JPH04187100A - Detection of nucleic acid - Google Patents

Abstract

PURPOSE:To detect the subject nucleic acid in improved accuracy such as detection sensitivity by reacting a specimen nucleic acid with a probe nucleic acid, labeling the reaction product, adding an alcohol and recovering the precipitate, thereby enabling effective separation of the nucleic acid with extremely simple method. CONSTITUTION:A specimen nucleic acid is made to react with a probe nucleic acid in a liquid medium. The hybrid formed in the reaction liquid is exclusively labeled, an alcohol (preferably isopropyl alcohol or ethyl alcohol) is added to the reaction liquid to recover the precipitated nucleic acid in a state separated from unreacted labeled material and the objective nucleic acid is detected by utilizing the labeled hybrid existing in the recovered nucleic acid.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a nucleic acid detection method useful for detecting or quantifying nucleic acids obtained from viruses, microorganisms, animals, plants, etc. with high sensitivity.

[Prior Art 1] Various hybridization methods using a labeled probe nucleic acid capable of forming a base pair with a target nucleic acid (nucleic acid to be detected) are known as methods for detecting nucleic acids.

As a typical method, for example, a sample is reacted with a labeled probe nucleic acid in a state immobilized on a filter as a support, a hybrid is formed in a state immobilized on the support, and unreacted labeled probe is removed by washing. This is a widely used method for separating and detecting.

Analysis using a nucleic acid hybridization reaction using a conventional filter as a support requires a series of operations: fixation of the nucleic acid in the specimen sample, hybridization, hybridization with a labeled probe, washing, and detection. However, since it takes time to obtain analytical results, it is not suitable for routine use in clinical experiments, for example.

In particular, the operations of baking, prehybridization, and washing in the immobilization of nucleic acids are complicated and cause an increase in the time required for analysis.

[Lin et al.: Journal of
Virology, Vol, 55゜509 pages
(1985)].

In addition, in hybrid formation on a filter, the reaction between the single-stranded nucleic acid in the solid phase and the single-stranded labeled probe in the liquid phase is carried out in a non-uniform state in solution, so the rate of hybrid formation may vary. It has the problem of being slow. Moreover, the hybridization efficiency is extremely low, and usually only a few percent of the calculated expected value of the added labeled probe is used for hybridization.

Furthermore, nucleic acid analysis methods using this filter as a support have a problem of low sensitivity and accuracy.

In view of the above, recently, attention has been paid to the application of hybridization methods to nucleic acid detection methods in which a sample nucleic acid and a probe are reacted in a solution without immobilizing the nucleic acid.

As a method using such hybridization in a non-fixed state, a sandwich hybridization method is described in US Pat. No. 4,486,539. In this method, two separate probes are used. One is a detection probe that is labeled and used for detection, and the other is a capture probe that is immobilized on a solid support to separate the target nucleic acid from the reaction mixture. In this method, a reaction between a sample and a detection probe is carried out in a solution in an unimmobilized state, and the resulting reaction mixture is brought into contact with a solid support on which a capture probe is immobilized to detect the target nucleic acid.
The probe hybrid is captured on a solid support, separated from unreacted detection probe, and detected.

Furthermore, British Patent Application Publication No. 2169403 discloses a method using two different probes (a detection probe and a capture probe) coexisting in the same liquid phase. The detection probe is labeled with a detectable label, and the capture probe has a portion that has an affinity for the capture means. After hybridization,
The hybrid formed by the capture probe, target nucleic acid, and detection probe is separated from the hybridization solution by utilizing the affinity between the capture probe and the capture means.

[Problem to be solved by the invention] Since the method described above uses two probes, namely a labeled probe for detection and a capture probe, both of them are prepared separately and used for capture and detection, respectively. Requires processing to function.

Another possibility is to prepare a type of probe, use part of it for capture, and label the other part, but this also avoids the complexity of having to perform separate processes for capture and labeling. do not have.

