JPH04108379A - New superoxide dismutase - Google Patents

Abstract

PURPOSE:To obtain the title superoxide dismutase resistant to protease by adding to any superoxide dismutase a heparin-binding region having a specific amino acid sequence containing arginine or lysine and proline. CONSTITUTION:A protease-resistant peptide with heparin binding ability, having an amino acid sequence of the formula I (X is any amino acid; Y is arginine or lysine in a mutually independent manner; Pro is proline; n is integer: 1-10) is added to any superoxide dismutase (hereinafter referred to as SOD) present in animals such as human being and bovine and other organisms such as plants and microbes. Since the SOD molecule and the heparin-binding peptide constitute a single polypeptide chain, the objective superoxide dismutase can be produced using a gene coding this polypeptide chain. Thereby, the aimed SOD having protease resistance with the heparin-binding region added thereto can be obtained.

Description

DETAILED DESCRIPTION OF THE INVENTION [Prior Art] SOD is an enzyme that decomposes and eliminates superoxide (active oxygen molecules) that is harmful to living organisms, and is present in all organs and intracellular fractions (cytoplasm and mitochondria). but,
Such defense mechanisms are extremely insufficient in cell membranes and tissue extracellular spaces, and therefore oxidative pathological conditions that are extremely dangerous to living organisms sometimes occur in these areas. Traditionally,
Intravenous and local administration of SOD has been attempted to improve these pathological conditions of oxidative tissue damage, but due to their in vivo instability and short half-life (several minutes), their protective effects are limited. It has not reached the point where it can be fully expressed.

Recently, SOD has been subjected to various chemical modifications in order to extend its half-life in the blood. For example, polyethylene glycol (JP 61-249388), polymer dextran (W, F, Petrone et al.,
Proc.

Natl, Acad, Aci, USA, 77, 115
9 (1980)), inulin (JP-A-58-328)
SOD has been modified by methods such as 26). However, these modified SODs have various drawbacks as shown below, and the problems have not yet been sufficiently solved.

In addition, SOD derivatives (SMA-SOD) are produced by bonding styrene maleate butyl ester derivatives (SMA) to enzyme residues through acid amide bonds in order to form complexes with serum proteins mainly composed of albumin in the blood. has also been devised (Masayasu Inoue et al., Protein Nucleic Acid Enzyme, 33, 28
89, (1988)). However, administering non-natural, chemically modified SOD like 2 into the blood may cause unexpected side effects.

[Problems to be Solved by the Invention] As mentioned above, although SOD is effective in removing harmful superoxide radicals, it is not expected to have much medicinal efficacy because it is rapidly excreted after administration.

On the other hand, although SOD modified by various chemical modification methods is stable in blood, it cannot effectively remove superoxide because it cannot be directed specifically to tissues or cells where oxidative tissue damage occurs. Furthermore, since modified SOD is modified with a modifying reagent that does not exist or exists only in a small amount in living organisms, administration of modified SOD may cause side effects. Furthermore, in order to obtain these modified SODs, complicated operations were required, including purifying SOD, chemically modifying it, and further purifying it.

In order to solve these problems, the present inventors previously developed a new superoxide dismutase in which a heparin-binding site was added to superoxide dismutase, which does not originally have a heparin-binding site (Patent application No. 1-52
No. 141). It is made of a substance that exists in the body, has extremely low possibility of side effects, and can specifically protect damaged tissues even in minute amounts. However, a superoxide dismutase with higher resistance to proteases and longer persistence is desired.

Therefore, the present invention provides a novel superoxide dismutase to which a heparin-binding site with protease resistance is added.

[Means for solving the problem] A common feature of many heparin-binding peptides present in living organisms is that they have clusters of basic amino acids (E,
Rauvala, EMBOJ, Dan, 2933-29
41.1989; and S. 5oeda et al., Bioch.
em, Biophys, Acta, 99929-3
5.1989). However, there are many proteases, such as trypsin, that specifically cleave the carboxyl groups of arginine and lysine residues in polypeptide chains. However, when the basic amino acid residue is next to a proline, the peptide is less susceptible to digestion by proteases.

