JPH0387197A - Novel physiologically active polypeptide - Google Patents

Abstract

NEW MATERIAL:A polypeptide of an amino acid sequence of the formula. USE:An antitumor agent, etc. PREPARATION:A recombinant microorganism cell transformed with a recombined plasmid containing a DNA region coding the polypeptide of the formula is cultured, and the polypeptide produced and accumulated in the cultured product is isolated.

Description

Detailed Description of the Invention <Industrial Application Field> The present invention relates to a novel physiologically active polypeptide, a recombinant plasmid containing a DNA region encoding the polypeptide, a recombinant microbial cell transformed with the plasmid, and a recombinant microbial cell transformed with the plasmid. The present invention relates to a method for producing a new bioactive polypeptide using microbial cells. More details ln la lu Va Sp sn he Tyr Sep-Pro-Cys Pro-G lu-G IV Prfl-Trl)-T Vr leu-G IV-G IV G lu-L Vs-G ly Alternatively, a novel polypeptide having antitumor activity (hereinafter referred to as
(sometimes abbreviated as "novel antitumor active polypeptide"), 11 recombinant plasmids containing the DNA region encoding the polypeptides, recombinant microbial cells transformed with the plasmids, and novel antitumor cells using the microbial cells. The present invention relates to a method for producing active polypeptides.

In this specification, amino acids and polypeptides are referred to as IUPA
(, - IUB Committee on Biochemistry (CI3N)'r It shall be abbreviated according to the adopted method, for example, the following abbreviations are used.

AIaL-Alanine AraL-Arginine Asn1--Asparagine ASr) L-Aspartic acid CVSl-m-Cysteine Qln L-Glutamine GluL-Glutamic acid Gly Glycine is L-Histidine 11e'L-Isoleucine 1-eul-Monoleucine LysL-Lysine Met L-medionine phel--phenylalanine prol--proline 3er L-serine 1hrl--threonine Trl) L-tryptophan Tyr L-tyrosine Vall--valine Also, the sequence of DNA is included in each deoxyribonucleide that makes it up. [L is abbreviated as type 3,
For example, use the following abbreviated months.

A adenine (indicates deoxyadenylic acid) C cytosine (indicates deoxycytidylic acid) G guanine (indicates deoxyguanylic acid) T amino (indicates deoxydemidylic acid) Furthermore, (2N) - and -(COO
1") indicate the amino terminal side and the carboxy terminal side of the amino acid sequence, respectively; (5')- and <3'
> indicates the 5' end and 3' end of the DNA sequence, respectively.

BACKGROUND OF THE INVENTION Carswell et al.
We discovered that serum collected after administering endotoxin to mice that had been previously stimulated with etteGuerin (BCG) contained a substance that causes hemorrhagic necrosis of cancer caused by transplanted Meth. Tumor necrosis factor
FaCitOr (hereinafter sometimes abbreviated as TNF)
named [E, A, CarsWell et al.+'
proc, N atl.

Acad, Sci, LISA, 72.3666 (1
975)], this TNF is found in many animals such as mice, rabbits, and humans, and since it acts specifically on tumor cells and across species, it has been expected to be used as an anticancer agent.

More recently, Pennica et al.
We carried out CD N A cloning of F and clarified the primary structure of human TNF protein, and reported on the expression of [Norhi h TN F M Nobuko] in Escherichia coli [
D, P [1niCa et al., Nature
, 312. 724 (1984)]. after that,
Shirai et al.

Nature, 313. 803 (1985)
], Munemura et al. [Ieso et al., Cancer and Chemotherapy, 12. 16
0 (1985)], Wana et al.
et al., Science, 228. 149 (19
85)] and Marmenout et al. [A,
M armenout et al.

Eur, J., [3iochem,, 152. 5
15 (1985)] subsequently reported on the expression of the human TNFI gene in E. coli.

As described above, by using genetic engineering techniques, it has become possible to obtain pure human TNF protein in large quantities, and the physiological activities of TNF other than its antitumor activity are becoming clearer. For example, cachectin, which is one of the causes of cachexia seen in patients with terminal cancer or severe infections, is very similar to TNF [B, B eul
ter et al., Nature.

