JPH04187090A - Dna encoding hepatitis antigen of non-a non-b type and polypeptide - Google Patents

Abstract

NEW MATERIAL:A DNA chain containing a base sequence shown by formula I, formula II or formula III. USE:A diagnosticum and a vaccine for hepatitis of non-A, non-B type. PREPARATION:For example, human plasma having high GPT(glutamic-pyrubic- transaminase) value is mixed with polyethylene glycol, a virus precipitation fraction is separated, RNA is extracted from the fraction by guanidine thiocyanate method and is used as template, cDNA is synthesized with a reverse transcriptase, inserted into a phage vector and Escherichia coli is infected with the vector to prepare a cDNA library. Then the coli bacilli is cultured, a positive clone is screened by plaque hybridization using a probe, a phage DNA is recovered from the positive clone, treated with a restriction enzyme and bonded to a manifestation vector to give a DNA encoding hepatitis antigen of non-A, non-B type.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of the Invention The present invention relates to DNA and polypeptides, and more particularly to DNA chains and polypeptides encoding non-A, non-B hepatitis antigens.

<Prior art and problems to be solved by the invention> It was known that viral hepatitis includes infectious hepatitis (hepatitis A) and serum hepatitis (hepatitis B) before the causative virus was discovered. The causative viruses of hepatitis A and hepatitis B have been discovered, and diagnosis can be made by immunological methods. With the establishment of screening methods for hepatitis B, it was expected that post-transfusion hepatitis could be prevented; however, in reality, although post-transfusion hepatitis has been reduced, it has not been eradicated, meaning that post-transfusion hepatitis is neither hepatitis A nor hepatitis B. It has become clear that viral hepatitis exists, namely non-A, non-B hepatitis (also referred to as hepatitis C). Non-A, non-B hepatitis accounts for the majority of post-transfusion hepatitis, and an increase in hepatocytosis associated with infection with non-A, non-B hepatitis viruses has also been noted. After the existence of non-A, non-B hepatitis became clear, many researchers investigated the causative virus of non-A, non-B hepatitis, or the causative virus remained unidentified for a long time. Therefore, the diagnosis of non-A, non-B hepatitis is made by testing for hepatitis A and hepatitis B, as well as testing for Epstein-Barr virus, cytomegalovirus, etc. If these tests are negative, non-A, non-B hepatitis is diagnosed. has been diagnosed as. As described above, the diagnosis of non-A, non-B hepatitis has the problem of requiring time and effort to obtain results.

Recently, complementary DNA was obtained based on RNA collected from chimpanzee serum infected with non-A, non-B hepatitis (
cDNA) was cloned and its nucleotide sequence was presented. A diagnostic method for non-A, non-B hepatitis and a vaccine for non-A, non-B hepatitis using polypeptides (antigens) prepared thereby have been proposed (see European Patent Publication No. A1-318216). However, it is said that non-A, non-B hepatitis viruses differ depending on the region, etc., and the diagnosis method for non-A, non-B hepatitis using the antigen described in the above publication can be used to diagnose all non-A, non-B hepatitis. There are doubts as to whether this can be done, and it has been pointed out that vaccines may not be sufficiently effective.

Means for Solving the Problems> The present invention was made in view of the above problems, and as a result of intensive research by the present inventors on antigenic substances that specifically react with non-A, non-B hepatitis antibodies, human We discovered that a DNA fragment encoding a non-A, non-B hepatitis antigen was present in cDNA prepared from RNA collected from plasma with high GPT levels, and determined the base sequence and amino acid sequence of the DNA. Completed the invention. That is, the DN of the present invention
The A chain contains the base sequence shown in FIG. 1, the base sequence shown in FIG. 2, or the base sequence shown in FIG. Furthermore, the polypeptide of the present invention is encoded by the base sequence shown in FIG. 1, FIG. 2, or FIG. 3, respectively.
It contains the amino acid sequence shown in the figure or FIG.

The present invention will be explained in detail below.

In the present invention, isolation of a DNA strand containing a base sequence encoding a non-A, non-B hepatitis antigen and determination of the base sequence can be performed, for example, by the following method.

