JPH04197182A - Dna coding alkaline protease ya enzyme and production of alkaline protease ya using the dna - Google Patents

Abstract

NEW MATERIAL:DNA coding alkaline protease Ya enzyme. EXAMPLE:The DNA having the amino acid sequence of formula. USE:Production of alkaline protease Ya, etc. PREPARATION:The DNA can be produced by gene recombination technique.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention provides a Ya enzyme (Japanese Unexamined Patent Publication No. 61-2802
This invention relates to a method for producing a Ya enzyme using a DNA fragment encoding the gene of No. 78) and a microorganism into which a plasmid containing the fragment has been introduced.

[Conventional technology]

Ya enzyme has excellent alkali resistance and surfactant resistance,
High p)I such that normal alkaline protease is inactivated
Even when blended into a liquid detergent, it retains its proteolytic activity and has the ability to contribute to improved detergency. Ya enzyme is Bacillus sp. Y strain (Bacillus sp.
sp.
Even if normal culture is carried out, the yield is low and calculations at an industrial level are difficult under these conditions.

Generally, in order to improve the productivity of alkaline protease produced by Bacillus, it is necessary to breed strains using mutations such as chemical substances and ultraviolet irradiation, and improve culture conditions. is being attempted. However, the degree of effectiveness varies depending on the strain or type of product, and is largely dependent on chance. Therefore, a production method that rationally and theoretically increases productivity, that is, a production method of Ya enzyme using genetic recombination technology is desired.

Furthermore, since Bacillus sp. Y strain, which is an alkalophilic bacterium, is cultured in an alkaline medium, various disadvantages such as deterioration of the nutrient source and coloration of the culture solution occur. Therefore, if it becomes possible to culture near neutrality, the culture process and purification process can be simplified, which is advantageous in industrial production.

[Problem to be solved by the invention]

In order to increase the productivity of the Ya enzyme, the conventional breeding method based on mutation treatment using seven strains of Bacillus sp. is insufficient. Therefore, the present invention provides a gene encoding a Ya enzyme that can be used to improve the productivity of the Ya enzyme by using genetic recombination technology, and a method that can improve the productivity of the Ya enzyme using the gene. The purpose is to provide

[Means to solve the problem]

By isolating the Yaa element gene from a Yaa element-producing bacterium and determining its base sequence, we also obtained a signal peptide from the promoter of the Ya enzyme gene.
The Ya enzyme is produced by introducing a DNA fragment containing the precursor region, the mature enzyme region, and the region encoding the terminator into an appropriate host bacterium, and the promoter region (hereinafter, promoter region is generally referred to as Escherichia coli). In addition to the consensus sequence defined by et. It was discovered that high production of the Ya enzyme could be achieved by substituting the promoter region derived from another gene, and the work was completed based on this knowledge.

The Yaa elementary gene according to the present invention has the base sequence and amino acid sequence shown in FIG. This sequence includes a region related to transcription and translation initiation, a precursor region, and a mature protein region, of which the amino acid sequence from residue 203 to residue 635 corresponds to the mature protein, and in the present invention, is important. In other words, according to the present invention, the above 203 to 635 (
The promoter region, secretion region, etc. located upstream of the mature enzyme region) residues are replaced with those of a gene encoding another protein by known means, and Ya
Enzymes can be produced. At this time, in the present invention, 2
A gene having a promoter region in which the bromo-multiple region located upstream of residues 03 to 635 functions strongly in Bacillus bacteria, such as the promoter region of a neutral or alkaline protease or amylase gene derived from Bacillus bacteria. By introducing the substituted DNA into a plasmid and introducing it into Bacillus bacteria, Ya enzyme can be efficiently produced by culturing in a neutral region (around pH 6 to 8).

The base sequence shown in FIG. 1 was determined by cloning the Yaa gene. The cloning method used here may be any method as long as it can clone the gene encoding the Ya enzyme. The Yaa elemental gene can be cloned by constructing a recombinant that retains the Yaa enzyme and by hybridization using NA that is complementary to the gene encoding the Ya enzyme.

