JPH0394686A - Production of improved dna and production of protein and peptide using the same dna - Google Patents

Abstract

PURPOSE:To obtain DNA capable of being manifested and prepared without changing a promoter by partially replacing a base of either of a base sequence containing a SD sequence or a base sequence to readily form or hardly form a secondary structure from the said base sequence, occurring in the same DNA. CONSTITUTION:A base of either of a base sequence containing SD sequence or a base sequence to readily form or hardly form a secondary structure from the said base sequence, occurring in the same DNA, is replaced with another base and free energy in case of association of these base sequences is increased or reduced to give the objective DNA. The base sequence to readily form the secondary structure has preferably <=-5 to -6kcal/mol free energy in case of association with the base sequence containing SD sequence and the base sequence to hardly form the secondary structure has preferably >=-5 to -6kcal/ mol free energy in case of association with the base sequence containing SD sequence.

Description

DETAILED DESCRIPTION OF THE INVENTION (Field of Industrial Application) The present invention relates to an improved method for producing DNA, and also to a plasmid containing the improved DNA, and further relates to transformation with the plasmid. The present invention relates to a method for producing proteins or peptides using microorganisms produced by microorganisms.

(Prior Art) In recent years, DNAs encoding proteins or peptides such as many useful enzymes and physiologically active substances have been cloned, and these cloned DNAs have been injected into Escherichia coli, Bacillus subtilis, Actinomycetes, fungi, etc. It is now possible to express it using animal cells, plant cells, etc. as hosts.

The expression of these DNAs depends on the copy number of the plasmid containing the DNA and the expression power of the promoter system located upstream of the DNA. Therefore, by changing the copy number of the plasmid and the expression power of the promoter,
Expression of DNA can be regulated, and as a result, the amount of protein or peptide produced can be regulated.

However, in order to change the copy number of a plasmid, it is necessary to modify the gene that controls the copy number using genetic engineering.
It is necessary to use different plasmids, and to change the expression power of the promoter it is necessary to convert the promoter itself. Moreover, although these methods allow for "rough" adjustment, delicate adjustment of the expression level is impossible or extremely difficult.

On the other hand, for example, Kubo et al. (J. Bacteriol. No. 17
Vol. 1, pp. 4080-4082) can reduce the expression of the sequence by replacing the salt of the DNA (structural gene) and making it easier to form a secondary structure within the DNA.
They have also reported that expression of the sequence can be increased by making it difficult to form secondary structures. Therefore, according to this method, it is possible to adjust DNA expression without changing the plasmid or promoter itself.

However, when there are many types of structural genes to be expressed, this method of substituting bases in structural genes needs to be carried out for all of them.

(Means for Solving the Problems) The present inventors believe that if it is possible to adjust the expression of DNA that is deeply involved in the expression of structural genes, such as SD sequences and terminator sequences, we will introduce various structural genes into these sequences. We thought that the expression of a protein or peptide could be regulated simply by connecting it, and we investigated the SD sequence in particular and perfected the present invention. That is, the present invention is directed to
An improved DNA characterized by substituting another base for a base in either a base sequence containing an SD sequence or a base sequence that is easy or difficult to form a secondary structure with said sequence. This is a production method in which bases in a base sequence containing an SD sequence or a base sequence that is easy or difficult to form a secondary structure with the SD sequence present in single-stranded DNA are replaced with other bases. A plasmid containing a DNA sequence substituted with a base, and a base sequence containing an SD sequence that is present in single-stranded DNA, or a base sequence that is easy or difficult to form a secondary structure with the said sequence. This is a method for producing proteins or peptides using a microorganism transformed with a plasmid containing a DNA sequence in which a salt in the base sequence is replaced with another base. The present invention will be explained in detail below.