In addition, the formation of a capture probe in the conventional method is generally performed by modifying the nucleotide chain necessary for capture. However, this modification affects hybridization and causes a lack of accuracy. Furthermore, although this modification for capture generally requires the use of a somewhat long probe, the longer the nucleotide chain of the probe, the more likely mismatches will occur, making it difficult to detect site-specific displacements that occur in relatively short regions. In some cases,

Furthermore, when the capture probe is immobilized on the capture means by utilizing the affinity between the capture probe and the capture means, such as by utilizing the binding of biotin and avidin, there are many variations depending on the conditions in the capture reaction. . Furthermore, in the method using two types of probes described above, the capture efficiency of a hybrid consisting of a target nucleic acid and a detection probe is determined in two stages: the binding stage of the hybrid and the capture probe, and the binding stage of the capture probe and the capture means. defined by their respective coupling efficiencies. That is, the capture efficiency through these steps is multiplied by their respective binding efficiencies, which inevitably results in lower efficiency than a reaction consisting of a single binding step.

Therefore, even the method using the two types of probes described above is still unsatisfactory in terms of operational complexity and sensitivity.

An object of the present invention is to provide a method for detecting nucleic acids that solves the above-mentioned conventional problems and has extremely simple steps, and furthermore, a method for detecting nucleic acids that is useful for highly sensitive nucleic acid detection or quantitative methods.

[Means for solving the problem] The nucleic acid detection method of the present invention includes a process of reacting a sample nucleic acid with a probe nucleic acid and detecting the presence or absence of formation of a target nucleic acid/probe nucleic acid hybrid in the resulting reaction mixture. A nucleic acid detection method comprising: a) a step of reacting a sample nucleic acid and a probe nucleic acid in a liquid medium; b) a step of labeling only the hybrid formed in the reaction solution obtained in step a; C) A step in which the nucleic acid is precipitated and recovered by adding alcohol to the reaction solution that has passed through step C, and separated from unreacted labeled substances; d) A step in which the labeled hybrid contained in the nucleic acid recovered in step C is separated. It is characterized by comprising the steps of detecting using a label applied to the hybrid.

As the probe nucleic acid (hereinafter simply referred to as probe) to be reacted with the sample nucleic acid in step a of the method of the present invention, any nucleic acid can be used as long as it has a base sequence that can effectively hybridize with the nucleic acid to be detected.

Since the probe in the present invention is used without being labeled, there is no requirement for labeling the probe. As a result, short nucleotide chains can be used, which are easy to obtain and do not easily cause mismatches, allowing for highly sensitive detection. can be done.

When selecting a probe, in the process described below, the probe constituting one nucleotide strand of the double-stranded portion of the hybrid is used as a primer, and the nucleotide strand is extended from its end using the nucleotide strand of the nucleic acid to be detected as a template. When a labeling method is used in which a labeling substance is incorporated into the extending portion of the probe, the hybrid formed is a template in which the nucleotide strand of the nucleic acid to be detected that has hybridized with the probe is used as the template for the extension of one end of the brimer. The probe is selected so that it can function as a probe, that is, the nucleotide chain of the nucleic acid to be detected exists in a single-stranded state in the direction in which the end of the probe extends.

Note that, depending on the case, the sample nucleic acid may be used as a primer.

Hybridization between a sample nucleic acid and a probe can be performed according to a conventional method.

The conditions for the hybridization reaction vary depending on the nucleotide chain length and base sequence of the probe used, so the operating conditions for hybridization should be appropriately selected depending on the desired purpose.

This hybridization reaction can generally be carried out in a hybridization solution containing formamide, an appropriate salt, and Denhardt's solution, with the sample nucleic acid and probe in an unimmobilized state, and the temperature controlled.

In the method of the present invention, a sample nucleic acid and a probe are reacted, and the resulting hybrid is selectively labeled during processing.

As a method for this labeling, for example, one of the strands constituting the double-stranded portion of the hybrid is used as a primer,
When extending the end to make the single-stranded part double-stranded,
A method of incorporating a label into the newly synthesized extended portion can be used.

According to this method, since a non-hybridized nucleic acid does not have a portion that functions as a primer for forming a new double-stranded portion and a portion that serves as a template for forming an extended portion, the above-mentioned labeled No double-stranded reaction takes place.

Therefore, even if this labeling reaction is performed in a mixture of non-hybridized nucleic acids and hybrids, only the hybrids can be selectively labeled.

For this labeling, various methods can be used to synthesize a new double-stranded portion using a primer.

For example, dATP, d, required for extension of one end of the blima,
A nucleotide such as CTP, dGTP, or dTTP is reacted with a hybrid to be labeled in the presence of an enzyme for forming a nucleotide chain, and a labeled nucleotide is used as one or more of the nucleotides used at that time to form a new hybrid. A method of incorporating a label into a nucleotide chain can be used.