(separate RNA encoding non-A, non-B hepatitis antigen; separate single-stranded cDNA from the RNA, then double-stranded cDNA)
Synthesize A; (C) Incorporate the double-stranded cDNA into a phage or plasmid to create a cDNA library.
Antibody screening from DNA library,
Screening is performed by plaque hybridization, colony hybridization, etc., and the desired D
Cloning a phage or plasmid containing NA e) After amplifying the cloned phage or plasmid and collecting the DNA, the cDNA obtained by cutting with a restriction enzyme is subcloned, and then the base sequence is determined.

The above steps will be explained in more detail.

(Preparation of RNA) RNA encoding a non-A, non-B hepatitis antigen can be prepared, for example, by adding a precipitant such as polyethylene glycol to human GPT-high plasma to concentrate the virus, and then using the AGTC method using guanidine thiocyanate [ Chomczynski
P, et al, Anal, Biochem,
, Vol.

182, 156 (1987)]. The RNA thus obtained can be used as is in the next step.

(Synthesis of cDNA) Synthesis of cDNA can be performed using, for example, Gubler-HoffI
Ilan's method [Gene, Vol, 25.263
(1983)], Okayama-Barb's method [Mo1. Ce
11. Biol, Vol. 2.161 (1982
)]. More specifically,
For example, using the above RNA as a template, a single-stranded cDNA complementary to the RNA is synthesized using a reverse transcriptase using a random primer of about 6 bases. Next, RNA is degraded with ribonuclease H, and double-stranded cDNA is synthesized using DNA polymerase I. This synthesis method can be used as a cDNA synthesis kit sold by Amajam, Boehringer, etc.

(Preparation of cDNA library) The above double-stranded cDNA is ligated to both ends with synthetic linkers or an appropriate region (e.g., polyC) is added using terminal transferase, and the double-stranded cDNA is transferred to a plasmid vector or λ
A cDNA library can be created by ligating to a phage vector. For example, after double-stranded cDNA is methylated with, for example, EeoRl methylase to protect the EcoRl cleavage site present in the cDNA, EcoRl
I Linker was ligated with DNA ligase derived from T4 phage, then cut with the restriction enzyme EcoRI, and Eeo
A cDNA library is prepared by making a double-stranded cDNA with an Rl sticky end, integrating it into the EcoR1 site of a phage vector λgtll, and performing in vitro packaging.

In addition, commercially available cDNAs of λgill and λgtlO
A library kit (manufactured by Stratagene, Amajam, Promega Biotic) can also be used.

(Cloning of cDNA) Methods for cloning a target cDNA from a cDNA library include, for example, antibody screening, plaque hybridization [5science, Vo.
I, 19B, 180 (1977)], colony hybridization [Gene, Vol, 10.83
(1980)], etc. can be used. Probes include antibody probes extracted from non-A, non-B hepatitis patient serum and cDNA obtained by antibody screening.
A complementary DNA fragment is synthesized from the nucleotide sequence of , and a probe is used that is labeled with a radioactive isotope (for example, 32P).

The cloned phage or plasmid is cultured and amplified using an appropriate host, and then the DNA is extracted.

(Subcloning) Subcloning of the obtained DNA is performed as follows. DNA containing cDNA and vector DNA are cut with restriction enzymes to prepare cDNA fragments and vector DNA fragments. Next, the mixture of both is treated with T4 DNA ligase, and then transformed into Escherichia coli etc. to obtain a transformant into which the cDNA has been integrated. Vector DNAs used include plJc18, pUc19, pUc118, and the like. Also, as restriction enzymes, EcoRl, Hj
nd m, PstlSBaIIIHI, and the like.

(Determination of base sequence of cDNA) Determination of base sequence of cDNA is performed using Maxam・G11be
rt method [Method in Enzyaolog
y, Vol, 65.499゜Acad, Press
(1980)], dideoxy method [Sanger
, P.

5science, 214.1205-1210 (1
It can be carried out by a conventional method such as 981)1.