Therefore, as a peptide with heparin binding ability and protease resistance ability, the following general formula:% formula%) (wherein, X is any amino acid, and Y is independently arginine or lysine) is used. , Pro is proline, and n is an integer from 1 to 10). n is preferably 5 or less, for example 2 or 3.

Any superoxide dismutase can be used in the present invention, including animal (e.g. human, bovine)
Any SOD present in living organisms such as plants, microorganisms, etc.
can also be used.

The binding mode between SOD and heparin-binding peptide is as follows:
The amine group of the N-terminal amino acid of the peptide and the C-
There are a method in which the terminal carboxyl group is bonded by an amide bond, a method in which the carboxyl group of the C-terminal amino acid of the peptide and the amino group of the N-terminal amino acid of SOD are bonded by a peptide bond, and the like. In such a binding mode, since the SOD molecule and the heparin-binding peptide constitute a single polypeptide, it can be produced using a gene encoding this.

Since the heparin-binding peptide of the present invention is protease resistant, SOD containing this peptide can be easily purified with good yield. Furthermore, this SOD has SOD activity as expected and also has heparin binding properties. This is also clear from the fact that the peptide of the present invention was adsorbed by a heparin Sepharose column in Example 3.

The present invention will be explained in more detail below using Examples. In this example, an example of a heparin-binding peptide is: A la -Arg -Pro -Arg -Arg
-Pro -Arg -Arg -Pr.

and human red blood cell type SOD is used as the SOD. The heparin-binding SOD in which the Pepti F is bound to this SOD is referred to as r) IB-500-4J.

[Example] Construction of IB-500-4i A base sequence encoding a peptide having an Arg-Arg-Pro repeat sequence was synthesized as a heparin-binding peptide with protease resistance. That is, A343:5 GATCGCCCGTCCTCGTCG
CCCACGTCGACCATGAG3' A344:5”TCGACTCATGGTCGACGT
GGGCGACGAGGACGGGC3'' was synthesized using the method of Ikehara et al.
al, Proc.

Natl, 8cad, Sci, USA, 81.5
956.1984), these four synthetic NAs were phosphorylated and annealed to form pBRsODl (
The resulting plasmid was ligated with a DNA fragment of approximately 4.5 kb digested with BamHr and 5alI (see Japanese Patent Application No. 1-52141) (the method for constructing this plasmid is described in the Reference Examples of this specification). ρBRHBSO
It was set as D4. ρBR) IBSOD4 is S.

The gene in which D and heparin-binding peptide are linked is Eco.
It has a structure cut out by RI and 5 alt (first
figure).

The base sequence of the portion of pBRHBsOD4 encoding HB-SOD-4 and the amino acid sequence encoded by it are shown in FIG.

As described above, the HB-5OD-4 gene having a heparin-binding peptide with protease resistance was constructed.

Example 1 HB-SOD-4 The HB-SOD-4 gene constructed in Example 1 was ligated to a yeast expression plasmid. As a yeast expression plasmid, pYI (CC
See IOI C JP-A-1-37291. In addition, pYHc
One yeast cell transformed with clol was added to the embryo.
It was named SAMO 750 and submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology in 1987.
February 16th, FERM P
-9475), and further in 1990 (1990) 2
Transferred to international deposit as of May 23rd
No. 7 (deposited as FERM BP-2767)) was used.

The approximately 480 bp DNA fragment obtained by digesting pBRHBsOD4 with EcoRI and 5alt was digested with pYI (CCIO
Approximately 8 kb obtained by digesting I with EcoRI and 5alI
The resulting plasmid was named pYsO6000. This plasmid was transferred to E. coli D
Using HI, it was amplified and yeast strain G-1315 (Mat
a, trpl)01. Yoshizumi et al.
,,J,Jpn,Soc,5tarch Sci,3
4.148 (1987)) was transformed. In this case, any (trp 1 ) strain can be used as the yeast strain. The transformation method was the method of Ito et al.
cteriol, 153.163 (1983)).