This labeled nucleotide may be one that is generally used to label nucleotides, such as one labeled with a radioactive isotope, such as biotin, a dinitrophenyl nucleotide conductor, etc. that is necessary to induce fluorescence, luminescence, or color development. Those labeled with non-radioactive labeling substances such as enzymes and compounds can be used.

Enzymes for forming nucleotide chains include Escherichia coli DNA polymerase ■, Klenow fragment of DNA polymerase ■,
Various DNA polymerases such as T, DNA polymerase, reverse transcriptase, etc. can be used.

Labeling in the present invention is carried out by appropriately diluting the reaction solution obtained in step a, adding each component for labeling to this, and dissolving or dispersing each component in a solvent. be able to.

Next, the nucleic acid is precipitated and recovered from the reaction solution labeled in Step C, and separated from the label remaining in the liquid medium.

For this precipitation treatment, a precipitation method using alcohol such as isopropyl alcohol or ethyl alcohol can be used.

If the sample contains the nucleic acid to be detected, the nucleic acid precipitate obtained by the precipitation treatment will contain the labeled hybrid.

This precipitate is separated by solid-liquid separation treatment such as centrifugation or filtration.
It is separated from the reaction solution, washed if necessary, and the labeled hybrid is detected by a method depending on the label used (step d). Particularly preferably, separation is performed by centrifugation.

In addition, in the method of the present invention, in order to ensure that the length of the double-stranded part newly synthesized by extension of the end of the nucleic acid that becomes the primer in the above-mentioned labeling operation is sufficiently long,
By considering the combination of probes for the nucleic acid to be detected and using them, it is possible to increase the amount of label uptake during labeling, and even when using non-radioactive labels, the low sensitivity can be compensated for by the large amount of uptake. is possible,
Highly sensitive detection becomes possible.

In detecting this labeled hybrid, the nucleic acid to be detected can be quantified by quantitatively analyzing the amount of label possessed by the formed hybrid.

[Example] Example 1 A 41-mer oligonucleotide having the following DNA base sequence constituting a part of plasmid pUc19 was synthesized using a DNA synthesizer (ABI, Model 381A).

5゛ 3゜GAT
CGCCCTTCCCCAACAGTTGCGCAGCC
Using part of the TGAATGGCGAATG compound, 7M
When its purity was examined by electrophoresis on a 15% polyacrylamide gel containing urea, it was determined to have a purity of 90% or more, so this compound was used directly without purification.

On the other hand, plasmid pBR322 (sample A) and plasmid pUc19 (sample B) were prepared as sample nucleic acids, and these samples were subjected to E co RI (TO
(manufactured by YOBO), the resulting digest was heat-treated to convert the double-stranded DNA into single-stranded DNA, and the reaction products containing two types of single-stranded DNA obtained from each sample were individually separated. The following operations were performed using

Put 20 μg of the reaction product containing single-stranded DNA and the previously prepared probe (1.0 μg) into a test tube, and add 10
x annealing solution [1 x annealing solution: 60m
M MgC1z, 100mM Tr containing 60mM β-mercaptoethanol and 500mM NaC1
is-HCI (pH 8,0) (7) 10 LLf2
was added, and distilled water was added so that the total strength was 100 LLI2.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, 10% of the IOX annealing solution was added to the obtained reaction solution.
μg, 1mM dATP 10LLI2.1mM
dCTP 10μff and 1mM dGTP10
After adding μn and t, p32-TTP 100 Ci
A solution for labeling was prepared by adding 200 μC to the total volume with distilled water.

Five units of Klenow fragment (manufactured by TOYOBO) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction, in order to separate the DNA and unreacted p''-TTP, isopropyl alcohol at 200 μC was added to the reaction solution, cooled at -70 °C for 1 hour, and the supernatant was discarded by suction. At the same time, unreacted p32-TTP was removed.The intensity of the precipitate was measured using a scintillation counter.
The intensity of the sample from pBR322 was about twice that of the background, and there was a marked difference between the two.

Comparative Example 1 Nucleic acid was detected by a conventional method using a detection probe and a capture probe as follows, and the detection sensitivity was compared with Example 1.

Using a DNA synthesizer (ABI, Model 381A), two types of 41mer oligonucleotides A and B, which are used as a detection probe and a capture probe, respectively, and have the following DNA base sequences that constitute a part of plasmid ptJc19 were prepared. Synthesized.

