JPH04126095A - New monoclonal antibody and hybridoma producing the same - Google Patents

Abstract

PURPOSE:To industrially and stably obtain a monoclonal antibody by adding a specific amino acid sequence thereto. CONSTITUTION:A mouse, etc., is immunized with a protein containing five or more amino acids in an amino acid sequence expressed 'by the formula to afford the antibody-producing cell (A) such as spleen cell. Then the cell A is fused with a myeloma cell (e.g. P3X63-Ag8-653) (B) in the presence of polyethylene glycol, etc., and subjected to cloning to provide a hybridoma (e.g. 7E11 FERM P-11633) (C) having antibody-producing ability. Then a supernatant obtained by culturing the ingredient C is salted out and separated and purified with an ion exchange chromatography, etc., to produce the monoclonal antibody (D) containing an amino acid sequence expressed by the formula and having specificity in a part of protein. As necessary, the ingredient D is added to a material to be examined such as brain spinal fluid and reacted with the material and APP 770 (a kind of precursor of senile spot amyloid) or fragment thereof is detected by an immunoassay method.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] This invention relates to a novel monoclonal antibody and a hybridoma producing the same. More specifically, the present invention relates to a novel monoclonal antibody that specifically recognizes a sequence unique to human senile plaque amyloid precursor protein APP770, which is useful as a diagnostic agent for neurological diseases including senile dementia, and a hybridoma that produces the same. It is something.

[Conventional technology]

In recent years, with the aging of the population, diseases of the brain and nervous system, including senile dementia, are becoming a social problem. Among these diseases, there are many diseases for which the causes, simple diagnostic methods, and treatments have not been established, and research and development of these diseases is strongly desired. Such diseases include senile dementia of the Alzheimer type and Alzheimer's disease (hereinafter abbreviated as AD).

After the death of an AD patient, the brain has deposits called senile plaques, whose main component is senile plaque amyloid, compared to normal people.
Since it is frequently discovered, the relationship between senile plaque amyloid and the onset of 40 years has attracted attention. Kang et al. discovered that senile plaque amyloid has a precursor (hereinafter abbreviated as APP) (hereinafter APP discovered by Kang et al. is referred to as APP69).
5) was reported (Kang et al., Nature 3
25733-7361987), further research including the present inventors revealed that there are at least three types of APP (see Figures 1-1), and two newly discovered types of APP, APP751 (Ponte et al. ,
Nature 331525-5271988, Tan
zi et al., Nature 33152B-5301988
, Ki taguchi et al., Nature 33153
05321988, Cal Bio Patent Application Publication Hei 2-501796, Neve International Publication Number-os9
107657) and APP770 (Kitaguchi
Kitaguchi et al., Nature 530-5321988) has a Kunitz-type serine paseline protease inhibitory region, and it has been revealed that serine protease inhibitor activity actually exists (Kitaguchi et al., Nature 33153).
0-5321988). The sequence consisting of 19 amino acids unique to APP770, shown dotted in Figure 1-1, is
It corresponds to the 5th to 24th amino acids in general formula (1). The region other than the 5th to 24th amino acids in general formula (I) is an amino acid sequence in APP770 adjacent to a sequence consisting of 19 amino acids unique to APP770.

If the intracerebral deposition of senile plaque amyloid in AD patients is considered to be the result of inhibition of intracerebral metabolism by protease inhibitors, APs with protease inhibitor activity
It is possible that overexpression of P plays some role in the onset of AD. From this perspective, the inventors
AD the expression levels of metsenger RNA of three types of APP.
When we examined the brains of patients and normal people, we found that the expression level of metsenger RNA of APP770 was about twice as high in AD patients. On the other hand, APP751 is
It was found that AD patients were 1.1- to 1.3-fold higher than controls (Tanaka et al., B, B, R
, C, 157472-4791988 and B, B,
R, C, 1651406-14141990). Therefore, APP770 has a larger ratio between AD patients and controls;
The difference is clear. This suggests that APP770 is involved in the onset of the disease, and provides important information for the diagnosis of AD. In addition, human brain cerebrospinal fluid was used as a test sample to measure the amount of APP or its fragments containing the protease inhibitor region using trypsin ELISA.
As a result of measurement using the method, it was found that the AD group showed significantly higher values than the cerebrovascular dementia group (Ki
taguchi et al., B, B, R, C.

Yu Regulation 1453-14591990 and Patent Application Hei 1-214
118).

[Ia] The above results were obtained using a rabbit antiserum that recognizes the protease inhibitor region that is commonly present in APP770 and APP751, but the experimental results regarding the amount of metsenger RNA are When considered together, APP77
It is thought that the difference will become even clearer if an antibody that specifically recognizes 0 is used. Furthermore, monoclonal antibodies have the advantage of being able to supply industrially stable specific antibodies.
Advantageous compared to antiserum.

[Means to solve the problem]

In order to solve the above-mentioned problems, the present inventor has made extensive research, and as a result, by using as an antigen a peptide or protein containing 5 or more amino acids of the amino acid sequence of the following general formula (1), We were able to obtain a monoclonal antibody that specifically recognizes the amino acid sequence of (I) and a hybridoma that produces it, leading to the completion of the present invention.

