JPH04281800A - Method for detecting dna-binding protein - Google Patents

Abstract

PURPOSE:To simply separate and detect a DNA-DNA binding protein conjugate and a DNA-DNA binding protein-protein conjugate. CONSTITUTION:In both a solution containing a DNA fragment labeled with a radioisotope or a fluorescent substance and a peptide or a protein specifically binding to the aforementioned DNA fragment, either thereof having a lower moving rate is subjected to electrophoresis in advance and unidimensionally developed. At this time, the electrophoresis is stopped. The electrophoresis of the other is then performed on the same lane to catch up with the aforementioned one and both are bound. The electrophoresis is subsequently carried out by using both as the resultant DNA-DNA binding protein conjugate. After completing the electrophoresis, the labeled DNA fragment-peptide or DNA fragment-protein conjugate is then detected.

Description

[Detailed description of the invention]

0001

TECHNICAL FIELD The present invention relates to a method for detecting proteins involved in the regulation of gene expression.

0002

BACKGROUND OF THE INVENTION Peptides and proteins that bind to DNA are important factors involved in regulating gene expression. A well-known example is a protein that binds to a specific sequence in the promoter region or enhancer region of DNA. By binding to a specific sequence on DNA, this protein initiates and promotes transcription of DNA into RNA. or suppress it.

[0003] Many attempts are being made to detect and separate this DNA-binding protein and analyze the regulation of gene expression. Not only that, many of the genes called oncogenes and tumor suppressor genes also have R from this DNA.
A DNA-binding protein that controls transcription to NA,
Analysis of these DNA-binding proteins is being carried out to analyze the mechanisms of cancer development and to apply them to cancer treatments.

[0004] DNA-binding proteins are abundant in cells, particularly in the nucleus, and are difficult to detect because they are present in minute quantities and mixed with many other proteins. Gel shift analysis is often used as a detection method. DN containing a specific sequence labeled with 32P etc.
The A fragment is mixed with an intracellular protein extract containing a DNA-binding protein, or a fraction thereof such as an intracellular protein extract or a nuclear protein extract, to form a DNA-protein complex. When this mixed solution is electrophoresed using an electrophoresis gel such as polyacrylamide gel in a buffer that slows down the dissociation rate of the complex, DNA
-Protein complexes are uncomplexed DNA
Because it has a larger molecular weight than fragments, it generally migrates later. However, the difference in migration speed at this time depends not only on the molecular weight but also on the amount of charge.

[0005] If only the labeled bands are detected using an autoradiograph or the like on the gel after electrophoresis, it is possible to separate and see bands of DNA fragments that do not form complexes with DNA-protein complexes. , that is, the presence of DNA binding proteins can be detected.

[0006] This gel shift analysis can be applied as a method for detecting which fraction of an intracellular protein extract fractionated by chromatography etc. contains a DNA-binding protein of interest, and it can be used not only for gel shift analysis but also for other purposes. It is widely used in combination with applied methods such as footprinting method and methylation binding inhibition method to identify specific DNA sequences.

[0007]

[Problem to be solved by the invention] The binding between intracellular DNA-binding proteins and DNA not only creates a 1:1 complex, but also multiple proteins often create a complex with one DNA-specific sequence. . At this time, only one protein binds to the specific sequence, and new proteins may sequentially bind to the DNA-protein complex, independent of the specific sequence. Conversely, there are cases in which a single protein cannot bind to a specific sequence, but multiple proteins can bind to a specific sequence only after forming a protein-protein complex.

In conventional gel shift analysis, in the presence of all proteins contained in an intracellular protein extract, D
Since the NA fragment and the protein are bound together, if a complex of multiple protein complexes and DNA is formed, only the final form of the DNA-protein complex can be detected. That is, it is impossible to detect the protein that initially binds to DNA as a DNA-protein complex.

[0009] Furthermore, when a protein-protein complex first binds to a specific sequence of DNA, it can only be detected as the final form of the complex.

[0010] The above-mentioned problems pose a major problem in detecting, identifying, or purifying the target DNA-binding protein.