A: 5' 3・GAT
CGCCCTTCCCCAACAGTTGCGCAGCC
TGAATGGCGAATGB: 5゛ 3・GCG
GTGGTTTTTTTTGTTTGCAAGCAGCA
Using part of the GATTACGCGCAGA compound, 7M
When its purity was examined by electrophoresis on a 15% polyacrylamide gel containing urea, it was determined to have a purity of 90% or more, so this compound was used directly without purification.

Oligonucleotide B used as a capture probe is
In order to function as a capture probe, a relay (Ri
ly) [DNA 5(4), 333p.
-337p (1986), terminal transferase (Promega, Biotech
Biotin-dTJTP is bound to its 3° end by
Bio11-dUTP (manufactured by Bethesda Research Laboratories (BRL)) was bound to the probe to form a capture probe.

On the other hand, plasmid pBR322 (sample A) and plasmid pUc19 (sample B) were prepared as sample nucleic acids, and these samples were subjected to E co RI (TO
(manufactured by YOBO), the resulting digest was heat-treated to convert the double-stranded DNA into single-stranded DNA, and the reaction products containing two types of single-stranded DNA obtained from each sample were individually separated. The following operations were performed using

20μg of the reaction product containing single-stranded DNA and oligonucleotide A as the detection probe (1.0μg) prepared earlier were placed in a test tube, 10μ℃ of 10X annealing solution was added thereto, and the whole was further heated to 100μC. Distilled water was added to bring the temperature to ℃.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, add 10× annealing solution to the obtained reaction solution.
μ℃, 1mM dATP 10μβ, 1mM d
CTP 10g4 and 1mM dGTPl 0u (
After adding p32-TTPI○OC'i,
A solution for labeling was prepared by adjusting the total amount to 200 μβ with distilled water.

Five units of Klenow fragment (manufactured by TOYOBO) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction, the previously prepared capture probe (1.0ug
) was added and the mixed solution was heated to 65°C for 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

After the annealing reaction of the capture probe, unreacted p”-TT
In order to remove P, gel particles (about 5 mm in diameter) that had been subjected to the following treatment were mixed into this solution. Gel grains are made by cutting agarose gel into pieces, the surface of which is activated with cyanogen bromide and then combined with avidin. These gel particles were mixed with the previous solution for 20 minutes. At this time, biotin bound to the 3° end of the capture probe specifically binds to avidin on the surface of the gel particles.

Thereafter, it was briefly centrifuged and the supernatant was discarded. After washing twice with TE buffer, the intensity of the precipitate was measured using a scintillation counter, and the sample from pUC19 was 1106.
The intensity of the sample from pBR322 remained less than twice that of the background, showing a significant difference.

Example 2 A 41-mer oligonucleotide having the following DNA base sequence constituting a part of plasmid pU'C19 was synthesized using a DNA synthesizer (ABI, Model 381A).

5° 3°GAT
CGCCCTTCCCCAACAGTTGCGCAGCC
Using part of the TGAATGGCGAATG compound, 7M
When its purity was checked by electrophoresis on a 15% polyacrylamide gel containing urea, it was determined to have a purity of 90% or more, so this compound was used directly without purification.

On the other hand, plasmid pBR322 (sample A) and plasmid pUc19 (sample B) were prepared as sample nucleic acids, and these samples were subjected to E co RI (TOY
(manufactured by OBO), the resulting digest was heat-treated to convert the double-stranded DNA into single-stranded DNA, and the reaction products containing two types of single-stranded DNA obtained from each sample were individually separated. The following operations were performed using

Put 20 μg of the reaction product containing single-stranded DNA and the previously prepared probe (1.0 μg) into a test tube, and add 10
× Annealing solution [1× Annealing solution: 60m
M MgC12, 100mM Tri containing 60mM β-mercaptoethanol and 500mM NaCl
5-HCI (pH 8,0)] was added, and distilled water was further added so that the total amount was 100 uβ.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, add 10× annealing solution 10× to the obtained reaction solution.
μβ, 1mM dATP 10μn, 1mM d
CTP 10LLj2 and 1mM dG, TP10
ALI2. p32-TTP 100 Ci
was added, and the entire amount was adjusted to 200ALβ with distilled water to prepare a solution for labeling.