That is, the present invention relates to the following general formula (1) included in APP770.
) and a hybridoma producing the monoclonal antibody.

General formula (I): Cys-G ly-5er-A la-Met-5er
-G l n-5er-Leu-Leu-Lys-Th
r-Thr-GIn-Glu-Pro-Leu-Ala
-Arg-Asp-Pro-Val-Lys-Leu-
Pro-Thr-Thr (wherein, Ala: alanine, Arg: arginine, Asn: asparagine,
Asp; aspartic acid, Cys; cysteine, G
in: glutamine, Glu; glutamic acid, G
uy; glycine, tlis; histidine, 11e
H Isoleucine, Leu; Leucine, Lys;
Lysine, Met; Methionine, phe; Phenylalanine, Pro; Proline, 5erS serine, Thr
; Threonine, Trp; Tryptophan, Tyr;
Furthermore, according to the present invention, there is provided a method for detecting APP or a fragment thereof using the above monoclonal antibody in a subject subjected to an immunoassay.

The hybridoma of the present invention comprises a myeloma cell and - general formula (I
) A hybridoma with antibody-producing cells present in the tile cells or lymph node cells of an animal immunized with a peptide or protein containing at least 5 amino acids of 1) is selected as a clone that produces a monoclonal antibody that specifically recognizes the amino acid sequence.

In general, when creating an antibody that recognizes a certain protein, it is considered desirable to use as an antigen a peptide that has a continuous amino acid sequence of five or more residues in the amino acid sequence of the protein. Therefore, general formula (1)
A peptide containing five or more consecutive amino acid residues in the amino acid sequence represented by can be used as an antigen. Such peptides can be produced using organic chemical techniques such as liquid phase or solid phase synthesis methods. Furthermore, recombinant DNA
It can also be produced by technology. As an immunization method, the peptide may be used as it is for immunization, and especially when the number of amino acid residues is about 20 or more, the peptide usually has sufficient antigenicity even when immunized as it is.

When the number of amino acid residues is 5 to 20, the antigenicity is often not very high, and in order to further increase the antigenicity, it is preferable to use a carrier protein. Examples of carrier proteins include thyroglobin, KLH. (Ke
yhole limpet hemocyanin) and the like. The preferred method for bonding the carrier protein and antigen peptide is the active ester method using a carbodiimide compound or the MBS method. In the MBS method, cysteine is bonded with an amide to the N-terminus or C-terminus of the antigen peptide, and the thiol group of cysteine is bonded to the thiol group of the cysteine. and meta-maleimidobenzoic acid-N-hydroxysuccinimide ester (hereinafter abbreviated as MBS), and further reacted with an antigen peptide compound and MB against the amino group of the carrier protein.
This is a method in which a bond of S is reacted. In this way, a peptide compound that can be used for antibody production according to the present invention is obtained. Either the sequence in APP770 containing at least a part of general formula (1) is immunized and the resulting monoclonal antibody is screened with the peptide of general formula (I), or the peptide of general formula (I) is screened with APP770 and APP751 to obtain APP770 and APP770. A method of screening for those that only react is also adopted.

Elutriation: Mice are immunized using the above-mentioned peptide compound or protein as an antigen in a conventional manner. For example, per mouse, 20 to 50 μg of the antigen may be added directly or denatured, such as in Laemmli's 5OS-PAGE sample buffer (Laemmli U, K, Nat.
ure 227-680-6851970) in 10
Examples include a method of boiling at 0° C. for 3 minutes and immunizing intraperitoneally or subcutaneously with Freund's complete adjuvant.

The immunization interval is usually every two weeks, and the number of immunizations is usually about 3 to 10 times. Establishment of immunity can be confirmed by collecting blood from sensitized mice and measuring the antibody titer in the blood using a standard ELISA method.

Next to Cell A and Hybridoma, the method for producing the monoclonal antibody and hybridoma according to the present invention will be explained below. As mentioned above, hybridomas are produced by fusing myeloma and antibody-producing cells. For antibody-producing cells, the general formula (
1) Use lung cells or lymph node cells from mice, rats, etc. that have been immunized with a protein containing 5 or more amino acids. It is usually preferable to use cells of the same species as the animal species from which the myeloma cells and antibody-producing cells are derived. One preferred hybridoma for carrying out the present invention is a hybridoma between mouse myeloma cells and lung cells or lymph node cells of a mouse immunized with a genetically engineered protein containing the APP gene exon 8 region. . As mouse myeloma cells, Ba1b/c mouse-derived myeloma cells P3X63-Ag8-653 are preferable because of their high fusion efficiency. Other bone marrow cell types include P3X63Ag
8, P3X63Ag8U, 1, SP210Ag1
4. (more than mouse) YB210 (rat) etc. 8-
Azaguanine-resistant cell lines may also be used. The production of hybridomas and the selection of hybridomas producing the desired monoclonal antibody can be carried out, for example, as follows. Antibody-producing cells and myeloma cells are fused using a cell fusion promoting substance such as polyethylene glycol. The resulting hybridoma grows in a medium containing hypoxanthine, aminopterin, and thymidine (hereinafter abbreviated as HAT medium). The unfused antibody-producing cells and myeloma cells die in the medium, and only the hybridoma produced by the fusion of both cells becomes viable.