Yaa-producing bacteria, such as Bacillus sp.
Purify the a enzyme, determine the amino acid sequence using Yaa elementary fragments etc. obtained by trypsin digestion as necessary, and synthesize a single-stranded oligonucleotide corresponding to a preferred amino acid sequence as a DNA probe. I can do it.

Next, chromosomal DNA is extracted from the Yaa element-producing bacteria. Any strain may be used as long as it produces the Ya enzyme, but for example, Bacillus sp.
Y stock is mentioned. The method of extracting chromosomal DNA is Cytoumiura's method (Biochim, Biop).
hs, Acta, 72. 619 (1963)).

The chromosomal DNA thus obtained was subjected to EcoRI.

Fragmented using restriction enzymes such as XbaI, subjected to agarose gel electrophoresis, and Southern hybridization (Molecular
Cloning, 2nd Edit, Cold S
pring)1arbor Laboratory P
ress, 9.31 (1989)) and D
The complementarity of the NA probes and the size of the complementary DNA fragments are determined. The restriction enzyme that digests the dyed DNA may be any other restriction enzyme. DNA probes can be labeled by using T32p-ATP.

Next, the identified DNA fragments are recovered. Any recovery method may be used, but for example, the DIEAE paper method (Molecular Cloning 2nd E
dit,,ColdSpring Harbor La
Laboratory Press, 6.24 (198
9)> can be used to recover the DNA fragment.

Furthermore, the recovered DNA fragment and vector DNA are ligated. Vector DNA that has the same restriction enzyme recognition site as the restriction enzyme that digested the DNA fragment.

For example, pBR328, pUc118, etc. are digested with the same restriction enzyme. Furthermore, after dephosphorylation with alkaline phosphatase, it can be ligated with a DNA fragment having the same restriction enzyme recognition site using T4 ligase. This reaction product was subjected to Hanahan's method (DNA cloning V
ol, 1 1RL Press, p, 109(1
It can be introduced into E. coli according to 985)).

A strain that retains the Ya enzyme gene is selected from the transformed strains. Colony hybridization method (Molecular Cloning method) is used as the selection method.
2nd Edit, Co1d Spring Ha
rbor Labor-atory Press, 1.
90 (1989)), but for example, the alkaline-3DS method (Molecular Cloning 2
nd Edit, Co1d Spring Harb
or Labor-atory Press, 1.25
(1989)), and Southern hybridization was performed in the same manner as above.
By selecting a strain carrying a recombinant plasmid complementary to the probe, a transformed strain carrying the Ya enzyme gene can be obtained.

The obtained base sequence of the Ya enzyme gene was obtained using the method of Sanger et al. (Proc, Natl, ^cad, Sci, U
SA 74°5463 (1977)). Furthermore, the amino acid sequence of the Ya enzyme can be elucidated based on the base sequence.

The DNA sequences of the present invention are not limited only to natural DNA sequences, but also include other DNA sequences encoding the amino acid sequence of the Ya enzyme revealed by the present invention.

In addition, by making artificial insertions, deletions, substitutions, etc. in the DNA sequence and amino acid sequence of the present invention, as long as the functions of the Ya enzyme such as surfactant resistance and alkali resistance, which are the characteristics of this enzyme, are not impaired. Modification is possible, and the present invention also includes such mutant genes and modified enzyme proteins.

In order to express the Ya enzyme gene, the Ya enzyme gene is introduced into a suitable host fungus. Host bacteria include Escherichia coli, Bacillus, and Pseudoionas.
Bacteria such as the genus Aspergillus
), genus Sacchar-omyce
Examples include microorganisms of the genus S) and genus Candida, but other host bacteria may also be used. For example, when Bacillus is used as a host bacterium, a vector plasmid such as pUBllo, pBD64, etc. is digested with the same restriction enzyme that digests the Ya enzyme gene without disrupting it.
This and the Ya enzyme gene are connected using T4'J gauze. This reaction product was processed using the protoplast method (S, Cha
ng, Mo1. Gen, Genet.