Five units of Klenow fragment (manufactured by TOYOB'0) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction, in order to separate the DNA and unreacted p32-TTP, isopropyl alcohol at 200 μC was added to the resulting reaction solution, cooled at -70 °C for 1 hour, and then centrifuged (TOMY MR15015,00 Or, p , m
), unreacted p32-'r'rp was removed together with the supernatant. Next, after washing twice with 70% ethanol, the intensity of the precipitate was measured using a scintillation counter. The sample from pUc19 showed an intensity of about 108 to 1109 Cp, and the sample from pBR322 showed an intensity twice that of the background. However, there was a significant difference between the two.

Example 3 A 41-mer oligonucleotide having the following DNA base sequence constituting a part of plasmid puc 19 was synthesized using a DNA synthesizer (ABI, Model 381A).

5° 3GAT
CGCCCTTCCCCAACAGTTGCGCAGCC
Using part of the TGAATGGCGAATG compound, 7M
When its purity was examined by electrophoresis on a 15% polyacrylamide gel containing urea, it was determined to have a purity of 90% or more, so this compound was used directly without purification.

On the other hand, plasmid pBR322 (sample A) and plasmid pUc19 (sample B) were prepared as sample nucleic acids, and these samples were subjected to E co RI (TO
(manufactured by YOBO), the resulting digest was heat-treated to convert the double-stranded DNA into single-stranded DNA, and the reaction products containing two types of single-stranded DNA obtained from each sample were individually separated. The following operations were performed using

Put 20 μg of the reaction product containing single-stranded DNA and the previously prepared probe (10 μg) into a test tube, and add 10×
Annealing solution [1x Annealing solution: 60mM
100mM Tri 5-I containing MgCl2.60mM β-mercaptoethanol and 500mM N5C1
C1 (pH 8,0)] at 10μ℃, and then the whole
Distilled water was added to give a concentration of 00 μρ.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, add 1 part of IOX annealing solution to the obtained reaction solution.
otLa, 1mM dATP 10μn, 1mM
dCTP 10ufi and 1mM dGTP 1
After adding 0 μfl, 1:) 32-TTP 100 C
A solution for labeling was prepared by adding i and making the total volume 200 μρ with distilled water.

Five units of Klenow fragment (manufactured by TOYOBO) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction is complete, 5001 ml of ethanol is added to separate DNA and unreacted p32-TTP. Add Lβ to the resulting reaction solution, cool it at -70°C for 1 hour, and centrifuge it (TO
MY MRI5 (125,000 r, p, m), unreacted p”-TTP was removed together with the supernatant. Then, 70%
After washing twice with ethanol, the intensity of the precipitate was measured using a scintillation counter, and the sample from pUc19 showed an intensity of about 108 to 109 cpm, indicating that pB
The sample from R322 was less than twice the background, and there was a significant difference between the two.

In addition, the background in the measurement with the scintillation counter in each of the above Examples and Comparative Examples is the normal background value (10-'cpm or less) measured with the scintillation counter in a state where no sample is placed.

[Effects of the Invention] As described above, conventionally it was necessary to prepare probes for capture and for labeling, but according to the present invention, the label is incorporated only into hybridized probes, which eliminates the troublesome conventional method. There is no need to prepare separate processes and two types of probes. In particular, when separating unreacted labeled substances and labeled hybrids that coexist in the same liquid phase, the nucleic acids containing the hybrids are precipitated with alcohol and separated from the liquid phase as precipitates. Since the unreacted labeled substance remaining in the phase and the hybrid can be effectively separated using an extremely simple method, and the hybrid can be recovered at a high recovery rate, detection sensitivity and accuracy in quantitative analysis can be improved.

Claims (1)

[Scope of Claims] 1) A nucleic acid detection method comprising a step of reacting a sample nucleic acid and a probe nucleic acid and detecting the presence or absence of formation of a target nucleic acid/probe nucleic acid hybrid in the resulting reaction mixture, comprising: a) A process of reacting a sample nucleic acid and a probe nucleic acid in a liquid medium; b) A process of labeling only the hybrid formed in the reaction solution obtained in step a; and c) Adding alcohol to the reaction solution obtained in step b. d) A step of precipitating and collecting the nucleic acid by adding 100% of the nucleic acid and separating it from unreacted labeled substances; A method for detecting a nucleic acid, the method comprising: a step of detecting a nucleic acid. 2) The method for detecting a nucleic acid according to claim 1, wherein isopropyl alcohol or ethyl alcohol is used as the alcohol. 3) The method for detecting a nucleic acid according to claim 1, wherein in step c, a centrifugation operation is further performed to precipitate the nucleic acid.