A transformed strain with recovered tryptophan synthesis ability was obtained.

Hereinafter, this transformed strain was transformed into G-1315 (pYsO600
0) (Figure 3).

The yeast vector described above is an example for producing HB-5on-4, and promoters of genes such as phosphoglycerokinase or repressible acid phosphatase can also be used as yeast promoters.

Obtained transformant G-1315 (pYs06000)
and G-1315 in 2d Harkholder medium (P, R
, Burkholder.

8m, J, Bot,, 30.206. (1943)
) and cultured with shaking at 30°C for 2 nights. After collecting 1.5d, the method of Yaffe et al.
l, Proc, Natl, Acad, Sci, IJSA
,.

81, 4819 (1984)), proteins were obtained from yeast cells and subjected to SDS polyacrylamide gel electrophoresis.

After electrophoresis, protein staining with Comazi Brilliant Blue R250 (for example, Imahori et al., Chemistry of Proteins, Sekisei Chemistry Experimental Course, Tokyo Kagaku Dojin (1987)) revealed that none of the transformed strains contained plasmids. A clear protein band, which is not present in G4315, was observed, and this band corresponds to about 5% of the bacterial protein. This molecular weight was about 19,000 Te, which was almost the same as the expected molecular weight of HB-5OD-4 (D).We also performed Western blotting, used an anti-SOD antibody, and performed an enzyme antibody method [e.g.
Imahori et al., Chemistry of the Protein Award in the Sekisei Biochemistry Experiment Course, Tokyo Kagaku Dojin (1987)) was used to detect a substance that reacted with the antibody, and one band was seen, which was associated with protein staining HB-SOD-4. Since the position of the hand coincided with that thought to be HB-5OD-4, it was concluded that HB-5OD-4 was produced by recombinant yeast.

G-1315 (ρYSO6000) on the purified slant was inoculated into 1 platinum loop and 5 volumes of parkholder medium, and cultured with shaking at 30°C for 40 hours. This was inoculated into a 400d Harkholder medium placed in a 1 liter Erlenmeyer flask and cultured in the same manner. Next, this culture solution was added to 30 liters of Perkholder medium containing 0.1mM copper sulfate and 0.1mM zinc sulfate in a jar fermentor for 4 hours.
It was cultured for 4 hours. Collect bacteria by centrifugation, approximately 1.3 kg
The bacterial cells were obtained.

The bacterial cells were treated with 1H copper sulfate, 1mM zinc sulfate, 10mM β-mercaptoethanol, and 1n+M (rose-amidiphenyl).
Methanesulfonyl fluoride hydrochloride (APMSF)
20mM Tris-HCI buffer pH 8,8,2 containing
The cells were suspended in a liter and crushed using a Dynomill. The crushed bacterial cells were centrifuged, and the centrifuged supernatant was heat-treated at 70 degrees for 10 minutes, centrifuged, and the supernatant was collected. After adding 50% ammonium sulfate to this fraction and dissolving it well, it was centrifuged, and the supernatant was applied to a Butyl Toyo Pearl 650 (2019-So Co., Ltd.) column equilibrated with 20 mM potassium phosphate buffer pH 7.0 containing 50% ammonium sulfate. (5X
20 cm). 20mM potassium phosphate buffer (pH 7,0) containing 50% ammonium sulfate, 500
! After washing the column with Idl, it was eluted with 20mM potassium phosphate buffer containing 30% ammonium sulfate and SOD
Active fraction (activity measurement was performed using the cytochrome C method (J, M, M
cCord et al., J. Biol, Chew.
, 244.6049 (1969)). This fraction was desalted with a 5ephadex G25 (Pharmacia) column (15 x 90 cm), and then
M Tris-HCI (pH 8,5), 30mM N
The electrical conductivity was the same as aC1 by adding NaC1.