Yu16. 552 (1985)], since cachectin influences lipoprotein lipase inhibitory activity,
The administration of TN increases the amount of triglycerides in the blood,
It was suggested that this may result in side effects such as hyperlipidemia. In addition, there are also effects on vascular endothelial cells [J, R.

Gamble et al., J. Exp. Med, 16
2.21t33 (1985)], bone resorption effect [D,
R, Beltolinl et al., Naturc,
319. 516 (198(3))] etc. have been reported.

On the other hand, recent advances in genetic engineering technology have made it possible to substitute, add, or delete any amino acid in a protein with another amino acid.

In this way, many studies are underway to create new proteins that serve specific purposes by modifying naturally occurring proteins.

Several studies have been carried out on the modification of the human TNF protein. substitution with other amino acid residues (PCT
Application publication W08G/No. 04606, patent application No. 61106
772), substitution of GIV” with other amino acid residues (
Patent Application No. 1983-106772, Patent Application No. 1983-23804
No. 8).

Substitution of AlB12 with other amino acid residues (patent application Sho 612)
No. 33337) has been reported. In addition, regarding deletion of amino acid residues on the amino terminal side, 6 amino acid deletion TN
F has cytotoxic activity (Japanese Patent Application Laid-open No. 61-50
923 Bow>, 7 amino acid deletion TNF has cytotoxic activity (Patent Application No. 1987-90087), 1-10
Amino acid deletion TNF has m cell-damaging activity, and its specific activity is maximum in 6- and 8-amino acid deletion TN (PCT application publication W 08B/02381)
, that 10 amino acid deleted TNF has cytotoxic activity (Japanese Patent Application No. 114754/1982), and that 11 amino acid deleted TNF has cytotoxic activity (Japanese Patent Application No. 173822/1982). ) has been reported.

Therefore, the present inventors have conducted intensive research on modification of human TNF protein with the aim of improving specific activity, improving stability, broadening the reaction spectrum, and reducing side effects.
The present invention has now been completed.

<Object of the Invention> An object of the present invention is to provide a novel polypeptide with antitumor activity.

Another object of the present invention is to provide a recombinant plasmid containing a DNA region encoding a novel antitumor active polypeptide.

Still another object of the present invention is to propose a method for producing a novel antitumor active polypeptide using a recombinant microorganism transformed with the above recombinant plasmid and the recombinant microorganism cells.

Still other objects of the present invention will become clearer from the following description. 12N) -Pro-Asp-AS
l) cyspro-Val-81a-1-1i
s -V at -V al-81aA sn -P
ro -Q In -A la -Q lu -Q 1
y-Q InL eu -G In -T rp-L
eu-to sn-to rg-ArgA 1a-Asn-A
la -1eu゛-L eu-A la -AsnGu
y-Val-Qlu-leu-Arg-Asp-Asn
G In-1-eu -Val-Val-Pro
-3er-Q luGly-1-eu-Tyr-1eu
-I 1e-Tyr-8erG In -V al-
L eu -P he -L ys-G Iy -G
InGIV-Cys-Pro-3er-Thr-l-l
is-VaLeu-Leu-Thr-l-1is-Th
r-11e-3erArG-Tle-Ala-Val-
3er-Tyr-QlnThr-Lys-Val-As
n-L eu -L eu-8erAla -I Ie
-Lys-8er, -prO-CVS-GlnA
r(1-G lu-T hr-Pro-G lu-
G ly-A 1aGIIJ-A la-LMS-Pr
o-Trll-TVr-QluPrO-11e-TVr
-LOu-GIV-GIV-VaP he -G In
-L eu -G lu -L Vs -G Iy-
A 5t)Arc-Leu-3er-Ala-Glu-
11e-AsnA rg-Pro ro-A sp-T y
r-L eu-A sp-P heA la-G lu
-S er-G ly-G In-V al-T yr
Phe-Gly-Ile-11e-Ala-Leu(
C0,0+-1) or a polypeptide having Met bound to its amino terminus.

Also, a DN encoding the above-mentioned novel antitumor active polypeptide or a polypeptide having Met bound to its amino terminus.
Includes a recombinant plasmid containing the A region.