Next, select lambda hybridomas producing the desired antibody as follows. If immunized with the antigen as is, use the antigen denatured with SO3, or with the antigen denatured with SO5. The hybridoma culture supernatant is added to a 96-well polystyrene microplate coated with the following, and a conventional solid-phase ELISA method is performed. In this process,
Antigen-specific hybridomas are selected, and further cloning is performed by limiting dilution to select hybridomas that exhibit stable antibody production ability. The hybridoma thus obtained is, for example, 7E11 (Feikoken FE
The target monoclonal antibody (RM P-11633) can be recovered from the culture supernatant of the hybridoma thus selected by separation and purification operations such as salting out, ion exchange chromatography, and protein A columns. When obtaining a large amount, the monoclonal antibody may be grown in the peritoneal cavity of a histocompatible animal, nude mouse, etc., and the monoclonal antibody produced in the ascites of the animal may be purified.

In the following, using the monoclonal antibody according to the present invention, AP
A method for diagnosing Alzheimer's disease in which P770-derived protein is detected by an immunological method will be described. Examples of the specimen include brain, cerebrospinal fluid (CSF), plasma, serum, urine, and the like. Examples of measurement methods include enzyme immunoassay (EL).
ISA), Radioimmunoassay (RIA),) Lipsin ELISA (Kitaguchi et al., B, B.

R, C, 1661453-14591990 and Japanese Patent Application No. 1-214118), immunoblotting, and the like. Describe a method using ELISA 0 For example, using a polystyrene microplate as a solid phase, CFS
A sample such as plasma, serum, urine, etc. is placed in a well together with a protein adsorption buffer and left to stand for a certain period of time. As a buffer for protein adsorption, a sodium carbonate-sodium hydrogen carbonate buffer, PBS (-), or the like is used. As for the conditions for standing, it is common to leave at 4° C. overnight, but it is also possible to leave at room temperature for about 2 hours, for example. The polystyrene microphone plate to which the specimen has been adsorbed in this way is washed with PBS (-) or the like. After washing, a monoclonal antibody according to the present invention is added as a secondary antibody and allowed to react for a certain period of time. Next, the plate is washed in the same manner as above, an enzyme-labeled anti-mouse immunoglobulin antibody is added as a secondary antibody, and the reaction is allowed to occur again for a certain period of time. Furthermore, after washing the plate in the same manner as above, an enzyme substrate is added and enzyme activity is measured. Examples of the enzymes used include horseradish peroxidase (HRP), β-galactosidase (β-Gsl), and alkaline phosphatase (AP). In addition, a so-called sandwich ELISA using two types of monoclonal antibodies (or a monoclonal antibody and an antiserum) that recognize different antigenic determinants is also effective from the viewpoint of sensitivity. Alternatively, the enzyme may be directly bound to the primary antibody, RI
In A, the antibody or antigen was labeled with a radioactive isotope instead of the enzyme-labeled antibody in ELISA, but trypsin EL4SA is a type of zero-order immunoblotting that can be thought of as a method that uses trypsin instead of the first antibody in sandwich ELISA. Aruichies ternBlo
tting (Towbin et al. Proc.
, Natl.

Acad, Sci, USA 764350-435
41979), CSF, plasma, serum, urine, etc., as is, or after denaturation treatment, for example, using Laemmli's 5DS-PAGE sample buffer (Laemmli's 5DS-PAGE sample buffer).
U, K, Nature 227 680
-685 1970) for 13 minutes at 100°C and polyacrylamide gel electrophoresis. After equilibrating the gel in transfer buffer, the proteins in the gel were electrophoresed onto a nitrocellulose or nylon filter. transcribe. After blocking this filter with BSA gelatin, Scum milk, etc. in a buffer such as Tris-HCl buffer, the monoclonal antibody according to the present invention is reacted with the antigen transferred onto the filter for a certain period of time. After the reaction, the filter is washed. As a subsequent antibody, an enzyme-labeled anti-mouse immunoglobulin antibody is added and reacted with the antibody according to the present invention. After washing, a substrate for the enzyme is added and reacted on the filter. HRP l1il! as a secondary antibody! When an antibody is used, 4-chloronaphthol or the like is used as a substrate. By measuring the color intensity on the filter using a densitometer or the like in this way, it is possible to measure the amount of antigen contained in the sample. Furthermore, the enzyme may be directly bound to the primary antibody, or an antibody labeled with a radioisotope may be used instead of the enzyme-labeled antibody. In this case, it is possible to measure by autoradiography. be. In addition, the radioactivity of a specific band on the filter can be
It is also possible to cut out the band and then measure it using a liquid scintillator-1T well counter or the like.

〔Effect of the invention〕

The present invention provides a novel monoclonal antibody that specifically recognizes a sequence unique to APP770 or a fragment thereof, and a novel hybridoma that produces the same. As mentioned above, APP770 or a fragment thereof is expected to be expressed at a significantly high level in Alzheimer's disease patients, so it becomes possible to diagnose Alzheimer's disease using the monoclonal antibody of the present invention. Also, APP
It is also useful as a research reagent for detecting, quantifying, and purifying APP molecules or fragments thereof containing sequences unique to 770.