In this way, the base sequence of the cDNA encoding the non-A, non-B hepatitis antigen can be determined, and the DNA strand of the present invention
It had the base sequence shown in Fig. 2 and Fig. 3. Next, the amino acid sequences of the polypeptides translated by each DNA strand are shown in FIGS. 4, 5, and 6, respectively, and the polypeptides of the present invention have such amino acid sequences. In addition, in this specification and drawings, the meanings of the symbols of amino acid residues in the polypeptide are as follows.

N: Asparagine D: Aspartic acid A: Alanine R: Arginine I: Isoleucine G Nigericine Q: Glutamine E: Glutamic acid C Nidistine S: Serine Y: Tyrosine W Nitributophane T: Threonine ■: Valine H: Histidine F: Phenylalanine P Nibroline M: Methionine: Lysine L: Leucine Also, the base sequences shown in Figures 1, 2, and 3 and the amino acid sequences shown in Figures 4, 5, and 6, and Nuclejc Ac1ds Res, + Vol.
, 18, 4626 (1990), the DNA of the present invention is compared with the cDNA base sequence and amino acid sequence described in
The A chain and polypeptide are presumed to correspond to the structural parts of non-A, non-B hepatitis antigens.

<Effects of the Invention> The DNA chain of the present invention encodes a non-A, non-B hepatitis antigen, and the polypeptide translated from the DNA is useful for the diagnosis of non-A, non-B hepatitis and for the diagnosis of non-A, non-B hepatitis. It is useful for producing vaccines, and has the advantage that it can be safely supplied in large quantities using genetic engineering techniques.

<Examples> Hereinafter, the present invention will be explained in more detail based on Examples, but the present invention is not limited to these Examples.

Example 1 Concentration of Virus from GPT-High Plasma G of Human Plasma
PT (glutamate pyruvate transaminase)
Polyethylene glycol 4000 was added to 300 x fl of high-value plasma to give a concentration of 4% to obtain 5 g of virus precipitate fraction.

2. RNA extraction AGTC method using guanidine thiocyanate [Ch
oIIlczynski P, et al, Anal
,,Bjochem,.

Vol. 162.156 (1987)]
was extracted.

4M guanidine thiocyanate, 25m'M sodium trienate, pH 7, 0.5% Sarcosyl, 0.1M
After homogenization in 2-mercaptoethanol, 1/1
Extracted with 0 volume of 2M sodium acetate (pH 4), equal volume of phenol, 2/10 volume of chloroform + isoamyl alcohol (49:1), and RN with 2-propanol.
A was precipitated. After dissolving in 4M guanidine solution again,
Ethanol precipitation was performed.

3. cDNA Synthesis cDNA was synthesized using cDNA Synthesis System Plus (manufactured by Amajam). The method of use was according to Amajam's protocol, and the primer was random he
Xanueleotides were used. Reverse transcriptase reaction was performed at 42°C for 1 hour, and then ribonuclease H
, DNA polymerase I reaction at 12°C for 1 hour, 22
After 1 hour at 70°C, the reaction was carried out at 70°C for 10 minutes to inactivate the enzyme. Furthermore, after reacting with T4 DNA polymerase at 37°C for 10 minutes, phenol/chloroform extraction was performed twice and chloroform extraction was performed once. An equivalent amount of 4M ammonium acetate was added to the upper layer, and then 2 times the amount of ethanol was added, and the mixture was placed in dry ice ethanol. After standing for 10 minutes at
400 μg of ethanol was added, and after standing in dry ice and ethanol for 10 minutes, centrifugation was performed, and the precipitate was washed with 70% ethanol to recover cDNA.

The obtained cDNA was converted to λ using a kit manufactured by Amajam.
Inserted into gtll. c incorporated into this vector
The DNA is amplified when the bacteriophage infects and multiplies host E. coli Y 1090 cells. thus,
Under certain conditions, the phenomenon of bacteriolysis makes it visible to the naked eye as a plaque.