As a recombinant plasmid, the following base sequence (5')-
To CCGG8CG C A A G CCT G T A G CCCA T
G T T G TAG CA AA CCCT C
A A G CT G A G GG G CA G
CT CCA G T G G CT G AΔCCG
CCGGGCCAATGCCCTGCTG G CCA
A T G G CG T G G A G C1-
G AG A G A T A A CCA G CT
G G T G G T ACCATCAGAGGG
CCTGTACCTC8TCTACTCCCAGGTC
TOCTCTTCAGGGCCCAAGGCTGCCCGT
CGACCCATGTGCTCCTCACCCACAC
CATCAGCCGCATCGCCG T CT CC
T A CCA G A CCA A GGTCAAC
CTCCTCTCTGCGATCAAGAGCCCCT
GCCAGAGGGGAGACCCCAGAGGGGGGC
TGAGGCCAAGCC8TGGTATGAGCCC
ATCTATCTGGGAGGGGTCTT CCA
G CT G G A G A A G G G T
G A CCGACTCAGCGCTGAAATCAA
TCGGCCCGACTATCTCGACTTTGCC
GAGTCTGGGGCAGGTCTACTTTGGGA
A single-stranded DNA complementary to a single-stranded DNA represented by TTATTGCCCTG-(3')
Examples include plasmids containing double-stranded DNA consisting of A.

Or the following base sequence (5')-CATCATAACGG TTCTGGCAAATATTCTGAAATGAGC
TGTTGACAATTAATCATCGAACTAG
A to TTAACTAGTACGCAAGTTCACGT
To AGGGTATCGATATGCCGGACGAC
AAGCCTGTAGCCCC to TGTTGTGCAA
ACCCTCAAGCTGAGGGGCAGCTCCA
GTGGCTGAACCG CCG GG CCA
A T G CCCT G CTGGCCAATGGC
GTGGAGCTGAGAGATAΔCCAGCTGG
TGGTACCATCAGAGGGCCTGTACCT
CAT C-r A CT CCCA G G T
CCT CTTCAAGGGCCΔAGGCTGCCC
GTCGACCCATGTGCTCCTCACCCAC
ACCATCAGCCGCATCGCCGTCTCCT
ACCAGACCAAAGGTCAACCTCCTTC
TGCGATCAAGAGCCCCTGCCAGAGG
GAGACCCCAGAGGGGGGCTGAGGCCA
AGCCATGGTATGAGCCCATCTATCT
GGGAGGGGTCTTCCAGCTGGAGAAG
GGTGACCG A CT CA G CG C1-
G A A AT CA AT CG G CCCG
A CT AT CT CG A CTTTGCC
GAGTCTGGGGCAGGTCTACTTTGGGA
TTATTGCCCTGTGATAAGCI-T-(3
Examples include plasmids containing double-stranded DNA consisting of a single-stranded DNA represented by ' ) and a single-stranded DNA complementary to the single-stranded DNA.

More specifically, plasmid 1) TNF604 can be mentioned.

The present invention encompasses a recombinant microbial cell transformed with a recombinant plasmid containing a DNA region encoding the above-mentioned novel physiologically active polypeptide or a polypeptide having Met bound to its amino terminus. Here, the microbial cell is ■ Schierichia coli ([g
cot i ).

The present invention involves culturing recombinant microbial cells transformed with a recombinant plasmid containing a DNA region encoding the above-mentioned novel physiologically active polypeptide or a polypeptide having a lylet linked to its amino terminus. The present invention includes a method for producing a novel bioactive polypeptide, which is characterized by producing and accumulating the bioactive polypeptide and separating the novel bioactive polypeptide from the resulting culture.

The present invention includes a pharmaceutical composition containing an antitumor-effective amount of the above-mentioned novel physiologically active polypeptide or a polypeptide having Met bound to its amino terminus.

The present invention will be explained in more detail below.

(A) Cloning of the human TNF gene; human TNFJ Nobuko has cloned the amino acids that constitute the human TNFI white matter [
[), p0nniCa et al., it can be obtained by selecting an appropriate one from among the above-mentioned ]tons and chemically synthesizing it. When constructing the human TNF gene, it is desirable to select codons that are most suitable for the host cell used, and to set cleavage sites with appropriate restriction enzymes at appropriate positions to facilitate subsequent cloning and genetic modification. (It is desirable to do so.

Furthermore, it is preferable that the DNA region encoding the human 1 to TN Fl white matter has a translation initiation codon (ATG) in the upstream direction with a matching reading frame, and a translation initiation codon (ATG) with matching reading frames in the downstream direction. translation stop codon (TGA).