The SD sequence is generally called the Shine-Dalgarno sequence and is a bosome binding site located upstream (5° side) of the translation start codon (ATG), and the base sequence containing the SD sequence is the SD sequence in DNA. means a part that includes all or part of. In addition, the secondary structure described in this specification is
It is formed within single-stranded DNA, and is not formed between one strand of DNA and other DNA.

The improved method for producing DNA provided by the present invention includes the first
The second step is to replace the bases in the DNA so that it becomes easier to express the DNA.
It consists of replacing the base in NA. The present invention is based on the SD
DN in the relationship between the base sequence containing the sequence and other base sequences
By improving A, that is, by making it easier or harder to form a secondary structure near the SD sequence, the expression of the structural gene located downstream of it can be adjusted as a result. This is because the expression of the SD sequence means that the ribosome binds to the mRNA produced by transcription of the sequence, making it possible to translate from the downstream translation start codon, and therefore, the expression of the SD is regulated. What happens next is the mRNA
This is because it will have a significant impact on the translation of . In other words, if it is made easier to form a secondary structure near the SD sequence, the expression of the DNA sequence will decrease as a result, and if it is made difficult to form a secondary structure, the expression of the DNA sequence will increase.

The first method for producing DNA that is easily expressed is, for example, in a base sequence that is present in a single-stranded DNA and that includes an SD sequence or a base sequence that is likely to form a secondary structure with the base sequence. This consists of replacing the base with another base to make it difficult to form a secondary structure, that is, to increase the free energy when these base sequences pair. In addition, the second method for producing DNA that is difficult to express is, for example, single-stranded DNA.
Substituting a base in either a base sequence that includes an SD sequence or a base sequence that is difficult to form a secondary structure with the base sequence with another base to facilitate the formation of a secondary structure. In other words, it consists of reducing the free energy when these base sequences pair.

Here, a base sequence that easily forms a secondary structure means that the free energy when paired with a base sequence containing an SD sequence is -5
~-6kcal/mo 1 or less, preferably -6kc
al/mol or less, and base sequences that are difficult to form secondary structures have free energy of -5 to 6 kcal/mol.
1 or more, preferably -5 kcal/mol or more. These findings were reported by ■Y, Hibino et al.
gric. Biol. Chem. Volume 52, page 329, 1988), ■P. Stanssens et al.
e, Volume 36, Page 211, 1985), ■Y, Xj
an-Ming et al. (J. Mol. Biol. Vol. 172, p. 355, 1984), H. Shimotu et al. (J. Bacter Lol. Vol. 166, p. 461,
1986), ■M. N. Ha 1 1 et al. (Nat
ure, Vol. 295, p. 616, 1982), ■R
．． A. Hallewell et al. (Nucleic Ac
ids Res, Volume 13, Page 2017, 1985
year), ■K. C. Cone et al. (Mo 1, Bio
l. Volume 186, page 733, 1985), ■N.
This is supported by the report of Lee et al. (Gene, Vol. 58, p. 77, 1987). Figure 1 shows the relationship between free energy and protein expression level reported in these papers ① to ②.

The free energy of a base sequence is Tinoco,! (Nature, Vol. 246, pp. 40-41, 19
For example, commercially available computer programs (Mitsui Information Co., Ltd., GE
It can also be known by using NIAS) etc.

The PAIA sequence including the SD sequence and the base sequences that tend to form secondary structures with the sequence or that are difficult to form each have about 20 bases, preferably about 15 bases, with or without sandwiching non-pairing bases (base sequences). A base sequence containing bases that pair completely or imperfectly (here, pairing refers to the hydrogen bond between a base with adenine and a base with thymine, or between a base with guanine and a base with cytosine). meaning).

The first method is a base sequence containing an SD sequence or a base sequence containing the sequence.
5 to -6 kcal/mol or less 1 preferably -6 kcal
Substituting a base in any base sequence that is likely to form a secondary structure that pairs with a free energy of l/mol or less, and the free energy is -5 to -6k c
a l /mo 1 or more 1 preferably -5 kcal/m
This is a method for producing a DNA sequence that is easy to express, which consists of converting the base sequence into a base sequence that is difficult to form a secondary structure of ol or higher.