At the same time, this cDNA is used as a fusion protein with β-galactosidase, which is pre-integrated into the phage DNA.
The amino acid sequence encoded by A is expressed. This-
Find clones that react with antibodies from among the amino acid sequences (peptides, proteins) of a group. This fusion protein is
Screening was performed using IF-hepatitis B patient serum absorbed with Escherichia coli cells. That is, the primary antibody was patient serum diluted 8 times after absorption with bacterial cells, and peroxidase-labeled anti-human IgG and sheep IgG were used as secondary antibodies against antigens plotted on a nitrocellulose membrane from veterinary germs forming plaques. After reacting with antibodies, plaques that were positive were picked up by color reaction. Thus, a positive clone MJ-1 was obtained.

5. Preparation of cDNA library inserted into λgtlo The cDNA obtained in 3 above was purified with EcoRI Methyl.
The mixture was reacted with 40U of ase at 37°C for 1 hour, extracted with chloroform, and cDNA was recovered by ethanol precipitation.

This cDNA and EcoRI l1nker (pGG
AATTCC) 2ug, DNA Liga
tion kit (manufactured by Takara Shuzo Co., Ltd.) at 16°C.
After reacting for a period of time, DNA was recovered by ethanol precipitation.

This DNA was digested with 50 U of EcoRl at 37°C overnight, and then added to Quick 5pjn column + nLin.
cDNA and I using kers B (Boehringer)
jnker was isolated. cDNA was recovered by ethanol precipitation. This cDNA and lμg of λgtlOarms (manufactured by Stratagene) were added to the ligation buf
fer(50mM Tris-HCΩ, pH8.0,
7mM” MgC2.1mM DTT, 1mM
After reacting at 22°C for 1 hour with 1.4 U of T4 DNA Iigase (manufactured by Takara Shuzo Co., Ltd.) in
The reaction was carried out overnight at
It was subjected to ckaging.

in vjtro packaging is Giga p
ack Gold (manufactured by Stratagene) was used.

5μi of the 1iga-tion reaction solution prepared above was
In addition to the reeze-thaw extract, 15 pΩ of 5onic extract was added and gently mixed by pipetting. After reacting this at 22°C for 2 hours, SM (0.1M NacΩ, 8
．． 1mM Mg5Oa, 0.01% gelatin, 50
0.5 μg of mM Tris-HCΩ pH 7,5) and 20 μg of chloroform were added and stored at 4°C. As indicator bacteria, Escherichia coli C600hfl+ and C600hfl- were used.

TB medium containing 10 m M M g S O4 and 0.2% maltose (Bacto-tryp per 1 g of water)
ton (10 g, dissolved 5 g of NaCΩ) at 37°C overnight with shaking, 10 m M M g S Oa AB
O3 was adjusted to 2. in vitro packag
ing phage solution was diluted with SM, 100 μg of each phage dilution and 100 μg of the above indicator bacteria were mixed, and the mixture was incubated at 37°C.
After reacting for 15 minutes, 0.7%NZ was kept at 45°C.
Y top agar (NZ amine per 1 ρ of water
type A 10 g, NaCl) 5 gSY
east extract 5 g) Mg S Oa
°7H202z, Bacto-agar 7 g
and autoclave sterilization), add 2.5yi, and add 37
1.5% N Z Y bottom pl kept at ℃
ate (NZ aminol Q g per 1 g of water
, N a CΩ5 z , Yeast extra
ct5gSMgS04 °7 H202g, Bac
15 g of to-agar was added and spread on top (autoclave sterilized). After the top agar was solidified, it was cultured overnight at 37°C, the number of plaques was examined, and the phage titer was determined.

Total titer is 1,2 x 106 pf'
It was u (plaque forming unit).