It is preferable to have TAG or TAA>.

The above translation stop codon is used to improve expression efficiency.
It is particularly preferable to link two or more genes in tandem.Furthermore, this human TNF gene can be cloned into an appropriate vector by using the cleavage sites of restriction enzymes that act upstream and downstream thereof. An example of such a nucleotide sequence of the human TNF gene is shown in FIG.

To obtain the human TNFI signal designed as described above, each of the upper and lower strands is divided into several oligonucleotides as shown in Figure 2, and these are chemically synthesized. It is desirable to use a method of linking each oligonucleotide. The synthesis method for each oligonucleotide is the diester method [1-1, G, Khora
na.

“3 ome Recent [) evelop
ments in Chemtstry of p
hosphate E 5ters of3 i
logical interest”,
John W 1leyand 5ons,
Inc., New York (1961)]
.

Triester method [R, L, Letsinger et al., J.

Am, Chem, Soc, 89.4801 (
1967)] and the Bosphite method [M, D, Ma
tteuccI et al.

Tetrahedron LctN, 21. 7
19 (1980)], but synthesis by the bosphite method using a fully automatic DNA synthesizer is preferred from the viewpoint of synthesis time, yield, simplicity of operation, etc. To purify the synthesized oligonucleotide, gel filtration, ion exchange chromatography, gel electrophoresis, high performance liquid chromatography using a reversed phase column, etc. can be used alone or in combination.

The hydroxyl group at the 5' end of the synthetic oligonucleotide thus obtained is phosphorylated using T4-polynucleotide kinase, then annealed and ligated using, for example, T/l-DNA ligase. One way to create a human I-TNF signal by linking synthetic oligonucleotides is to divide the synthetic oligonucleotides into several blocks and link them together, for example, pBR32.
2 [F, Bolivar et al., Gene,
2. 95 (1977)].
A preferred method is to clone the DNA fragments multiple times and then ligate the DNA fragments of each block. A plasmid containing a DNA fragment of a block constituting the human TNF gene is preferably pTNF1BR.

pTNF2N or pTNF3 is used.

The human TNF gene cloned as described above was
4. After ligating the DNA fragments of each block, an expression type gene can be obtained by ligating the DNA fragments downstream of an appropriate promoter and SD (Sea in Dalgarno) sequence. As a promoter that can be used, tryptophan operon promoter (trp promoter)
.

Lactose operon promoter (lac promoter), tac promoter, PL promoter,
Examples include lpp promoter, but especially Lttr
The p promoter is preferred. As a plasmid having a trp promoter, 1) YS3IN or pΔA41 is preferably used.

Furthermore, with the aim of improving expression efficiency, we added a terminator downstream of the human TN gene that functions efficiently in E. coli!
-3′? I can. Terminator like this
Examples include 1pp terminator, TRP A terminator, etc., but TRP A terminator is particularly preferred, and rlA A 41 is preferably used as the plasmid for trpA terminator. This expression type of human l-TNF gene can be traced to l
] By cloning into the BR322 vector, an expression plasmid can be created. Human TNFm Nobuko expression plasmid, preferably pTNF401N
N or 1) TNF401A is used.

(B) Cloning of a novel anti-tumor active polypeptide gene: The thus obtained Hi1"T N F M trochanter expression plasmid was cut with an appropriate restriction enzyme to clone a specific region within the Hi1 to TN"Donobuko. After removing the amino acid, the gene is repaired using a synthetic oligonucleotide with an appropriate base sequence.By using this method, any amino acid in the human TNF protein can be replaced with another amino acid, or any amino acid can be added. It becomes possible to create an expression plasmid containing a gene encoding the new antitumor active polypeptide in a deleted form.As such a novel antitumor active polypeptide gene expression plasmid, Preferably DTNF
416. pTNF416A or 1) TNF476 is used.

(C) Expression confirmation and activity evaluation: Examples of microbial hosts for expressing the TN F gene and the novel antitumor active polypeptide gene include Escherichia coli, Bacillus subtilis, and yeast, but especially Escherichia coli. [Escherichia coli (Escherichia c.
oli)] is preferred. The human TNF31 gene expression plasmid and the novel antitumor active polypeptide gene expression plasmid can be obtained by, for example, known methods [M, V
, N orgard et al.