Here, D
Free energy is -4kcal to produce NA
It is preferable to set the amount to be about /mol or more. In addition, in the first method, by substituting bases in the base sequence that are difficult to form a secondary structure of -5 kcal/mol or more and further increasing the free energy, DNA can be more easily expressed.
can be manufactured.

The second method is a base sequence containing an SD sequence or a base sequence containing the sequence.
5 to -6k cal/mo 1 or more, preferably -
Substituting a base in any base sequence that is difficult to form a secondary structure that pairs with a free energy of 5 kcal/mol or more, and the free energy is -5 to -
6kcal/mol or less, preferably -6kcal/m
This is a method for producing a DNA sequence that is difficult to express, which consists of converting a base sequence that is easy to form a secondary structure below ol.

Here, D
Free energy is -7 kcal to produce NA
It is preferable to set the amount to be about mol/mol. In addition, in the second method, by substituting bases in the base sequence that are likely to form secondary structures of -5 to -6 kcal/mol or less, and further reducing the free energy, it is possible to create DNAs that are more difficult to express.
A can be manufactured.

By the way, the DNA of the SD sequence or the promoter, operator, etc. located upstream thereof consists of a highly conserved base sequence, and if a base in the base sequence is replaced, the activity may be lost. Therefore, if there are multiple base sequences that are easy or difficult to form secondary structures with the base sequence containing the SD sequence, the conserved D
It is preferable to perform base substitution on a base sequence that does not contain an NA portion. Usually downstream (3' side) of the SD sequence
The translation start codon (ATG) is located in the , and the structural gene is located further downstream, so if these sequences also exist downstream of the structural gene SD sequence, the downstream nucleotide sequence will be preferentially It is recommended to perform base substitution. In this case, it is preferable to ensure that the primary structure of the protein or peptide encoded by the structural gene is not affected by the base substitution.

The above-mentioned method for producing DNA that is easy to express or difficult to express is based on at least one of the base sequences that include an SD sequence or the base sequences that are easy or difficult to form a secondary structure with the SD sequence. It is sufficient if base substitution is carried out, but
Depending on the case, it may be performed for both base sequences. In addition, sometimes a new base sequence appears in the produced DNA that is easy or difficult to form a secondary structure with the SD sequence due to base substitution. Therefore, when producing DAN according to the present invention, the produced DNA
It is also good to consider.

The improved method for producing DNA of the present invention is a method consisting of substituting a base in a base sequence existing in a single-stranded DNA. In this way, D
A method for substituting a base in NA with another base is, for example, site-directed mutagenesis method (site-directed mutagenesis method).
-mutagenesis), etc. In particular, by cloning the DNA to be substituted with a base into a single-stranded DNA such as M13 phage, and annealing the partial DNA in which the target base has been replaced with another base, this is used as a primer to generate the full-length DNA. Techniques such as producing DNA are useful.

A plasmid for expressing proteins, peptides, etc. can be obtained using the DNA produced by the method of the present invention, which has been improved to be easily or difficult to express. Here, the plasmid itself may be one that is used in normal genetic engineering. In general, expression plasmids for producing proteins, peptides, etc. are selected in relation to the host used, and are used to express genes for replication, genes for resistance expression, SD sequences, and downstream gene groups. That is, it ultimately includes genes such as a control gene system such as a promoter/operator that instructs the translation of a structural gene into a protein, and a terminator sequence that instructs the termination of transcription of the structural gene.

The method for constructing the plasmid itself may be based on conventionally known techniques, such as using various restriction enzymes to create cohesive ends that match the two DNA sequences to be joined, and joining the ends. For example, the DN to be combined
2 by forming a blunt end in A and introducing a linker into the end.
It is also possible to use techniques for joining DNA sequences.