〔Example〕

The present invention will be explained in detail below with reference to Examples, but the present invention is not limited by these Examples.

In addition, the basic operations in the examples were in accordance with the following literature.

◎ T, Maniatis et al., Mo1ecular
Cloning, A Laboratory Ma
nual, Co1d Spring Harbor La
laboratory (1982) ◎ D, M, Glover et al., DNA Clonin
g, IRL Press In addition to the protease inhibitor region (hereinafter abbreviated as APPI) present in APP enclosed by diagonal lines in Figure 1-1, a peptide portion containing amino acids derived from APP770 on the N-terminal side and C-terminal side is added. For expression, the DNA encoding APP770 was truncated using a so-called site-directed mutagenesis method using synthetic oligonucleotides. The MutanG@ (Zen Shuzo) system was used for this reaction, and the 3'- and 5'-side deletion reactions were performed simultaneously by partially modifying the attached protocol. The outline is described below. European Patent Publication No. 0304
Plasmid pGBP2 (ATCC-
67502) was digested with the restriction enzyme BawHI and fractionated by agarose gel electrophoresis, resulting in 1.6K containing the APPI portion.
The DNA fragment of b was recovered. Bamfl I
After cleavage with bacterial alkaline phosphatase (BA
P) was connected to the treated vector TvlB (Zen Shuzo) to obtain a clone TvBB1 integrated in the desired direction.

(see Figure 2), the two oligonucleotides D5.
D3 Abride Biosystem Da DNA Synthesizer 380
It was synthesized and used in the reaction. When the deletion reaction with D5 occurs, after cleavage with BamHI, when connected to the Bgl 11 site present in the signal sequence of human tissue type plasminogen activator (hereinafter abbreviated as tPA), t
After the PA signal, exon B (Les + afre et al., Nucleic Acid
sRe5earch 17517-5221989
According to the 6 amino acids derived from exon 6), it has a structure in which a peptide encoded from exon I (exon 7) and below is connected (see Figure 4).If deletion by D3 occurs, exon J (exon 8) Following the part described in (Hereinafter, exons of the human APP gene are indicated by numbers), the C-terminal amino acid derived from exon 9, the subsequent stop codon, and the Bamtl I site are introduced.

That is, the reaction using D3 involves the substitution of two bases at the same time as the deletion reaction (see Figures 3 and 4).

First, add 0.2ug of mplB DNA included in the kit to 0.5μg of 1st strand TvBBIDN^, and add 10μl.
20mM Tris-HCI (pH 8,0), 10
100°C for 3 min, 65°C in mM MgClg, 50mM NaCl, 1mM dithiothreitol CDTT)
The plate was incubated for IO minutes at 37°C for 10 minutes to allow annealing.

This annealed DNA was phosphorylated to 4.5 μm D3. 16 ng of each D5 was added and annealed by incubating at 65°C for 15 minutes and at 37°C for 15 minutes. Here, 30μm of 50mM Tris-HCI (pH 8,
0), 60s*M CHsCOONH4, 5gMMgC
1g, 5mM DTT, 1wM NAD and 60 units of E.

E. coli ligase and 1 unit of T4 polymerase were added, and the mixture was allowed to react at 25°C for 2 hours. This reaction product was transfected into the large 11ii BMH71-18 strain.
After incubation for an hour, the culture solution containing phage particles was extracted with E. coli MV11.
84 strains were transfected to form plaques (
All E. coli bacteria, buffers, and enzymes used were from Takara Shuzo). 3 for this plaque! Screening was performed using P-labeled D5 and D3. D5. Four plaques giving positive signals for both D3 and D3 were identified, and the nucleotide sequence of the deletion site was determined using the M13 Sequencing Kit (Takara Shuzo). To confirm the deletion of D3, use the universal primer included in the kit, and to confirm the deletion of D5, use the custom-made primer (5' ACTTTGGGG
ACATGGCGCTGCCACA3') was used.

The clone in which the desired deletion had occurred was named TvlJ.

[Step 2]
- as described in the above-mentioned European Patent Publication No. 030413
Plasmid vector pSVMT tPA expressing PA
was completely digested with the restriction enzyme Bgl II, and then partially digested with Bawl I, and the resulting approximately 3.8 Kb fragment was transformed into TvlJ
About 300 plasmids obtained by digesting the plasmid with BamH1
A clone that has been ligated with the bP fragment and integrated in the desired direction is selected, and this allows the tPA signal sequence to be linked (
A vector plJ was obtained which expresses a portion mainly containing exon 7.8 of APP using the SV40 and mouse metallothionein promoters (see FIG. 5).

[Step 3] Look into the vector and vector plJ
After digestion with BamHI, the excised fragment was incorporated into mplB (Takara Shuzo) to obtain a clone-plJ integrated in the desired direction (Fig. 5).