Gene, 3. 279 (1978) using
Microbial hosts, such as Escherichia coli C6C600
r-strain (ATCC33525).

The recombinant microbial cells thus obtained are cultured in a manner known per se. Examples of the medium include M9 medium [T, ManiaN
s et al., “Molecular Cloning”
, p 440. Cold 3pringl-1a
rbor 1 laboratory, New Y
ork (1982)], and it is desirable to add, for example, fanpicillin, if necessary. For example, incubate at 37°C with aeration by shaking and stirring.
Do this for ~36 hours. In addition, at the culture start patch or during culture,
For the purpose of making the promoter function efficiently, a drug such as 3-β-indoleacrylic acid can also be added.

After culturing, the recombinant microbial cells are collected by, for example, centrifugation, suspended in, for example, a phosphate buffer, disrupted by, for example, sonication, and a lysate of the recombinant microbial cells is obtained by centrifugation. . The white matter in the obtained lysate is separated by electrophoresis using a polyacrylamide gel containing sodium lauryl sulfate (hereinafter sometimes abbreviated as SDS), and the proteins in the gel are stained using an appropriate method. .

Human h
T NF gene or new antill! Confirm the expression of the tumor active polypeptide gene.

This J, the one who got 151, INF? The activity of the novel anti-tumor active polypeptide in white matter was evaluated by looking at its effect on necrosis of MethA sarcoma transplanted into mice.
n ViVO activity assay (Carswell et al.

), Mouse 1 - To see the cytotoxic effect on cells
VitrO activity measurement method [1quff, J.

Immunol,, 126. 235 (1981
), but from the viewpoint of measurement time, constantness, simplicity of measurement, etc., evaluation by in vitro activity measurement method is preferable.

<Effects of the Invention> Thus, according to the present invention, it is possible to obtain a novel physiologically active polypeptide that is different from the conventionally known human TN protein, and by using this novel antitumor active polypeptide, it is possible to obtain an antitumor protein. It has now become possible to provide an excellent pharmaceutical composition.

<Examples> Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited to the following Examples.

Example 1 (Design of human TNF gene) A human TNF gene having the base sequence shown in FIG. 1 was designed.

Penntca et al., Nature, 312.
724 (19g4)] reported by h T N
The base sequence of the structural gene part of the F precursor cDNA is M
Place a cleavage site with an appropriate restriction enzyme at an appropriate position (a translation start codon (ATG>) on the 5' side and two translation stop codons (TGA and TA) on the 3' side.
A > were given 4 each. In addition, a cleavage site with a restriction enzyme (laI) was provided upstream of the 5' translation start codon, which enabled ligation to the promoter while maintaining an appropriate state between the SD sequence and the translation start codon. Furthermore, a cleavage site for the restriction enzyme 1-1indI was provided downstream of the 3' translation stop codon to facilitate ligation with the vector plasmid.

Example 2 (Chemical synthesis of oligonucleotide) The human TNF gene designed in Example 1 was
Synthesize it in seven oligonucleotides. Oligonucleotide inclusion or fully automatic DNA synthesizer (Applied)
Biosystems.

The test was carried out using the Boss Fight method using Model 38OA). Purification of the synthetic oligonucleotide was performed according to the manual of Applied Biosystems.

That is, by keeping an ammonia aqueous solution containing synthetic oligonucleotides at 55°C overnight, the protecting groups of the DNA bases are removed, and the DNA bases are removed from the ammonia solution containing Sephadex G-50 Fine Gel (
A high-molecular weight synthetic oligonucleotide fraction is collected by gel filtration using Pharmacia®. Next, 7M
After polyacrylamide gel electrophoresis containing urea (gel concentration 20%), the migration pattern was observed using ultraviolet shadowing. A band of the desired size was cut out, and the polyacrylamide gel fragments were crushed into small pieces. After that, elution buffer r [500mM
N1140Ac-1mMEDTA-0,1%S
D S (pH 7,5)] was added, and the mixture was shaken at 37°C overnight. The aqueous phase containing the DNA of interest was collected by centrifugation. Finally, transfer the solution containing the synthetic oligonucleotide to a gel filtration column (Sephadex G-50) (
A purified product of the synthetic oligonucleotide was obtained by Note that, if necessary, polyacrylamide gel electrophoresis was repeated to improve the purity of the synthetic oligonucleotide.