168.111 (1979)) into Bacillus bacteria. Contains Ya enzyme gene
A host bacterium into which DNA has been introduced is cultured, and Ya
Get the enzyme. Confirmation of the expression of the Ya enzyme and its expression level can be carried out by Western blotting, measurement of proteolytic ability, etc.

In order to increase the productivity of the Ya enzyme, the productivity can be increased by replacing the promoter region with a promoter region that is efficient for the host bacterium. For example, when a bacterium of the genus Bacillus is used as a host, a promoter region of a neutral or alkaline protease gene, a promoter region of an amylase gene, etc. derived from a bacterium of the genus Bacillus are convenient. For example, the promoter region derived from the Ya enzyme gene is extracted from Bacillus licheniformis.
Replace with the promoter region of the derived amylase gene. Then, for example, a restriction enzyme recognition site, such as a Bcll recognition site, is created in the rear part of the promoter region using site-specific mutagenesis, and the promoter region is excised using restriction enzymes and ligated using T4 ligase. By doing so, promoter regions can be exchanged. Furthermore, the Ya enzyme gene with the promoter region exchanged was transferred to Bacillus subtilis (Bacillus 5ubt).
ilis) and cultured to produce the Ya enzyme. This makes it possible to increase productivity compared to the case where the promoter region derived from the original Ya enzyme gene is used.

Ya with the promoter region exchanged by the method shown above
Extremely high productivity of the Ya enzyme can be obtained using Bacillus subtilis carrying a plasmid containing the enzyme gene.

The above-mentioned Bacillus subtilis may be grown in any medium as long as the above-mentioned Bacillus subtilis can grow, but for example, the carbon source is glucose, starch, molasses, etc., and the nitrogen source is peptone, polypeptone 81 soybean flour, corn staple liquor, etc. Furthermore, the culture can be carried out at a temperature of 30 to 40° C. for 50 to 100 hours using a medium containing minerals and the like. In addition, anion exchange chromatography from culture
Ya enzyme can be purified by gel filtration or the like.

The present invention will be explained in more detail with reference to Examples below, but the present invention is not limited thereto.

〔Example〕

Example 1 Southern Hybridization The amino acid sequence of the N-terminal region of Ya enzyme was determined using Protein Sequencer 377A manufactured by Applied Biosystems (ABI).

The results were as shown below.

N'-AsnAspValAlaArgGlylle
ValLysAlaAspValAlaGlnAsnA
In order to analyze the amino acid sequence of the central to C-terminal region of the snTyrGly Ya enzyme, a similar operation was performed using a sample obtained by trypsin digestion. The results are shown below.

N'-LysTyrAlaTyrMetGlyGly
ThrSerMetAlaThr From these analysis results, the following oligonucleotide DN was prepared using the inosine method.
A was produced using a DNA synthesizer 381A manufactured by ABI.

AT Probe N: 5' CCATA TT TT TGI
GCIACATCIGC3'GC T Probe C: 5' GTICCICCCATATAI
GCTA TT 3'C The 5' end of the above probe was labeled with 32p using r-''P-dATP (manufactured by Amajam) and T4 polynucleotide kinase (manufactured by Takara Shuzo).

Bacillus sp. Y strain was inoculated into a Sakaro flask containing 200-ml broth medium (Kyokuto Seiyaku Co., Ltd.) containing 310 g/l of NazC, and cultured overnight at 30°C. 2g of bacterial cells
and chromosomal DN according to Saitoumiura's method.
2.8 mg of A was prepared.

This DNA10/Jg was digested with EcoRI (all restriction enzymes were manufactured by Takara Shuzo) or XbaI, subjected to agarose gel electrophoresis, and Southern hybridization was performed using probe N prepared previously.

As a result, a DNA fragment of approximately 2.8 bp hybridized with the chromosomal DNA fragment digested with EcoRI, and a DNA fragment of approximately 1.2 Kbp hybridized with the fragment digested with Xbal. Furthermore, when the same operation was performed for probe C, it was found that the chromosomal DNA fragment digested with EcoRI was about 2. A DNA fragment of OKbp and a DNA fragment of approximately 1.2 Kbp hybridized with the fragment digested with XbaI.