[Step 4] A single-stranded DNA of boothmid AmpIJ was prepared according to a conventional method. - side, oligonucleotide pleater DJ2 (5' TA
GAGGATCCTAGGCGCTGCCACA 3'
) and Mu Cheetah DOGI (5' AGAGGT
TCCTGGGCAGCCTTGAGTAAAACTTT
G3') was synthesized, and the part downstream of exon 8 (base numbers 295 to 369 in Figure 4) was removed using Pleater DJ2 according to the protocol shown below, and the exon 8 region was removed using MuCheetah〇〇GI. We modified the part that is considered to be the internal 〇-linked glycosylation site. First, use 32pmole of DJ2 or DOGI.
, synthetic oligonucleotide (5' GTTTTCCCA
After phosphorylating 10pIllol of GTCACGA3' in the presence of adenosine triphosphate using T and DNA kinase (Takara Shuzo), 0.6μ of the previously prepared single-stranded DNA was added.
After incubating at 95°C for 5 minutes and leaving at room temperature, deoxyribonucleotide (adenine, guanine, cytosine, thymidine) triphosphate and adenosine triphosphate
Double-stranded DNA was synthesized by the action of DNA polymerase Klenow fragment, T, and DNA ligase in the presence of phosphoric acid, and then E. coli JM105 (Takara Shuzo) was transformed to form plaques. This is Maniatis
According to the experimental manual of ``P-7ATP, Braags with the desired mutation were selected using radiolabeled DJ2 or DOGI as a probe.Single-stranded DNA was collected from these Plags, and the M13 sequencing kit was used. (Zen Shuzo) was used to determine the nucleotide sequence. DJ2 was used to determine the nucleotide sequence from 295th A to 369th nucleotide in Figure 4.
A product was obtained in which up to C-th was removed, that is, a TAG stop codon after position 370 was connected from position 294 onwards. In the case using DOGI, the 316th A
changes to G, the 319th A changes to G, and along with that,
The two encoded Thr were converted to Ala. Each of these clones is called mpDJL.
and mpDOGL. s+pDJL and wp
The fragment obtained by cutting the double-stranded DNA of DOGL with Bawl I was cleaved with BamHI and then treated with BAP.
The clones that were inserted in the desired direction were selected (see Figure 5).

Additionally, Maniat using the same probe for confirmation.
Southern analysis was performed according to the IS experimental manual to confirm that each clone had the desired mutation. The expression vectors thus obtained were transformed into pSVMTDJL and pSVM.
It was named T-DOGL. pSVMT-DJL is pI
Compared to J, only the portion deleted from exon 8 and below is expressed.

On the other hand, pSVMT-DOGL expresses a protein in which two Thr residues considered to be 0-linked glycosylation sites within exon 8 have been converted to Ala residues.

[Step 5] pSVMT-D and pSVMT-DO obtained in Step 4
20 μg each of GL and plJ was added to each I×10′ CO5-1 cells in PBS (272
mM sig-sugar, 7mM sodium phosphate (pi(7,4)
1mM MgCh). The introduction was carried out using Bioland's Sheen Pulser ■ by applying electric pulses twice at a voltage of 400 V, a capacitor of 3 uF, and a duration of 1.0 to 1.3 seconds at an interval of 30 seconds. The cells after introduction were incubated at 37°C for 50 minutes in Dulbecco's modified minimal basic medium containing 10% fetal calf serum (hereinafter abbreviated as FC5).
After incubation for 24 hours under conditions of % CO, Dulbecco's phosphate buffered salt l! Solution (Ca"Mgt-free) (hereinafter referred to as PBS)
(abbreviated as -)) to remove FCS, then F
The medium was replaced with a CS-free medium, and thereafter the medium was replaced every 48 hours, and the culture supernatant was collected three times in total. Further introductions were performed 10 times for each plasmid, for a total of 30 transfections per plasmid.
A 0 m culture supernatant was obtained.

In addition, pIJ, pSVMT-DJL and pSVMT-
The proteins expressed by DOGL were IJ and D, respectively.
Acetone was added to each culture supernatant (abbreviated as JL and DOGL) to a final concentration of 40%, left at -20°C for 1 hour, centrifuged at 5000 rpm for 20 minutes at -10°C, and the supernatant was separated. Recovered. Furthermore, acetone was added to the collected supernatant to give a final concentration of 80%, and after being left at -20°C for 1 hour, it was centrifuged to collect the precipitate. The resulting precipitate was dissolved in 6ml of 205M Tris-HCl (pH 8,0), centrifuged at 5000 rpm for 10 minutes at 4°C, and the supernatant was collected.6 Next, this supernatant 61d was immobilized on agarose beads. Bovine pancreatic trypsin (Sigma) 5
0 units was added and shaken at 37°C for 10 minutes to adsorb the sample. The resulting suspension was packed into Select S Column 0 manufactured by 5Prime-3Prime, and the agarose beads were collected. From then on, the separation of acarose beads was carried out at 11,000 r.
After washing the collected beads with washing solution 6111 consisting of 0.3M NaCl, 10mMCaC1g, 0.3MNaCl, 10wMC
Elution was carried out with eluent 3 consisting of 1 g of aCl, 10 MHCI (pH 2). Elution was performed three times in total, and each eluate was IM
) Neutralized using Squirrel Salt # (pIJ8.o). Acetone was added to the obtained elution wave meter 9d to give a final concentration of 80%, and after 1 hour at -20°C, it was heated at 5000 rpm.
m, centrifuged at 10°C for 20 minutes, collected the precipitate,
The resulting precipitate was diluted with approximately 200 μl of 20mM) lithium-hydrochloric acid (
pH 8.0).