Example 3 (Cloning of chemically synthesized human TNF gene) The 17 synthetic oligonucleotides prepared in Example 2 (
The human TNF gene was divided into three blocks and cloned using TNF-1 to TNF-17).

0.1-1.0 μm of Gokai oligonucleotide TN “-
The 5' end of 2-TNI'-6 was injected with 5-15 units of 1,4-polynucleotide kinase (E).

E. coli type 3, Takara Shuzo) to phosphorylate each separately. Phosphorylation reaction is 10-20μ 50m in summer
M Tris-lcf (pl-I 9
．． 5), 10 mM M(l
C92.

5mM didiothreitol, 10mM ΔT
The test was carried out in a P aqueous solution at 37°C for 30 minutes. After the reaction is completed, all the synthetic oligonucleotide aqueous solutions are mixed together, and T4-polynucleotide kinase is inactivated and removed by phenol extraction and ether extraction.

Add 0.1~ to this synthetic oligonucleotide mixture solution.
1.0 μq of synthetic oligonucleotides TNF1 and TN
F-7 is added, heated at 90° C. for 5 minutes, and then slowly cooled to room temperature for annealing.

Next, after drying this under reduced pressure, 30 μm of 66mMT
ris-HCj (D port 7.6), 6.6 m
M M (] CR2.

10 mM didiothreitol, 1 mM T
300 units of T4. -D
NA ligase (Takara Shuzo) was added, and the ligation reaction was carried out at 11°C for 15 hours. After the reaction is completed, polyacrylamide gel electrophoresis (gel concentration 5%) is performed, and the migration pattern is observed by edidium bromide staining.

A band portion of the desired size (approximately 220 bO) is cut out, and the DNA is recovered from the polyacrylamide gel according to the method of Example 2.

On the other hand, 3μ of E. coli plasmid DIJ3R322 (approximately 4.4K bp) was added to 30μ of 10mM Tri.
s-1-I C9 (0 days 7.5), 60 M
Na CL 7 was dissolved in a 111 MMgCR2 aqueous solution, 10 units of restriction enzyme CRa (Corn England Biolapse) was added, and a cleavage reaction was carried out at 37° C. for 1 hour.

After cleavage with restriction enzyme C9aI, phenol extraction.

Ether extraction is performed and DNA is recovered by ethanol precipitation. Transfer this DNA to 30ul of 50mMTr.
+5-FICID mouth 7.4), 1
00mM Na CL 10m
MM (+504 dissolved in aqueous solution, 10 tons of restriction enzyme 5alI <Takara Shuzo) was added, and the cleavage reaction was carried out at 37°C for 1 hour. After the reaction is completed, agarose gel electrophoresis (gel concentration 0.8%) is performed, and the cutting pattern is observed using the ]-dijiul\\boomite staining method.

Approximately 3,7K containing most of plasmid 1IBR322
Cut out the band corresponding to the bp DNA part, and add the agarose gel fragment to 3 times the amount (vol 7wt) of 8M
Na (JO + dissolved in aqueous solution. Glass filter method CC, W of Chen et al.

Chen et al., Anal, [3iochcm,
101. 339 (1980)] to J: about 3.7
A Kbp DNA fragment (Cρa I+5alI) was recovered from the agarose gel.

Approximately 220b containing part of the previously obtained human TNFI Nobuko
After phosphorylating the terminals of the p DNA fragment according to the method described above, it is mixed with an aqueous DNA solution of approximately 3.7 Kbp containing most of plasmid +1BR322. After ethanol precipitation, both DNAs were separated according to the method described above.
A ligation reaction of the fragments was performed.

Transformation of Escherichia coli C600r-m- strain
A modification of the conventional CaCR,+ method (method of M. V. Norgard et al.) was used. Namely, 5-Noshi medium (1% 1-rib), 0.5% yeast extract, 0.5%
Na (J, IILI 7.2) was inoculated with an 18-hour culture medium of Escherichia C600rm- strain,
At 600 nm of the culture solution containing bacterial cells (Puru 111 degrees (○
Grow until Dtoo> reaches 0.3. The bacterial cells were soaked in cold magnesium buffer'-[0,IM Na
CR, 5mM M(ICjz.