In the present invention, base substitution is performed on single-stranded DNA, and therefore, the produced DNA is single-stranded DNA in which at least - bases have been substituted. By the way, in conventional methods for producing proteins or peptides, double-stranded DNA is usually used. Therefore, the DNA produced by carrying out the present invention can be converted into double-stranded DNA.
In order to incorporate the DNA into the plasmid of A, it is necessary to make the DNA into double strands before the DNA-to-DNA binding operation using restriction enzymes or the like.

In order to make single-stranded DNA double-stranded, the manufactured DNA must be
DNA complementary to the sequence may be prepared using A as a template, and these may be annealed. For these operations, conventional methods in the field of genetic engineering can be used.

When DNA improvement is carried out using M13 phage as described above, the improved DNA can be selectively obtained as single-stranded or double-stranded DNA. Therefore, M1
DNA improved by carrying out the present invention using 3 phages
By producing this, it is possible to obtain DNA produced in either single-stranded or double-stranded form.

(Effects of the Invention) According to the present invention, DNA that is easily expressed or difficult to express can be produced. Furthermore, by using a plasmid containing DNA produced according to the present invention, it is possible to produce proteins or peptides with their expression regulated.

This means that gene expression, which could previously only be controlled by adjusting the plasmid copy number and promoter expression strength, or the production of proteins, etc., can be controlled within a more delicate range, and moreover, using the same promoter plasmid. However, it makes it possible to achieve this goal. Moreover, since the present invention provides DNA with improved expression, for example, a plasmid with recognition sites for appropriate restriction enzymes introduced upstream and downstream near the SD sequence is prepared and subjected to various improvements. SD
If sequences can be linked, it is also effective for searching for optimal conditions for the expression of a type of protein.

According to the method of the present invention, in DNA substituted with a base sequence that is likely to form a secondary structure, secondary structure is likely to be formed near the SD, and its expression is decreased, resulting in a decrease in the expression of downstream DNA. In addition, in a DNA substituted with a base sequence that makes it difficult to form a secondary structure, it becomes difficult to form a secondary horizontal structure near the SD, and its expression increases, resulting in an increase in the expression of downstream DNA.

(Examples) Examples will be described below to explain the present invention in more detail, but the present invention is not limited to these Examples.

In the Examples, operations (1) to (3) below were performed according to the following methods unless otherwise specified.

(1) Cleavage of DNA sequences with restriction enzymes and its recovery When cutting DNA sequences with restriction enzymes, 2 units/μ
The treatment was carried out using 1 of DNA restriction enzymes at 37° C. for 90 minutes.

The cut DNA sequence was recovered using TE buffer (10
m M }Lis hydrochloric acid (pH 7.4) and 1mM EDTA
After extraction with phenol saturated with 20% ether (containing ), ether was added to remove the phenol layer, twice the amount of ether was added, and the mixture was left at -20°C for 30 minutes, followed by centrifugation.

(2) Connecting the cut DNA sequences The two DNA sequences to be connected were added to 5 μl of buffer (6.5 m
100mM containing MgC 12}lithic hydrochloric acid (pH
7.6)) and a commercially available DNA ligation reagent (Takara Shuzo Co., Ltd.).
The reaction was carried out at 16° C. for 30 minutes using L'igation kit (manufactured by Co., Ltd.).

(3) Transformation of E. coli JM103 strain was used as E. coli. Incubate strain JM103 into 4 ml of LB-Pross medium (0.1% tributophane, 0.5% yeast extract, 0.5% NaCl),
After culturing overnight, the cells were transferred to 50 ml of LB-broth and cultured for 2 hours. After culturing, collect the E. coli bacteria, suspend in 25 ml of calcium chloride solution, cool in water for 30 minutes, collect the bacteria, and add 5 ml of the bacteria.
O.C. in which contiguous cells and plasmids were dissolved by suspending them in 50mM calcium chloride solution. IM Tris-HCl (pH
7.2) Mix with 10 μl and cool with water for 40 minutes, then incubate at 42℃ for 2 hours.
Treat for 37 hours, add 1.5 ml of LB-broth,
The cells were incubated at ℃ for 2 hours. 0.1 ml of the obtained bacterial cell suspension was placed on LB agar medium (LB-
The cells were cultured overnight in 2.0% agar) to obtain transformed bacteria.