[Step 6] Part of IJ, DJL and DOGL obtained in Step 5 was added to 17.
After electrophoresis on 5% 5O5-PAGE, Coomassi
E-staining was performed to test the purity and molecular weight of each recovered protein. Obtained IJ, D and DOG
L was approximately uniform bands with sizes of ~17 Kd, ~7 Kd, and ~ld, respectively. This indicates that the predicted 〇-linked type I! on exon 8 of APP! A sugar chain actually exists on IJ, which has a chain addition site, and its apparent molecular weight is about 10 Kd. In addition, in D and DOGL, deletion of exon B SI region and O - Combined type I! It was strongly suggested that only the peptide portion was expressed due to mutation of the chain addition site. Furthermore, Il on each protein! Regarding the presence or absence of chains, PAS (Periodic acid-5
hiff) staining was performed (Zacharius et al., An
al, Bioche-, 3014B-1521969
), as a result, only IJ was positive for PAS staining, indicating that sugar chains exist in IJ, but DJL and DOGL
It was revealed that there were no sugar chains in the . In other words, it became clear that each protein was purified and recovered as designed.

[Step 7] The secreted APP described in APP667, 648 and 592, European Patent Publication No. 0304013, Example 5, Step 2 was purified by the method shown below (the schematic diagram is shown in Figure 1-2), European Patent Publication No. 0304013. Number 0304
Plasmid pSVMT6 described in No. 013, Example 5, Step 2
67.648 and 592 were introduced into COS cells.

The method was as described in Step 5 of Example 1 of the present invention. Add (p-amidinophenyl)methanesulfonyl fluoride hydrochloride (Wako Pure Chemical Industries, Ltd.) to the culture supernatant of each plasmid-introduced CO5 cell to a final concentration of 2 H, and add CentriprepH30'' (Amicon). 20-MTris-
Buffer exchange was performed with hydrochloric acid (pH 8,0).

Next, the above sample was applied to a DEAE-Sepharose@column (Pharmacia), and a column of 20 m
MTris-HCl (pH 8,0), NaCl gradient 0-I
Column chromatography was performed under M conditions. For each chromatographic fraction, APP592 and AP
For P64B, APP+* expressed in E. coli
Rabbit anti-APP created against sヮ, (ZKX)
Regarding I9 379 antiserum and APP667, the monoclonal antibody ADJ5-3-7 (FERM P-10388 obtained from JP-A-2-138995, Example 9) was used.
A solid-phase ELISA was performed using 3D ELISA (No. 1), and the APP elution position was identified. ZKX is the N-terminal 19 in APP770.
It is a fusion protein of a polypeptide containing amino acid residues 1 to 379 and β-galactosidase, and was expressed in Escherichia coli and purified by solubilization with 6M urea. Each APP is 0.3-0.4M
It was eluted with NaCl. The ELISA-positive fraction was concentrated using Centcolin 130@(Amicon), and further injected with 50% sodium phosphate (p) 17.2 in the same device.
) After buffer exchange, affinity chromatography using a heparin column was performed.

DHAI! The partially purified fraction by -5epharose@column (Pharmacia) was applied to a heparin-5PW column (Tosoh Corporation), and NaCl gradient 0-2
Chromatography was performed under M conditions. Similarly for each chromatographic fraction rabbit anti-APP + q
37. Solid phase ELI using antiserum or ADJ5-3-7
SA was performed to identify the APP elution position. Each APP is 1
．． Eluted with 0-1.2M NaCl. The ELISA-positive fraction was concentrated using Centcolin 130@ (Amicon) and buffer exchanged into 20mM Tris-HCl (pH 8.0). These were subjected to 7.5% 5DS-PAGE and Coo*aasie staining was performed to confirm purity and molecular weight. PSVMT 667, 648 and 592
Each protein obtained by performing the above procedure from the culture supernatant of COS cells introduced with 5DS-PA
It is a rather broad single band on GE, and the apparent molecular weights are 105 ± 5 Kd, 100 ± 5 Kd, and 9, respectively.
4:t: It was determined to be 5Kd. Below pSVMT66
APP667.648 was purified from the culture supernatant obtained by introducing 7.648 and 592 into COS cells.
and 592.

(i) Mouse sensitization Antigens for creating hybridomas were prepared as follows. The IJ obtained in Step 5 of Example 1 was dissolved in PBS(-)
Dissolved in Laemmli's 5DS-PAGE sample buffer (Laesw+Ii U, K, N
After boiling for 3 minutes at 100°C in ture 22-680-685 (1970), add 4 times the volume of acetone,
The mixture was cooled at −20° C. for 1 hour and centrifuged at 9000 rpm for 20 minutes. Excess amount of SDS was removed, and SDS-denatured IJ was collected from the sediment, which was used as an antigen for hybridoma production. For immunization, 50 tIg SDS-denatured IJ dissolved in 500 μl of PBS (-) was injected intraperitoneally into three 6-week-old Ba1b/c female mice together with Freund's complete adjuvant, followed by Freund's complete adjuvant at 2-week intervals. A total of four immunizations were performed with incomplete adjuvant.