Cloning 200 μg of the aforementioned chromosomal DNA was digested with EcoRI and subjected to agarose gel electrophoresis to obtain approximately 2.8 Kbp DNA.
20 μg of the A fragment was recovered using the DEAE paper method. Also about 2. The same operation was performed for the OKbp DNA fragment, and 20 μg was recovered. Chromosomal DNA 200
Digest μg with Xbal and perform the same operation to obtain approximately 1.2
10 μg of Kbp DNA fragment was recovered. pBR328
(manufactured by Boehringer) 1 μg was digested with EcoRI, dephosphorylated with alkaline phosphatase (manufactured by Boehringer), phenol extraction was performed, that is, protein denaturation was performed by adding a mixture of phenol and chloroform (1:1), and Tsuchiura was collected after centrifugation. I performed the following operation. Furthermore, ethanol precipitation, that is, 0.1 times the amount of 3M sodium acetate (pH 4
, 8) and twice the amount of ethanol, and after cooling at -80°C for 10 minutes, DNA was recovered by centrifugation.

Of this, 0.2 μg and the aforementioned approximately 2.8 Kbp Eco
0.05 μg of the RI fragment was ligated using a ligation kit (manufactured by Takara Shuzo). This reaction product was introduced into E. coli strain H8101 according to Hanahan's method. Arca! from 500 grown transformants. D using J-3DS method
NA was extracted and Southern hybridization was performed using the probe N described above. As a result, the plasmid pYTlol hybridizes with probe N (Figure 2)
and obtained a bacterial strain that carries the plasmid. Furthermore, the same operation was performed on the approximately 2 Kbp EcoRI fragment using the probe C described above.
Plasmid pYB2 that hybridizes with (Figure 3)
and obtained a bacterial strain that carries the plasmid. In addition, 1 μg of pUC118 (manufactured by Takara Shuzo Co., Ltd.) was added to XbaI.
After digestion with alkaline phosphatase and dephosphorylation with alkaline phosphatase, phenol extraction and ethanol precipitation were performed. Of these, 0.2
μg and 0.05 μg of the approximately L 2 Kb XbaI fragment described above.
g was ligated using a ligation kit, and the same operation was performed using probe N. As a result, a plasmid pYX1 (Fig. 4) that hybridized with probe N was found, and a strain carrying this plasmid was obtained.

Determination of base sequences Obtained plasmids pYT101, pYB2 and pYX
pUc118 and pUc1
19 (manufactured by Takara Shuzo Co., Ltd.), and one-stack DNA was prepared according to the manual manufactured by Takara Shuzo Co., Ltd. This one
Heavyweight DNA and α-3SS-acrpi manufactured by Amajam>
37 T B q /mmol) and S[EQUEN
The base sequence was determined using ASε (manufactured by Toyobo Co., Ltd.). The resulting nucleotide sequence is shown in FIG. 21
The amino acid sequence elucidated from the open reading frame existing from 8 bp to 2122 bp includes sequences from residues 203 to 448 that match the amino acid sequence confirmed by the amino acid sequence analysis using the propene sequencer of the Ya enzyme mentioned above. It can be found from the residue order. Furthermore, since the N-terminus begins at the 203rd residue, it is determined that the region from the start of translation 1 to the 202nd residue is a precursor region, and the region after the 203rd residue is a region constituting the mature enzyme.

Example 2 Promoter acquisition Bacillus reichenformis strain LB8907 was inoculated into a Sakalo flask containing 200-mL broth medium, cultured overnight at 30°C, 1 g of bacterial cells was obtained, and chromosomes were extracted according to the method of Cytoumiura. 2.0 μl of DNA was prepared. Of this, 50 μg was digested with EcoRI, treated with phenol, and precipitated with ethanol. 1 μg of pUc118 was digested with EcoRI, dephosphorylated using alkaline phosphatase, treated with phenol, and precipitated with ethanol.
Of these, 0.2 μg and 0 EC0RI fragments of chromosomal DNA
．． 05 μg was ligated using a ligation kit, and the reaction product was transformed into E. coli JMI 09 according to Hanahan's method.
introduced into the stock. The grown transformants were grown in L medium containing 1% sweet potato starch (manufactured by Junsei Kagaku Co., Ltd.) (Batato Tributone Log/I, Bacto Yeast Extract 5g/L Na(
15g/L Bacto Agar 20g/L, Ampicillin 1
The cells were inoculated at 0.01°/1° pH 7.2) and cultured at 37°C for about 40 hours.

