindIII to obtain plasmid pUC-MO-HAMY. This plasmid was cut with BamHI-HindIII and
．． The 8kb DNA fragment was recovered and pNU550 Bam
HI-HindIII and B. brevis
Transformation of HPD31 was performed. IPTG of transformed strain
(Isopropyl β-D(-)thiogalactopyranoside)
The presence or absence of induction was investigated, and the plasmid obtained from the induced transformant was designated pNU550-HAMY (FIG. 8).

[0042]

[Example 2] B. brevis HPD31 in 5'PY medium (Agric.Biol.Chem., 53, 227
9-2280 (1989)) in a medium containing 1mM of IPTG and a medium without the addition of IPTG, and cultured with shaking at 30°C for 85 hours. The above culture solution was centrifuged, and the amylase activity of the supernatant was determined using Saito's method (Arc) using soluble starch as a substrate.
h. Bischem. Biophys. ,155,29
0-298 (1978)), and the results shown in FIG. 9 were obtained. As expected, B.
brevis HPD31 secreted and produced human salivary gland amylase in the culture medium by induction with IPTG. There was no production in the control without IPTG addition.

[0043] Therefore, it was confirmed that production control using the pNU550-X system is possible.

[0044]

[Example 3] B. brevis 47 (FERM
P-7224) MWP promoter and signal peptide (J. Bacteriol., 169, 1239-
1245 (1987) downstream of B. lichenifo
rmis α-amylase (BLA) gene (J.Bi
ochem. , 96, 1147-1156 (1985)
) directly connected to B. Plasmid pHY481 (Appl. Env. Microb
iol. , 49, 1076-1079 (1985)).
iol. , 169, 1239-1245 (1987))
was digested with HindIII, further digested with ApaLI, and B
An ApaLI-HindIII fragment containing the LA gene was obtained.

pNU550-HAMY obtained in Example 1 was treated with ApaLI and HindIII to remove HAMY, and an ApaLI-HindIII fragment containing the BLA gene was inserted to obtain pNU550-BLA. bre
vis HPD31 was transformed.

[0046] This transformant was grown in 5'PY medium (Agr
ic. Biol. Chem. , 53, 2279-228
(1989)) in a medium containing 1mM of IPTG and a medium without the addition, and cultured with shaking at 30°C for 85 hours. The above culture solution was centrifuged, and the amylase activity of the supernatant was determined using Saito's method (Arch.Bis) using soluble starch as a substrate.
chem. Biophys. , 155, 290-298
(1978)), and the results shown in FIG. 10 were obtained. As in Example 2, as expected, B. brevis HPD31 secreted and produced human salivary gland amylase in the culture medium by induction with IPTG. Bacillus, which did not produce in the control without IPTG.
licheniformis α-amylase was secreted and produced.

[0047] Therefore, it was further confirmed that production control using the pNU550-X system is possible.

[0048]

Effect of the invention: Novel expression control vector p according to the present invention
NU550 not only has an excellent ability to control expression, but also allows insertion of various foreign genes as appropriate, so it can significantly increase the productivity of foreign gene products.

[Brief explanation of the drawing]

FIG. 1 is a restriction enzyme map of the expression control vector pNU550.

FIG. 2 is a diagram illustrating a method of inserting an operator.

FIG. 3 is a nucleotide sequence diagram of a region including the MWP promoter and each region in plasmid pHT2.

FIG. 4 is a nucleotide sequence diagram of the region including the promoter and operator region of plasmid pUC119-MO.

[Figure 5] pJTO1 (pUC1 with lacI gene)
9) Vector construction diagram (1).

[Figure 6] pJTO1 (pUC1 with lacI gene)
9) Vector construction diagram (2).

FIG. 7 is a diagram showing the introduction of the lacI repressor gene.

FIG. 8 is a construction diagram of pNU550-X.

FIG. 9B. brevis HPD31/pNU55
FIG. 2 is a diagram showing the relationship between culture time and amylase activity of 0-HAMY.

FIG. 10B. brevis HPD31/pNU5
It is a relationship diagram between culture time and amylase activity of 50-BLA.

Claims (7)

[Claims] Claim 1: Expression control vector pNU550 shown in the restriction enzyme map of FIG. 2. An expression control vector pNU550-X obtained by ligating a foreign gene to the expression control vector pNU550 shown in the restriction enzyme map of FIG. 3. A microorganism carrying the expression control vector pNU550-X. 4. Bacillus b brevis carrying the expression control vector pNU550-X.
revis). 5. Bacillus brevis HPD31 carrying the expression control vector pNU550-X
us brevis HPD31) (FERMBP
-1087). 6. A method for producing a foreign gene product, which comprises culturing a microorganism carrying the expression control vector pNU550-X. 7. The foreign gene product is human salivary gland amylase or Bacillus licheniformis.
7. The method according to claim 6, wherein the α-amylase is α-amylase of P. licheniformis.