This was mixed with 10mM Tris-HCI (pH 8,5),
A column (5X
10C111) to collect the non-adsorbed fraction. An appropriate amount of IM potassium phosphate buffer (pH 7.0) was added to this fraction to lower the pH to 7.0, and then SP Sepharose C equilibrated with 10 mM potassium phosphate buffer (pH 7.0) was added.
Column (5X1) filled with -25 (Pharmacia)
0c1++) and the non-adsorbed fraction was collected. This is 1
It was adsorbed onto a column (5X10C11) packed with heparin Sepharose CL6B (Pharmacia) equilibrated with On+M potassium phosphate buffer (pF17.0).

50mM NaCl, 10mM potassium phosphate buffer (pH
7,0) 500*M NaCl after washing with ld
, 10mM potassium phosphate buffer (pH 7.0). The active fraction was collected and salted out with 90% ammonium sulfate, and the precipitated protein was dissolved in a small amount of water and dialyzed against physiological saline. When this active fraction was subjected to SDS polyacrylamide gel electrophoresis and protein staining as described above, a single band was observed.
Suppose we got . Note that 1(B-5OD-477) was purified at 4°C.

11■ Ball..."Average" ■ Hemostasis I The protease resistance of HB-5OD-4 was investigated. G-
1315 (pYsO6000), G-1315 (p
YHBs2) (pYHBS2 is a plasmid containing a gene encoding a novel superoxide dismutase in which a heparin binding site is added to a superoxide dimutase that does not originally have a heparin binding site. See Japanese Patent Application No. 1-52141. ], and G-13
15 (pYsO200) (pYs0200 is pYHBS
2) A plasmid containing a human superoxide dismutase gene that does not have a heparin-binding site in place of the 1B-5OD-2 gene],
Inoculate a 10 m parkholder medium and incubate at 30°C for 40 min.
Cultured with shaking for hours. Of these, 1.5 d was after bacterial collection;
The method of Yaffe et al. (M.

P,Burkholder, Am,J,Bot,.
30.206. (1943)), proteins were obtained from yeast cells. The remaining 8.5 d is transferred to the bacterial cells after bacterial collection.
The suspension was suspended by adding 0.5 d of NaCl, and further, 0.5 IM of chloroform was added and the mixture was shaken at room temperature overnight. Then, centrifugation was performed and the supernatant was collected.

These proteins were subjected to SDS polyacrylamide gel electrophoresis. The results are shown in Figure 4. When prepared using the method of Yaffe et al., intracellular proteases do not act, so none of the three types of SOD is decomposed or reduced to low molecular weight. However, when chloroform extraction is performed, yeast protease acts, so protease digestion HB-S which is easy to receive
OD-2 is a protein that has been decomposed and reduced to a low molecular weight. However, in SOD and 1 (B-5OD-4, no low molecular weight proteins were observed, suggesting that HB-5OD-4 is more resistant to proteases than HB-5OD-2. .

Next, purified HB-SOD-4 was analyzed for amino acids. The results are shown in Table 1 below. The analytical values showed good agreement with the values expected from the DNA base sequence.

Furthermore, since the absorption spectrum of HB-5OD-4 matched that of recombinant SOD, it is considered to be an active protein containing copper and zinc.

Table 1 Amino Acid Analysis Total RNA was obtained from human placenta using guanidium thiocyanate according to a conventional method. Polyadenylated RNA was separated from total RNA as an mRNA fraction using No. 17 GodT cellulose column chromatography. This RN
Using the A fraction, the method of Gubler et al.
U, et al,, Gene+ 25+ 263(1
Two 1j DNAs were prepared using a cDNA synthesis kit (Amajam) prepared according to the method (983).

DeoxyCTP homopolymer was added to this double-stranded DNA using terminal deoxynucleotidyl transferase (Pharmacia). This and pBR322
E. coli 081 was transformed by annealing Pst with a vector containing a homopolymer of deoxy GTP at one site (Pharmacia), and approximately 400,000 clones of c.
A DNA library was created.

(2) Carving I skin J■1 deletion First, DNA A039 having the following sequence was synthesized as a probe for detecting human 5OD cDNA. Its sequence is 5' GAAAGTACAAAGACAGGAAACG
CTGGAAGTCGTTTGGCTTG3'.