6. Probe From the base sequence of the positive clone (MJ-1) cDNA obtained in 4 above (see Figure 7), a complementary strand 54mer (5°-CCAT
CCCATGCCCTCATTGCCATAGAGGG
GCCAAGGGTACCCGGGCTGAGCCCA
-3°, Fig. 8) using an automatic DNA synthesizer (Appljed
381A) manufactured by Biosystems and used as a probe for plaque hybridization. 250 ng of synthetic NA was added to [7-”P]ATP (P B 10218.5000Ci/II1mo manufactured by AmaJam).
l) 250μci, 50mM Tris-HC4) (
pH 7,6), 10mM MtrCR2, 5mM
Using 10 U of DTT1 polynucleotide kinase (manufactured by Boehringer), a total of 20 μg was incubated at 37°C for 3 days.
React for 0 minutes, add 0.5M EDTA (pH 8,0)
The reaction was stopped by adding 1 μg. This reaction solution is Nen5
Free [γ P] ATP and labeled DNA were separated and purified using an orb@-20 (manufactured by NEN) column.

The steps of filter preparation and braxt hybridization are shown below.

(1)-Next Screening ∎C600 (hfl+) was used as the master plate indicator bacteria. Diameter 15c
m L-Bottom plate (Ba per 1Ω of water
cto-trypton 10 g, NaCl)
5g, Yeast extract 5g.

Add 5 g of BaetO-agar and sterilize by autoclaving) and add phage solution prepared so that the number of plaques is approximately 40,000 per plate.
) was incubated for 15 minutes at 37°C. And 45
0.7% L-top agarose warmed to ℃
2. 5111 and L-bottom pla
It spread to te. After solidification, it was incubated at 37°C for 5 to 6 hours, and when the plaque diameter was 1 mm or less, it was stored at 4°C.

■Filter The filter is colony/plaque 5cree
n (NEN) was used. - At night, C600 (hrl+) cultured in TB medium containing 0.2% maltose and 10mM gSO4 was diluted 20 times with TB medium, and the filter was immersed in it and dried on the filter paper for 2 to 4 hours. Ta.

■ Replica and amplification of the phage to the filter Place the filter from ■ above on the master plate, and after 5 minutes, peel it off and contact it on a new l-agar plate.
Place the plated side up and incubate at 37°C for 6-12 hours.

■ Filters with amplified denatured plaques were placed on 3MM filter paper soaked with 0.5M NaOH and 1.5M NaCΩ for 5 minutes, and filtered with 0.5M Tris-HCρ (pH 8,0), 1
．． Place on 314M filter paper soaked with 5M NaC1) for 5 min and soak with 2x SSPE (0,36M NaCN-,2
0mM Na2HPO4, 2mM EDTA) for 2 minutes. After drying at room temperature, it was baked at 80° C. for 1 hour.

■Prehybridization The filter of
Ω, 75mM sodium citrate), 20mM Na
H2PO4 (pH 7,0), 7% SDS (sodium dodecyl sulfate), 10x Denhardt's (0
, 2% Bovine serum albumin.

0.2% Po! yvinylpyrrolidone,
0.2% Picoll), 10% deXtran 5
ulfate, 100ug/xiYeas
The cells were incubated at 50° C. for 2 hours in a plastic bag containing Breno hybridization solution containing ttRNA.

■Remove the prehybridization solution from the hybridization bag and
XSSC, 7%SDS, 10XDenh
arclt's, 10% dextran 5ulfat
c4, 100 t, t g/11Yeast t
RNA, 32P labeled probe (2, OXl 06c
pm/y7.8. 6 x 106 cpIII/p+
Add hybridization solution containing
It was incubated at 0°C for 144 hours.

■ Wash filter with 3XSSC, 20mM NaH2PO4
(pH 7,5), 5% SDS, 10x Denhard
After washing 4 times with t's solution at 50°C for 1 hour, 1xS
It was washed twice with SC, 1% SDS solution at 65°C for 2 hours.

(2) Exposure to X-ray film The washed filter was exposed to X-ray film at -80°C overnight, then developed, and the position of the signal was confirmed.

(2) Scrape the gel from the master plate corresponding to the position of the secondary screening signal, suspend it in SM, and place it on a plate with a diameter of 150 mm.
The seeds were sown again until 0.00 plaques appeared, and screening was performed again. As a result, one type of single plaque was obtained.