Example 1 The following artificially synthesized DNA fragment, plasmid pKYU22, based on the description in JP-A-61-181377
(Feikoken Bibori No. 8041), plasmid pTcM1
(Feikoken Bibori No. 7779) and commercially available plasmids (P
harmacia PL Biochemica
ls; pKK223-3), from the upstream side tac promoter/operator 1ac SD and C230
(Metapyrotechase) SD sequence, natural type 1-20
A commercially available plasmid (Pharmacia P-LBioc) containing a prourokinase structural gene in which the amino acid No.
The transcription terminator (rrB, Tl, T
A plasmid pMUTBS containing 2) was prepared.

Synthesized DNA fragment; 5-C ATGAGCAATGAAC
TTCATCAAGTTCCAT 3-TCG
AG TACTCGTTACTTGAAGTAGTT
pMUTB, shown in Figure 2 of CAAGGTA 5
When we examined the SD sequence of S and the salt sequence that could form a secondary structure with the DNA in its vicinity, we found that
Thirteen salt-crossing sequences from 8th (A) to 40th (G) were found. This base sequence has an unpaired fourth base.
-10.2 kcal/mo with 16 base sequences from 63rd (C) to 78th (T) sandwiching 22 base sequences from 1st (A) to 62nd (A).
A secondary structure is formed with free energy of l (Figure 3).

In order to improve the expression of the prourokinase structural gene without changing the promoter/operator in pMUTBS or the genes involved in the copy number of the plasmid, bases in the base sequence that could form the secondary crosslinker were substituted.

First, a DNA synthesizer (manufactured by Applied Biosystems, model 380B DNA synthesizer)
r) was used to synthesize the following DNA.

■; (5' side) 1 5 to 15 20
25 29CATGAGCAACGAGC
TCCACCAGGTTCCGT＊＊＊＊＊
* (3' side) ■; (5' side) 1 5 10 15 20 2
5 3G 35CGACGGAACCTGGT
GGAGCTCGTTGCTCATGACGT book
Book Book Book Book Book (3″ side) The DNA fragment marked ■ has a base sequence that is complementary to the 80th to 46th base sequence of the DNA sequence shown in Figure 2, except for the bases marked with *. And the DNA fragment of ■ is the DNA of ■
This is a DNA sequence that is complementary to the 3rd to 31st base sequence of the A fragment.

In addition, the bases marked with * in the DNA sequence of ■ are bases substituted to increase free energy, and according to the substitution of bases, the matching salts l&(* ) have also been replaced.

This base sequence has a free energy of Okcal/mO1 and is a base sequence that is difficult to form secondary structures (Figure 4).
.

The synthesized ■ and ■ are annealed to form double-stranded DNA.
Fragment the previously prepared pMUTBS with the restriction enzyme Aat
Fragment exchange was performed by mixing the digested fragments digested with II and Taq I.

As described above, D consisting of the base sequence shown in FIG.
Obtain plasmid pMUTRE with NA and pMU
It was used in the following examples along with TBS.

Example 2 Escherichia coli strain JM109 was transformed with the plasmids pMUTBS and pMUTRE prepared as in Example 1, and cultured in LB medium to produce prourokinase.

Regarding the produced prourokinase, the bacterial cells were crushed and refolded according to the method described in JP-A-56-161321, and human plasmin was reduced to 0.07.
After activating the mixture by adding 5 (CU) units and converting it into urokinase having thrombolytic ability, the degrading activity against a synthetic substrate (S2444, manufactured by Daiichi Kagaku Yakuhin Co., Ltd.), which is a substance of urokinase, was measured. The results are shown in Table 1.