As a result, one strain that degrades starch, that is, has an amylase gene, was obtained from 2000 transformants. Plasmid pTA1 carried by this strain (Figure 5)
The base sequence of the promoter region of was determined according to Example 1, and the results are shown in FIG.

Construction of plasmid capable of expressing Ya enzyme Plasmid pY
82 50μg was incubated with EcoRI and 5phI and DE
A DNA fragment of approximately 2 Kbp was recovered using the AE paper method. Among them, 0.0bpg and EcoRI
After digestion with 5phI, dephosphorylation using alkaline phosphatase, phenol treatment, and ethanol precipitation, 0.2 μg of recovered pUc118 was ligated using a ligation kit. This reaction product was introduced into Escherichia coli JMI O9 strain according to Hanahan's method. A strain carrying pUC118ES shown in FIG. 7 was obtained from the grown transformants. 50μg of pYTiol
Digested with coRI and using the DEAE paper method to approximately 2.7
A bp-DNA fragment was recovered. Of which 0.0bp
pUc118E30.2μ, which was previously digested with EcoRI, dephosphorylated using alkaline phosphatase, treated with phenol, and precipitated with ethanol.
g were ligated using a ligation kit. This reaction product was introduced into Escherichia coli JM109 strain according to Hanahan's method, and the pTB shown in Figure 7 was selected from the grown transformants.
A strain retaining 3 was obtained.

The DNA probe shown below (corresponding to 1181-1210bp in Figure 1) was synthesized using ABI DNA synthesizer model 381A, and 5'-CCAAGAGTTAGTATGGATTCT
TGCTCCAGC-3' Site-directed mutagenesis kit (manufactured by Takara Shuzo Co., Ltd.) Using Mutan-K, the base sequence of the Ya enzyme of pTB3 was modified without changing the amino acid sequence, and EcoR
A plasmid pTB3E in which position IiB was deleted was obtained. Furthermore, the DNA probe shown below (200-
corresponding to 229 bp) and synthesized 5'-TTTCCCCTTCATTGATCATCA
A plasmid pT83EB was obtained in which the base sequence was modified in the same manner as in ACTCCCTCAT-3' and a BclI recognition site was created upstream of the Ya enzyme translation start codon.

In addition, we synthesized the DNA probe shown below (2 in Figure 6).
(corresponding to 16-245bp) and synthesized 5'-TGTT
GTTTCATGATCATCCTCCCCTTTCA
The base sequence of pTAI was modified in the same manner as A-3' to create a plasmid pTAIB having a Ba11 recognition site downstream of the promoter region.

pUc118 1JJg was digested with EcoRI to yield 7JL.

After dephosphorylation with calyphosphatase, phenol treatment and ethanol precipitation were performed and the product was recovered. Of this, 0.2 μg was ligated to pU81100.0 bpg, which had been previously digested with EcoRI, treated with phenol, and precipitated with ethanol, and recovered using a ligation kit. This reaction product was introduced into Escherichia coli JMI 09 strain according to Hanahan's method. A strain carrying plasmid pUB81 shown in FIG. 8 was obtained from the grown transformants. pTB3E
After 5 μg was digested with EcoRI, treated with phenol, and precipitated with ethanol, the ends of the DNA were blunted using Flenow fragment (manufactured by Takara Shuzo).

Furthermore, phenol extraction and ethanol precipitation were performed, and 0.2 μg of this was ligated to 5phI linker (manufactured by New England Biolab) using a ligation kit. This reaction product was introduced into E. coli JMI O9 strain using Hanahan's method.