8. Amplification of phage Put 100 μg of indicator bacteria into a dry heat sterilized test tube kept at 37°C, and add NZY top agar2. kept at 50°C.
After adding 5v1, it was spread on a NZY bottom plate that was lightly portexed and kept at 37°C.

Once the top agar had solidified, the single plaque from 7 above was poked once with the thin end of an autoclaved toothpick, and then poked into the plate 4 to 5 times.

When the second plate was cultured at 37°C for 8 hours, bacterial Iysis caused by phage was observed. Iy by phage
Using the thick end of a dry-heat sterilized Pasteur pipette, scrape off the transparent part of the sis, including the agar, and collect 200 μg of λ.
diluent (10mM Tri 5-HC
II.

After suspending in pH 8, 0, 2mM MgCΩ2) and portexing, the phage 7-di was extracted at 4°C overnight. Portex the extract and transfer 5 μg of it to E, coltC6000Hf
After mixing 100 μg of 'l-indicator bacteria in a Corning disposable 1511 centrifuge tube, 20-3
It was left standing for 0 minutes. Here, 61 NZY IIledi
um was added and cultured with shaking at 37°C for 4 to 6 hours. Bacteria 1
When S. ysis was observed, the culture was stopped and centrifuged for 20 minutes at 3.000 rpm in a tabletop centrifuge, and the resulting supernatant was transferred to a short test tube that had been sterilized by dry heat. 100 μg of chloroform was added and stored at 4°C.

9. Extraction of phage DNA The phage solution (Lysate) amplified in step 8 was activated and an equivalent amount of DE-52 suspension was added thereto. phage solution 2
After mixing by inverting 0 to 30 times, the mixture was allowed to stand at room temperature for 30 minutes, and centrifuged at 10.00 rpm for 10 minutes using a centrifuge. Centrifugation was repeated twice. For supernatant, 1 xl
5M NaCl) and 5.41f (7) isopropanol were added thereto, and the mixture was allowed to stand at -40°C for 1 hour. This is 10,
Centrifugation was performed at 000 rpm for 10 minutes. After discarding the supernatant, the precipitate was washed twice with 70% cold ethanol. This precipitate was dried under reduced pressure to give 0.1 mg/ffZ protein.
ase K: 10%SDS: TE-50μII
: prote mixed at a ratio of 120ul:3wl
Dissolve in 200 μg of inase K solution and incubate for 10 minutes at room temperature.
It reacted for minutes.

200μ of TE-saturated phenol:chloroform-1:1
15. g, portex, and microcentrifuge.
Centrifugation was performed at 00 Or p m for 2.5 minutes.

The aqueous phase was transferred to a new sample cup, 20 Pg of 3M sodium acetate (pH 6,0) and 500 μg of ethanol were added, and the mixture was left standing in dry ice and ethanol for 15 minutes or more. This was heated to 15.00 Or in a microcentrifuge.
pm, centrifuged for 5 minutes, and the resulting phage DNA
The precipitate of A was dried under reduced pressure.

The phage DNA from 9 above was digested with EcoRl, and 1%
Perform low melting point gel electrophoresis, cut out the cDNA band, perform phenol extraction twice, and D by ethanol precipitation.
NA was collected. The E. coli vector pUc18 digested with EcoRl and the recovered cDNA were subjected to DNA Lig.
ation kit (manufactured by Takara Shuzo Co., Ltd.) Niyori, l tg
Atton reaction was performed and E. coli H,B 101:7
Transformed into pitent cells (manufactured by Takara Shuzo Co., Ltd.), and 20Pg
/'11 ampicillin-containing L-plate, 3
Ampicillin-resistant bacteria with integrated cDNA were obtained by incubating overnight at 7°C, and the DNA was then subjected to alkaline method [
Birnboim, H.C. et al., Nucl.
ejc Ac1dsRes,, Vol, 7.1513
(1979)] (MJ-2).

11. Plaque hybridization (2) The obtained cDNA was treated with Random Primer DNA La
With the bell-ing kit (manufactured by Takara Shuzo Co., Ltd.), 3
The filter prepared in step 7 above was labeled with 2P and used as a probe, and the filter prepared in step 7 was screened again by the plaque hybridization method, and two types of positive clones were obtained. These two types of clones were pLIc1
81. :”l-bucloned (MJ-3, MJ-
4).