5 mM Tris-CR(1)l-17,6,Q
°C)] and washed twice in 2-cold Nocolcium buffer [100mM Ca C12, 250mM KCR
, 5mM MgCL, 5mM Tris-C
resuspended in (Il+-17,6°0°C)],
Leave at 0°C for 25 minutes.

Next, the bacterial cells were concentrated in a calcium buffer to this volume of 1710, and mixed with the ligated DNA aqueous solution at a ratio of 2:1 (
vol, : vol,) mix. 60% of this mixture
minutes.

After keeping at 0°C, 1-LBG medium <1% tryptone,
Add 0.5% yeast extract, 1% NaCJ, 0.08% glucose, 1)H7,2), and culture with shaking at 37°C for 1 hour. The culture solution was added to a selective medium [medium plate containing 30 μq/- of ampicillin (Sigma)] for 10 minutes.
Inoculate at a rate of 0 μd/plate. Play 1~37
The transformed strain is grown by culturing overnight at °C. Using the obtained ampicillin-absorbing protein, DNA was prepared using a known method and subjected to agarose gel electrophoresis.
1 plasmid pTNFIBR (approximately 4.OK bll
) was confirmed. In FIG. 3, plasmid pTN “l
[This shows how to create 3R.

By the same method as above, synthetic oligonucleotide T
Plasmid 1) TNF using NF-8 to TNF-13
2N < approx. 3. IKbp), synthetic oligonucleotide T
Plasmid pTNF using NF-14 to TNF-17
3 (approximately 2.4K bp) were created. Figures 4 and 5 show plasmids pTNF2N and pTN"3".
We will show how to create each.

Plasmids pTNF1BR, pRNF2N and pTNF3 containing a part of the human TNF1 gene thus obtained,
It is confirmed that the base sequence of the synthetic oligonucleotide is as designed using the Maxam-Gilbert method [AoM, l
vlaxam et al., Methods Enzymol,
, 65. 499 (1980)].

Example 4 (Creation of human TNFI Nobuko expression plasmid) The plasmid pTNFIBR10 μg obtained in Example 3 was treated with the restriction enzymes CfaI and 3al in the same manner as in Example 3.
Cut with ■ and perform polyacrylamide gel electrophoresis (gel m
5%), human TNF1 was added according to the method of Example 2.
Approximately 220 bp DNA fragment containing part of Nobuko (Cja
l-8alI) was recovered from polyacrylamide gel.

Next, the plasmid pTNF2 1 isolated in Example 3
0μ9 to 100μ of 10mM Tris-l-
(CR(p)-17,5), 60mM Na
CL7. Dissolved in mM(]Cf2 aqueous solution, 40
Add unit restriction enzyme PVIIm (Takara Shuzo),
The cleavage reaction was carried out at 7°C for 1 hour. Then, after cleavage with restriction enzyme Sa1 according to the method of Example 3, and performing polyacrylamide gel electrophoresis at a gel concentration of 5%, a part of human TNF1 Nobuko was removed according to the method of Example 2. including about 1
70b11 DNA fragment (SalI4-1PVulI)
was recovered from polyacrylamide gel.

In addition, plasmid pTNI3 obtained in Example 3
μ9 was also 100 μM of 10 mM Trys-years + cf (
IIH7,5>, 60 mM NaCj,
7 mM (IcL aqueous solution), 40 units of restriction enzyme pvu and 40 units of restriction enzyme ind I (Takara Shuzo) were added, and the cleavage reaction was carried out at 37°C for 1 hour. After electrophoresis (glue concentration: 5%), approximately 110 bp of DNA containing a part of the human TNF gene was collected according to the method of Example 2.
The fragment (PVUII←)<1ndI[[] was recovered from the polyacrylamide gel.

On the other hand, plasmid p with E. coli trp promoter
Ys31N (approximately 4.7 Kbp) 5μ9 was digested with restriction enzymes (laI and l-1indIII) in the same manner as above,
After agarose gel electrophoresis (glue concentration 0.8%), plasmid l) Y S 31N was extracted according to the method of Example 3.
An approximately 4.7 Kbp DNA fragment containing most of the
"1-1ind (2)) was recovered from the agarose gel.