[0011]

[Means for Solving the Problems] The present invention involves electrolytically treating a solution containing a DNA fragment labeled with a radioactive isotope or a fluorescent substance and a solution containing a peptide or protein that specifically binds to the DNA fragment. Electrophoresis is performed on the same lane of a electrophoresis gel with different electrophoresis start times, the DNA fragment and the peptide or the protein are combined in the electrophoresis gel, and after the electrophoresis is finished, the labeled DNA fragment-peptide is separated. Alternatively, a method for detecting a DNA-binding protein is characterized by detecting a DNA fragment-protein complex.

Examples of the radioactive isotope used in the present invention include 32P, and examples of the fluorescent substance include FITC (fluorescein isothiocyanate). As a solution containing a peptide or protein that specifically binds to a DNA fragment, for example, an intracellular protein extract, an intracytoplasmic protein extract, or an intranuclear protein extract is used. Further, as the gel for electrophoresis, for example, polyacrylamide gel or the like is used.

[0013]

[Action] A large number of proteins are mixed in the intracellular protein extract. When this extract is subjected to electrophoresis using a polyacrylamide gel or the like, each protein is developed according to its molecular weight and charge.

[0014] Generally, the molecular weight of DNA-binding proteins contained in intracellular protein extracts is on the order of several thousand to several hundred thousand, and in many cases tens of thousands or more. On the contrary,
The DNA fragments used in gel shift analysis are single-stranded or double-stranded, consisting of tens to hundreds of base pairs, and when comparing the electrophoretic migration speeds of DNA fragments and DNA-binding proteins alone, the DNA fragments are faster. is often large.

The present invention utilizes the difference in migration speed between DNA fragments and DNA-binding proteins during electrophoresis.

[0016] First, an intracellular protein extract is introduced into a lane of an electrophoresis gel, and electrophoresis is started. As a result, proteins mixed in the intracellular protein extract are developed in one dimension. At this point, electrophoresis is temporarily stopped, a DNA fragment having a specific sequence is introduced onto the same lane, and electrophoresis is started again. The DNA fragment will catch up with the protein with a smaller electrophoretic velocity and at some point will be co-located with the DNA-binding protein. The DNA fragment and the DNA-binding protein existing at the same position bind together in the same way as in a solution, and from then on, the DNA fragment and the DNA-binding protein bind together.
Electrophoresis will be performed as a DNA-binding protein complex.

[0017] If the electrophoretic migration speed of DNA-binding proteins is expected to be higher than that of DNA fragments, conversely, the DNA fragments may be migrated first, and then the intracellular protein extract may be introduced. .

[0018] By this method, the proteins in the intracellular protein extract are expanded in one dimension, so the DNA
- Proteins do not bind to the protein complex one after another, and information that cannot be obtained with conventional gel shift analysis can be obtained.

[0019]

[Example] DNA fragments were synthesized using a synthesizer (Applied Biosystems 391 DNA Synthesizer). Synthesized coding strand (CGTTAACTGTGCA
GCTCAAACATTTGTTGGAGACAGTG
ACATCACTAAGTCACTGAAAGCCCC
AGCT) and non-coding strand (GGGGCTT)
TCAGTGACTTAGTGATGTCACTGTC
TCCAACAAAATGTTTGAGCTGCACAG
TTAACGAGCT) in an equal volume of high salt solution (50m
M tris(hydroxymethyl)aminomethane, 10mM
Mixed in magnesium chloride, 100mM common salt),
After heating at 95° C. for 5 minutes, annealing was performed by cooling slowly to obtain a 67mer double-stranded DNA fragment.

The obtained DNA fragment was subjected to electrophoresis using an 8% polyacrylamide gel, and the band of the DNA fragment was cut out, eluted from the gel by electrodialysis, and purified by ethanol precipitation. The double-stranded DNA fragment is [γ-32
P]ATP was used to label the 5' end using polynucleotide kinase.

[0021] A nuclear protein extract of BW5147 (mature T cell line) was prepared as follows.