Monoclonal antibody experimental manual (Kodansha Scientific)
This was confirmed by the solid-phase εLISA method according to Sakuji Tomiyama (author).

(j) Cell fusion Cell fusion was performed according to the Monoclonal Antibody Experiment Manual (Kodansha Scientific, written by Sakuji Tomiyama). The mouse with the highest serum antibody titer was given 200μm PBS (
50 μg of SDS-denatured IJ dissolved in 100 μg/ml of SDS was injected through the tail vein, and 3 days later, lung cells were removed aseptically.
Disintegrate into single cells with a stainless steel mesh and remove 175 lung cells.
amount of 8-azaguanine resistant myeloma cell line P3X63-A
g8-653 cells (Immunobiology Institute Co., Ltd.) and M
Mix edial@medium (Immune Biological Laboratories Co., Ltd.) and centrifuge, then add 50% PF and G1500 to the cell pellet.
(manufactured by Boehringer) was added to perform the fusion operation. After that, the fused cells were centrifuged and the supernatant was removed by suction, and then
% FCS-containing HAT medium was added and plated on 11 966 microplates. After fusion, colonies grew from 600 wells in about 2 weeks, and SOS was applied to these culture supernatants.
Solid-phase ELISA using denatured IJ as a screening antigen
We obtained a clone that strongly reacted with SOS degenerated ■J.
Cloning by limiting dilution method was repeated three times. One clone that showed stable antibody production after three clonings was named 7E11, and was deposited with the Microbial Technology Research Institute on July 27, 1990. (Accession number F
ERMP-11633) (i) Immunoglobulin class and subclass The immunoglobulin class and subclass of monoclonal antibody 7E11 was determined using an isotyping kit (Amerjam). The result was 1gG1. The L chain was determined to be ni.

(ii) Determination of specificity The specificity of 7E11 was determined by the test described below.

IJ, DOGL, and DJ created in Step 5 of Example 1
Conventional solid-phase ELIS^ was performed using L. The determination results are shown in the table below.

The results of the second reactivity with 7E11 suggested that the 7E11 antibody according to the present invention specifically recognized the protein corresponding to the APP gene exon 8 tr'll region. The following tests were further conducted on 7E11 to clarify its antigen specificity. For the test, various types of secreted PP (A
PP667, APP648, APP592) were subjected to non-denaturation and 5O5-denaturation treatment, and normal solid-phase ELIS
Judgment was made using Method A. - Next antibody at 2μs/d 7
E1118G, and the secondary antibody was β-galactosidase-labeled sheep F(ab′)! anti-mouse Ig
(Amarjam), 4-methylumbelliphenyl β-D-galactopyranoside was used as the substrate, and fluorescence intensity was measured using a fluorescence reader FCA (PANDF, Company X). The results are shown in the table below.

(Non-denatured) (SO5-denatured) The 7E11 antibody according to the present invention strongly recognized APP667, but did not recognize APP64B and APP592 at all. This also indicates that the 7E11 antibody is specific to the protein corresponding to the APP gene exon 8 region, and recognizes both non-denatured and S[lS denatured proteins.

Solid-phase ELISA was performed according to the Single Clone Antibody Experiment Manual (Kodansha Scientific, written by Sakuji Tomiyama).

APP667 obtained in Step 7 of Example 1 was used as a standard antigen for creating a calibration curve, and the next antibody was 2 μg/dl of 7E111gG.
The secondary antibody used was β-galactosidase-labeled sheep F(ab')z anti-mouse Ig (Amerjam). The results are shown in Figure 6.

Kitaguchi et al.'s method (B, B, R, C,
1663145314591990 and patent application Hei 1-21
Trypsin ELISA was performed according to 4118). APP667 obtained in Step 7 of Example 1 was used as a standard antigen for creating a calibration curve, and the following antibody was 2 μg/wfl of 7E111gG.
The second antibody used was β-galactosidase-labeled sheep F (ab') and anti-mouse RG (Amerjam). The results are shown in Figure 7.

Using the monoclonal antibody 7E11 of the present invention of APPT, cerebrospinal fluid was collected from brains obtained from 3 Alzheimer's disease (AD) patients and 3 patients with cerebrovascular dementia as a control group. An attempt was made to detect APPI in brain cerebrospinal fluid using the method described in Example 4 (trypsin-ELISA). The AD group tended to show higher values than the target cerebrovascular dementia group.

Human brain was subjected to Western blotting for cerebrospinal fluid and various APPs by the method shown below.

Regarding various APPs, APP6 obtained in Example 1 Step 7
67, using 1 μg each of APP64B and APP592, the brain was obtained from one patient with AD and one patient with cerebrovascular dementia. Four times the volume of methanol was added to the cerebrospinal fluid, and the mixture was incubated at -20°C for 11 hours. After standing, centrifugation was performed at 9,000 rpm for 20 minutes to collect the sediment, and then this sediment was
Protein was quantified using samples dissolved in 0mM Tris-HCl (pH 8,0), and 200μg of each sample was added to L
Aemmli's 5DS-PAGE Sambulva Sofa was boiled at 100°C for 13 minutes, resulting in a concentration of 7.5%.
After electrophoresis on 5DS-PAGE, the method of Tosvbin et al. (Towbin et al. Proc.