This sequence is based on the already known human soD cDNA base sequence [Sherman et al., Proc.
Natl.

Acad, Sci, USA, 80.5465 (19
83) ) is an array contained in ). Synthesis was performed using an Applied Biosystems 381A DNA synthesizer. This probe was labeled using (T~32P)8TP (Amajam) and T4-polynucleotide kinase, and used as a probe for detecting the SOD gene. By the colony hybridization method, E. coli transformants that hybridize with this probe were transformed into c.
Obtained from a DNA library. This transformant was cultured and grown in a conventional manner, and plasmid DNA was extracted from the bacterial cells. This plasmid contained a 600 bp cDNA of human origin that was excised with PstI. This plasmid was named psOlo. The nucleotide sequence of this inserted portion was determined using the dideoxy method using M13 phage as a template [for example,
Determined according to Takatoshi et al., Laboratory of Biochemical Experiments, Genetic Research Methods (Tokyo Kagaku Dojin (1986)). The determined base sequence matched the previously reported base sequence, but the gene encoding the amino-terminal three amino acid residues was missing.

(3) The following experiment was performed to create the deleted amino terminal gene and start codon of HB-5OD', and the EcoR1 site for linking to Syrah for expression.

Synthetic NA AO71, i.e. 5”GGGGGGGG
GGAATTCATGGCGACGAAGGCCGTG
TGC3' was produced as described above using the Applied Biosystems DNA Synthesizer 381A. Using this synthetic NA as a primer, a 600 bp DNA fragment excised with PstI of psOlo was used as M13mp19.
Using the recombinant single-stranded DNA obtained by cloning into a template as a template, the method of Schiller et al. (M, J.

Zoller et al., Nuc, Ac1d R
Site-directed mutagenesis was generated by ES, +10.6487 (1982)). When we determined the nucleotide sequence of the inserted portion of this mutant, we found that the gene encoding the three amino-terminal amino acids that had been deleted, the start codon, and the EcoR1 site were present, as expected, so we found that the full-length It was found that SOD cDNA was obtained. A recombinant M13 single-stranded DNA containing this mutation was prepared, and P
The 600 bP DNA fragment excised with stl is pUC
Subcloned into the Pst1 site of 9. Among the obtained recombinants, 60 were excised with EcoRI and Pstl.
A plasmid with a 0 bp DNA fragment was designated as ρ50100. A 450bp DNA fragment excised from psOloo with EcoRI and 5au3A1 was inserted into the E of ρBR322.
Subcloned into the coRI and BamH1 sites. This plasmid was named pBR5OD1.

[Brief explanation of drawings]

Figure 1 shows plasmid pBR5 containing the SOD gene.
A heparin-binding peptide is synthesized from OD1 and a synthetic oligonucleotide encoding a heparin-binding peptide.
This shows the construction of plasmid pBR1 (BSOD4) containing DNA encoding SOD added to the terminal. Figure 2 shows the amino acid sequence of SOD (HB-SOD-4) with heparin-binding peptide added of the present invention. and the base sequence of the gene encoding it. Figure 3 shows yeast expression plasmid pYHcc101,
Figure 2 shows the construction of yeast expression plasmid pYsO6000 for HB-SOD-4 from plasmid pBRHBsOD4 containing the gene encoding HB-5OD-4. FIG. 4 shows (A) heparin-binding SOD (H
B-SOD-4), (B) unmodified SOD, and (C)
SOD (HB-5OD-2
) is expressed in yeast. In the figure, lane (1) is the one recovered by chloroform extraction (under the action of yeast protease), lane (2) is
SDS polyacrylamide gel electropherogram of lane (S) molecular weight standard and lane H (untransformed host) when extracted by Jaffe's method (not affected by yeast protease). SB C H5

Claims (1)

[Claims] 1. The following amino acid sequence: ▲ Numerical formulas, chemical formulas, tables, etc. ▼ (In the formula, X is any amino acid, Y is each independently arginine or lysine, and Pro is proline. and n is an integer from 1 to 10).