[0022] 109 cultured BW5147 were
ml Buffer I (15mM HEPES; pH
Cells were killed by suspension in 7.6, 10mM KCl, 5mM magnesium chloride, 0.1mM EDTA, 10mM sodium bicarbonate, 1mM phenylmethylsulfonyl fluoride) and passing through a 25-gauge syringe needle.

[0023] This suspension was centrifuged, and the resulting pellet was mixed with 10 ml of Buffer II (15 mM HEPES;
pH7.6, 115mM KCl, 5mM MgC
l2, 0.1mM EDTA, 1mM DTT,
Resuspended in 10mM sodium bicarbonate, 1mM phenylmethylsulfonyl fluoride).

[0024] Add 1 ml of 4M ammonium sulfate (pH 7.8) to this suspension, shake slowly at 4°C for 30 minutes, and centrifuge to obtain a supernatant.

[0025] 3 g of ammonium sulfate was added little by little to this, and the mixture was further slowly shaken at 4°C for 15 minutes. This solution was centrifuged to obtain a crude nuclear protein extract, and buffer III (25mM HEPES; pH 7
．． 6, 50mM KCl, 5mM magnesium chloride, 0.1mM EDTA, 1mM DTT, 10
% glycerin) and further dialyzed against 500 ml of Buffer III for 4 hours. This dialysis was repeated twice to obtain a nuclear protein extract of 2.5 mg/ml.

[0026] Detection of DNA-binding proteins was carried out as follows.

104c in the Eppendorf tube
5 μl of DNA fragment labeled with 32P at the 5′ end of pm
BW5147 nuclear protein extract in a total amount of 15μ
1 of reaction solution (10mM tris(hydroxymethyl)aminomethane; pH 7.5, 1mM EDTA, 10mM
M β-mercaptoethanol, 50mM NaCl,
2.5 μg poly(dI)-poly(dC), 4
% glycerin) and BW5147
A similar reaction solution containing only the nuclear protein extract is prepared and reacted for 30 minutes at room temperature.

These two solutions are placed on a 4% polyacrylamide gel and electrophoresed at 10 V/cm. After 10 minutes, electrophoresis is temporarily stopped, and a total amount of 15 μl of a reaction solution containing a DNA fragment at the 5' end of 104 cpm is further loaded into the well loaded with the solution containing only the nuclear protein extract. After starting electrophoresis again and continuing electrophoresis for 2 and a half hours,
Dry the polyacrylamide gel and perform autoradiography.

From the obtained autoradiograph film, five specific bands can be seen in the lane where DNA fragments and nuclear protein extract were mixed in advance and electrophoresed, but in the electrophoresis gel, For the mixture of DNA fragments and nuclear protein extract, only one specific band was observed.

[0030] From this result, the specific bands observed in both lanes are complexes of one protein or a protein-protein complex stable in solution and a DNA fragment, and the DNA fragment and nuclear protein The four specific bands seen only in the lane loaded with the extract solution are the result of the DNA fragment and the DNA-binding protein forming a complex, and then the protein binding to the complex, resulting in the resulting DNA fragment. It turns out to be a DNA-binding protein-protein complex.

[0031]

[Effects of the Invention] As explained above, the present method for detecting DNA-binding proteins allows the detection of DNA-DNA-binding protein complexes and DNA, which have been difficult to separate until now.
- DNA-binding protein-protein complexes can be easily separated and detected.

[0032] Therefore, it can be effectively applied to the detection and identification of DNA-binding proteins, as well as to their purification.

Claims (1)

[Claims] Claim 1: A solution containing a DNA fragment labeled with a radioisotope or a fluorescent substance and a solution containing a peptide or protein that specifically binds to the DNA fragment are placed on the same lane of an electrophoresis gel. The DNA fragment and the peptide or protein are bound together in an electrophoresis gel, and after the electrophoresis is finished, the labeled DNA fragment - peptide or DNA fragment -
DNA characterized by detecting protein complexes
Methods for detecting binding proteins.