Among the grown transformants, a strain carrying the plasmid pT83ES (Fig. 8) in which the Sph I #Il tissue site was newly created was obtained. pTB3E3 50μg
4. was digested with 5phI using the DEAE paper method.
A 6 bp DNA fragment was recovered. This DNA fragment 0.
0 bpg, digested with S ph I, extracted with phenol,
10.2 μg of ethanol-precipitated pUB8 was ligated using a ligation kit. This reaction product was introduced into Bacillus subacillus 1012 strain using the protoplast method. Among the grown transformants, a strain carrying the plasmid pHB8Y shown in FIG. 8 was obtained.

50 μg of pTAIB was digested with EcoRI and BclI, and a DNA fragment of approximately I Kbp was recovered using the DEAE paper method. 81 μg of pT83E was treated with EcoRI and B
After digestion with clI and dephosphorylation with alkaline phosphatase,
It was recovered by phenol extraction and ethanol precipitation. Of this, 0.2 μg and the above pTAIB-derived IKbpD
0.05 μg of the NA fragment was ligated using a ligation kit.

This reaction product was extracted into Escherichia coli JM109 according to Hanahan's method.
introduced into the stock. Among the grown transformants, a strain carrying plasmid pAY1 shown in FIG. 9 was obtained.

50 μg of pAYl was digested with S ph I and then with Xmn I to separate the 7 fragments on the vector side.
A DNA fragment of approximately 3.5 Kb was recovered using the EAE paper method. Digest 1 μg of pU881 with 5 phl, dephosphorylate with alkaline phosphatase, and extract with phenol.
It was recovered by ethanol precipitation.

Of these, 0.2μg and 3.5K derived from pAY1 mentioned above.
b 0.05 μg of DNA fragments were ligated using a ligation kit. This reaction product was introduced into Bacillus subacillus 1012 strain using the protoplast method. Among the grown transformants, plasmid pUB8 shown in FIG.
A strain containing A was obtained.

Expression of Ya enzyme A transformant of Bacillus subacillus 1012 strain carrying pUBllo and pUB8YSpUB8A was cultured in a medium with the composition shown below (90 g/l of soluble starch, 50 g/l of polypeptone S (manufactured by Daigo Nutrition Co., Ltd.), and 45 g/l of 2HPO. 5Mg
The cells were inoculated into a Sakaro flask containing 5O<-7H200, 2g/L kanamycin sulfate 50/I, pH 7.5) and cultured at 33°C for 90 hours. The alkaline protease activity of the culture supernatant was determined by the modified Anson-Hagiwara method (t (agiwa
ra, B,, J.

Biochem, 45. 188 (1958)
). i.e. 35°C, pH 10.5
The amount of enzyme that releases an amount equivalent to 1 μg of tyrosine in 1 minute after reacting for 10 minutes under the following conditions was defined as 1 alcoholic lipoprotease unit (APU). Table 1 shows the results of alkaline protease activity of each culture supernatant. The production amount of alkaline protease of the transformant carrying pUB8Y is pUBll
The pU
The transformant carrying B8A showed approximately 30 times higher Ya enzyme productivity than the transformant carrying pU88Y.

Table 1 AP[I/rnl Bacillus subtilis1012 (pUB
8Y) 850 (pUB8A) 25400 (pLIBllo) 320

[Brief explanation of the drawing]