Table 1 Free energy activity of plasmid SD sequence (kca
l/mol) (U/ml)pMUTRE
0 450pMUTBS
-10. 2 110 According to Table 1, the plasmid pMUTR contains a DNA that is easily expressed by replacing some bases in the base sequence that is likely to form a secondary structure with a base sequence that includes an SD sequence that is present in the structural gene.
In E, compared to the plasmid pMUTBS before conversion,
It can be seen that about 4 times as much pro-urokinase is expressed.

[Brief explanation of drawings]

FIG. 1 shows the relationship between free energy and protein expression as described in the literature described in the Detailed Description of the Invention section. In the figure, the numbers attached to the plots correspond to the numbers of the documents described. In Figure 1, the expression rate is high when the free energy is -5 to -6 kcal/mol or more, and the free energy is -5 to -6 kcal/mol.
It is supported that the expression rate is low when the cal/m o is about 1 or less. FIG. 2 shows a nucleotide sequence that is likely to form a secondary structure with the SD sequence and a nucleotide sequence containing the SD sequence in the DNA for expressing prourokinase in the plasmid pMUTBS. In the figure, the SD sequence derived from C230 is shown with a straight line, and the translation initiation codon is shown with a double straight line. Figure 3 shows the base sequence containing the SD sequence and the salt bracket sequence that is likely to form a secondary structure with the SD sequence, which is present in the single-stranded DNA that encodes the information in the DNA shown in Figure 2. It shows the secondary structures that can form. FIG. 4 shows the base sequence of the DNA produced in Example 1 of the present invention and improved to facilitate expression. In the figure, the bases marked with * indicate the substituted bases in Example 1. In addition, in FIG. 3 and FIG. 4, the base sequence is shown when it is transcribed into mRNA.

Claims (8)

[Claims] (1) Substituting a base in a base sequence that includes an SD sequence or a base sequence that is easy or difficult to form a secondary structure with the SD sequence, which exists in the same DNA, with another base. An improved method for producing DNA, characterized by: (2) Substituting a base in either a base sequence that includes an SD sequence or a base sequence that is likely to form a secondary structure with the SD sequence that exists in the same DNA with another base, and these base sequences The method according to claim 1, characterized in that the free energy in the case of pairing is increased. (3) Substituting a base in either a base sequence that contains an SD sequence or a base sequence that is difficult to form a secondary structure with the SD sequence that exists in the same DNA with another base, and this base sequence The method according to claim 1, characterized in that the free energy when paired is reduced. (4) A base sequence that is likely or difficult to form a secondary structure with a base sequence containing an SD sequence in DNA is a base sequence that exists in a structural gene downstream of the SD sequence, and the base substitution is a base sequence that is present in a structural gene downstream of the SD sequence. The method according to any one of claims (1) to (3), characterized in that the method is carried out on a base sequence within. (5) Claim (4) characterized in that the base substitution carried out in the base sequence within the structural gene does not involve a change in the primary structure of the protein or peptide encoded by the structural gene. ) Method described in section. (6) Base sequences that tend to form secondary structures have free energies of -5 to -6 when paired with base sequences containing SD sequences.
kcal/mol or less, and the base sequence that is difficult to form a secondary structure is characterized by having a free energy of -5 to -6 kcal/mol or more when paired with a base sequence containing an SD sequence. The method according to any one of paragraphs (1) to (4). (7) Any base sequence that exists in the same DNA that includes an SD sequence or a base sequence that is likely or difficult to form a secondary structure with the SD sequence is replaced with another base. A plasmid containing a DNA sequence. (8) A base sequence that exists in the same DNA that includes an SD sequence or a base sequence that is easy or difficult to form a secondary structure with the SD sequence is replaced with another base. A method for producing a protein or peptide using a microorganism transformed with a plasmid containing a DNA sequence.