12. Determination of the cDNA base sequence The cDNA base sequence was determined using the dideoxy method [Sanget
, F.

5science, 214.1205-1210 (1
981)], and 7-D E A Z A
This was carried out using a Sequencing Kit (manufactured by Takara Shuzo Co., Ltd.).

The number of bases of the three clones (MJ-2, MJ-3, MJ-4) is 1682 bp, 567 bp, 52 obp, respectively.
The respective base sequences are shown in Figures 1, 2, and 3.
It was as shown in the figure. Each sequence is Nucl
eic Ac1ds Res,, Vol, 18.48
From the cDNA base sequence described in 26 (1990),
It is presumed that this corresponds to the structural part of the hepatitis C virus. The amino acid sequence predicted from each base sequence is
5 and 6.

[Brief explanation of the drawing]

Figures 1, 2 and 3 are diagrams showing the base sequence of the DNA encoding the non-A, non-B hepatitis antigen of the present invention, and Figures 4, 5, and 6 are Figure 1, respectively. Figures 2 and 3 show the amino acid sequences translated from the nucleotide sequences, and Figures 7 and 8 show the nucleotide sequence of positive clone MJ-1 and the nucleotide sequence of the synthetic probe that is its complementary strand, respectively. It is a diagram. Patent applicant Toshio Shikata Midori Juji Co., Ltd. 4 ■ SLFRFGASQNIQLINSNGSWHINRT
SLNCNDSLQTGFIAALF'+DQRPYC
WHYAPRQCGIVPASQVCGPVYCFTP
SPVVVGTTDRFX5th N-GCSFSIFLALLSCLTTPASAYE
VRNVSGVYHVTNDCSNSSIXNSVPT
TT I RRHVDLLVGAAALC3AMYVG
DLCGSVFLVSQLFTFALVVSQLLRI
PQAVVDMVAGAHWGVLAG -C 6th N-TIPASAYEVRNVSGMYHVTNDCS
NSSIVYEAADVIMHTPGCVFVGAAA
LCSAMYVGDLCGSVFLVSQLFTFSP
RRHETVQDCNCSLDMVAGAHWGSLA
-C LLGVRATRKTSERSQPRGRRQPIPK
ARHPEGRAWAQPGDTLTCGFADLMG
YIPLVGAPLGGAARALAHG'/RVLE
D2 supplement + TNDCSNSS IVYEAADVIMHTPGC
VPC, VRENNSSRCWV; VFLVSQLFTFSPRRYETVQDCNCS
IYPGHVTGHRMAW-iMVGNWAKVLIVMLLFAGVDGQTRV
SGGTAGRNTHGFV'THKFNSSGCPE
RMASCRPIDRF AQGWGPITYTEPNS
PIsLRIAGGGMNGRAAPQLTPAAAR
QLVRLY -C figure LYEAADV IMHTPGCVPCVRENNNS
5RCWVALTPTLAARNSPRRYETVQD
CNC5IYPGHVTGHRMAWDMMMNWSP
TA figure'CVRENNNS 5RCWVALTPTLAAKNA
SVPTTT I RRHVDLLYPGHVSGHR
MAWDMMMMNWSPTAALVVSQLLRIPE
AVV5'-CGACTAGGAAGACTTCCGA
GCGGTCGCAAACCTCGTGGA/GCCTG
GGCTCAGCCCGGGTACCCTTGGCCC
CTCTATGG (5'-CCATCCCATGCCCTCATTGCCA
TAGAGGGGGCCAAGGGT/Figure kGGc+ :AATGAGGGCATGGGATGGGGCAGGA
TGGCTCCTG-3'8 figure

Claims (1)

[Claims] 1. D containing the base sequence shown in FIG. 1, FIG. 2, or FIG. 3
NA chain. 2. A polypeptide comprising the amino acid sequence shown in FIG. 4, FIG. 5, or FIG. 6.