FIG. 1 shows the base sequence and the corresponding amino acid sequence of the structural gene region of the Ya enzyme gene. Figure 2 shows plasmid pYT10, which retains the N-terminal side of the structural gene and promoter region of the Ya enzyme gene.
1 is a restriction enzyme cleavage map of No. 1. FIG. 3 is a restriction enzyme cleavage map of plasmid pYB2 which retains the C-terminal side of the structural gene and the terminator region of the Ya enzyme gene. FIG. 4 is a new restriction enzyme map of plasmid pYX1 which retains the central portion of the structural gene of the Ya enzyme gene. Figure 5 shows plasmid pT carrying the amylase gene isolated from Bacillus reichenformis LB8907.
This is a restriction enzyme cleavage map of A1. FIG. 6 shows the nucleotide sequence near the promoter region of the amylase gene isolated from Bacillus reichenformis LB8907 and the corresponding amino acid sequence. FIG. 7 is a diagram showing the production process of plasmid pTB3 in which the Ya enzyme gene regions of pYTlol and pYB2 are linked. FIG. 8 is a diagram showing the production process of plasmid pU88Y, in which the Ya enzyme gene region of pTB3 was linked to plasmid pUBIIO, which can be replicated in Bacillus bacteria. FIG. 9 is a diagram showing the process for producing plasmid pUB8A, in which the promoter region of the Ya enzyme gene of pTB3EB was replaced with the promoter region of the amylase gene of pTAIB, and the resulting product was ligated to plasmid pUB110, which can be replicated in Bacillus bacteria. Ba: BamHI Bc: BclIB
g: BglI I C: C1aIE:
EcoRI H: Hinc I IK
:KpnI P-nee PstIS
: 5phI Xb :XbaIXm:X
mn1 to P: alkaline phosphatase MC3: multiple cloning site Apr: ampicillin resistance gene 'l'c': tetracycline resistance gene ori: replication region. Elbow (B) E Ba C
GATTATTAAAAAGCTGAAAGCAAAAA
GGCTATCAATTGGTAACTGTATCT<
:A GCTTGAA GAAGTG AAGAACG
AGAGAGGG CT ATTG AATA AAT@
GA GTA GAAAGCGCCATATCGCTTTTTCT TT
TGGA AGAAAAT ATAGGGA AAAT
GGTATTTGT TAA`A etLys ATTCTGAA TATTTAT ACAATAT
CATATGTTTCACATTGAAAGGGGAG
G AGAATCA TGA`A G I nG l nLysA rgLysTy rA
I aA rgLeu LeuP roLeu Le
u PheA I aLeu@l l ePheLeu
Leu CAACAAAAAACGG(TT TACGCCCGA
TTGCTGCCGCT GTTATTT GCGCT
CATCTT (:T TGCs G ProllisSerAIa CCTCATTCTGCA 301 3+2 Procedural Amendment - Companion) 1. Display of the case Patent Application No. 327110 of 1990, Person making the amendment Relationship to the case Applicant name (676) Lion Co., Ltd. 4, Agent 5, Date of amendment order March 12, 1991 attached Amended as per '2/I[=]sa,■, Indication of case 1990 Patent Application No. 327110 3, Person making the amendment Relationship with the case Applicant name (676) Lion Corporation 4, Agent 5 , Date of amendment order Motto 6. Subject of amendment Column section of detailed explanation of the invention in the specification (1) The following parts of the specification are amended as follows. (2) Figure 1 of the drawings - Figures 6 and 9 will be corrected as shown in the attached sheet.

Claims (9)

[Claims] (1) DN encoding alkaline protease Ya enzyme
A. (2) The DNA according to claim 1, which is specified by the following amino acid sequence. [There is a gene sequence] [There is a gene sequence] (3) D according to claim 1, which is specified by the following DNA sequence:
N.A. [There is a gene sequence] (4) Upstream of the DNA of claim 1 or 2, there is a 5' nucleotide related to the transcription and translation of a neutral or alkaline protease gene.
The DNA according to claim 1, which has an untranslated region at the end or an untranslated region at the 5' end for transcription and translation of the amylase gene. (5) Plasmid DNA containing DNA encoding the alkaline protease Ya enzyme according to any one of claims 1 to 4. (6) A microorganism into which the plasmid DNA according to claim 5 has been introduced. (7) The microorganism according to claim 6, wherein the microorganism is a bacterium belonging to the genus Bacillus. (8) A method for producing alkaline protease Ya, which comprises collecting alkaline protease Ya from a culture by culturing the microorganism according to claim 6 or 7. (9) The production method according to claim 8, wherein the microorganism is a bacterium belonging to the genus Bacillus and is cultured in neutral conditions.