Natl, Acad, Sci, USA 764
Transfer buffer (350-43541979)
After equilibration in 25mM Tr.
is-HCI (pH 7,5), 500mM NaCl)
After profking in the buffer, monoclonal antibody 7E11 (2 μs/d) according to the present invention was added and reacted for 1 hour at 37°C. After washing with TBS buffer, 37 kB
q"' Il [1iProtein A (Amarjam), and after washing with TBS buffer, autoradiography was performed. Three types of purified A
Only APP667 reacted with 7E11 in PP.

Regarding brain cerebrospinal fluid, a band of about 110 Kd was detected from both AD and cerebrovascular dementia specimens, with AD giving a darker band.

Ascites conversion of APP770 protein using 7E11 Column from MAPSII@Kit (BIO-R
A 7E11 antibody column was prepared by binding the purified 7E11 antibody with cyanide bromine-activated Sepharose (Pharmacia) according to the protocol attached to the kit. The binding method followed the protocol published by Pharmacia. pSVM obtained in Example 1 Step 7
T667 introduced COS cells introduced C S cells M1 on 7E11
After applying to the column and washing with PBS (-), the column bound substance was eluted with 1M potassium thiocyanate.

CentriprepHO" (Amicon), 10% 5O3-PAGE was performed. As a result, it was confirmed that a single band of about 110 Kd was recovered by the 7E11 column. This band was the same as that in Example 7. It was also confirmed by the same Western blotting method.

In addition, human blood diluted 2 times with PBS (-) was ablated, washed with PBS (-), the column bound substance was eluted with 1M potassium thiocyanate, and Centriprep was used.
After concentrating with HlO@ (Amicon), 10% 5O5-
As a result of PAGE, a single band of approximately 110Kd was found at 7
It was confirmed that it was recovered by the E11 column. This band was also confirmed by the same Western blotting method as in Example 7.

[Brief explanation of the drawing]

Figure 1-1 shows brain amyloid precursor proteins APP695, APP751, PP
770 and the structures of APP derivatives IJ, DOGL, and DJL, which include the region near the proteolytic enzyme inhibiting active portion APPI in APP770. The shaded area is a region consisting of 56 amino acids with protease inhibitor activity, and the dotted area is a region unique to APP770.
The region consisting of 9 amino acids, the blacked-out part, indicates the senile plaque amyloid deposited in the brain. In the figure, CHO indicates a sugar chain, and X indicates the absence of a W chain. The numbers in the figure indicate the amino acid residue numbers counted from the N-terminus of APP770. Figure 1-2 shows secreted APP (APP667, APP6
4B, a schematic diagram showing the structure of APP592) The numbers in Figure 0 indicate the numbers of amino acid residues counted from the N-terminus of each APP. Figure 2 shows the 5′ side of plasmid pGBP2 encoding amyloid precursor protein using Mutang@.
This figure shows how TvlJ was obtained by deleting the 3' side. FIG. 3 shows how one strand of TvBBl@DNA hybridizes with oligonucleotides D5 and D3. The deduced amino acid sequence is shown above the DNA sequence, the restriction enzyme cleavage points are shown below, and the position of the primer used for nucleotide sequencing to confirm the deletion is also shown. Figure 4 shows plJ, pSVMT-DJL and psV
Following the signal sequence of tPA, which MT-DOGL has (A
These are the DNA sequence encoding PPI and the amino acid sequence deduced from it. The restriction enzyme site connecting tPA and APP1 portion is shown. Figure 5 shows that after creating pIJ from TvlJ, a mutation was introduced into the APP1 portion, and the vector was returned to pSVMTD.
It shows the steps up to the creation of OGL and pSVMT-DJL. FIG. 6 shows a calibration curve in a solid-phase ELISA system using monoclonal antibody 7E11 of the present invention. FIG. 7 shows a calibration curve in a trypsin ELISA system using the monoclonal antibody 7E11 of the present invention.

Claims (3)

[Claims] (1) A monoclonal antibody specific for at least a portion of a protein containing the amino acid sequence of general formula (I) below. General formula (I): [There is a gene sequence] (However, in the formula, Ala: alanine, Arg: arginine,
Asn; asparagine, Asp; aspartic acid, Cy
s; cysteine, Gln; glutamine, Glu; glutamic acid, Gly; glycine, His; histidine, Il
e; Isoleucine, Leu; Leucine, Lys; Lysine, Met; Methionine, Phe; Phenylalanine, P
ro; Proline, Ser; Serine, Thr; Threonine, Trp; Tryptophan, Tyr; Tyrosine, Val
; indicates each valine residue) (2) A hybridoma producing the monoclonal antibody according to claim (1). (3) A method for detecting APP770 or a fragment thereof using the monoclonal antibody according to claim (1) and subjecting a subject to immunoassay. (However, APP represents the precursor of senile plaque amyloid,
APP770 is a type of APP revealed by Kitaguchi et al. (Kitaguchi et al., Nature) ¥331
¥530-5321988))