Approximately 2 cells containing part of the human TNF gene obtained in this way
2011p, approximately 170 bl) and three approximately 110 bp DNA fragments and an approximately 4.7 K bp DNA fragment containing most of the plasmid pYs31N, and after ethanol precipitation, T4 ．． -DNA
A ligation reaction using ligase was performed. After the reaction, Escherichia coli C600r-m was added according to the method of Example 3.
1) TNF401NN (approximately 5.2
Kbl)) was selected. FIG. 6 shows the method for constructing the plasmid 1) TNF401NN.

In addition, the above plasmid 1) YS3IN5μq was partially digested with the restriction enzyme PvulI according to the above method, further cut with the restriction enzyme port 1ndI[l, and subjected to Aga[1-Sgel city air phoresis (gel concentration 0.8%). After that, approximately 2.7K bp containing the trp promoter was extracted according to the method of Example 3.
DNA fragment [P vu ■(21<-)to1indI
II] Recovered from agarose gel.

Next, an oligonucleotide having the base sequence shown in FIG. 7 was synthesized and purified according to the method of Example 2. The terminals of each of the two synthetic oligonucleotides (0.5μ9) were phosphorylated for 11L according to the method of Example 3, and after annealing, the obtained length was approximately 2.7K.
bp(7) DNA fragment [pvun(2)-day 1
ndIII] and after ethanol precipitation, Example 3
A ligation reaction using T4-DNA ligase was performed according to the method of . After the reaction was completed, it was introduced into Escherichia coli CC600r- strain according to the method of Example 3, and the target plasmid pAA41 (approximately 2.7 Kbl) was extracted from the transformed strain.
)) were selected. Such a plasmid is obtained by removing the copy number control region from the plasmid pYS31N and inserting the Escherichia coli trp A terminator downstream of the cloning site located downstream of the trp promoter.
This is a multi-copy, high-efficiency expression vector that has been given the following: Figure 7 shows how to create it.

2 μq of this plasmid pAA41 was cut with restriction enzymes C9aI and indIII in the same manner as above, and after agarose gel electrophoresis (gel concentration 0.8%), Example 3
A DNA fragment of about 2.7 Kbp containing most of plasmid l)A A41 ((JaI-l-
1indlll) was recovered from the agarose gel.

In addition, the previously obtained human TNFl Shinko expression plasmid l) 5μq of TNF401N N was cut with the restriction enzymes CRa■ and l-1indIII in the same manner as above,
After polyacrylamide gel electrophoresis (gel concentration 5%), approximately 490110 DNA fragments ((Ja 'It-+l
-1indIII> was recovered from the polyacrylamide gel.

The approximately 2.7 K bp DNA fragment containing most of the plasmid IIA A 41 obtained in this way and the approximately 490 bp DNA fragment containing the entire human TNF gene were mixed,
D [After ethanol precipitation, according to the method of Example 3, T
4. - A ligation reaction using DNA ligase was performed.

After the reaction was completed, it was introduced into Escherichia coli 600rm- strain according to the method of Example 3, and the desired plasmid +11'' NF 401A (
A clone with approximately 3.2 Kbp) was selected. This plasmid has the ability to express the human TNF gene more efficiently, and the method for its construction is shown in FIG.

Example 5 (Creation of a novel antitumor active polypeptide gene expression plasmid) The human TNFI trochanteric expression plasmid pTNF401NN20μ9 obtained in Example 4 was treated with restriction enzymes (JaI and I[[cut with
After polyacrylamide gel electrophoresis (gel concentration 5%) and agarose gel electrophoresis (gel concentration 0.8%), two DNA fragments (approximately 490 bl) and Approximately 4.7K bp, both cRa l-11ind m ) were recovered from the gel.

Approximately 490 genes including the entire human TNF31 gene obtained here
bl) DNA fragment in 50μ of 10mM Tris.
HCj (pH 7,5), 60 mM NaC
9.7mM MCl (dissolved in J2 aqueous solution), 10 units of restriction enzyme AVaI (Takara Shuzo) was added, and the cleavage reaction was carried out at 37°C for 1 hour. After the reaction was completed, polyacrylamide gel electrophoresis (gel concentration 5%) was carried out. According to the method of Example 2, a DNA fragment of approximately 460 bp containing most of the human TNF gene (Ava I 4-1 days in
d■> was recovered from the polyacrylamide gel.

Further, a double-stranded oligonucleotide having the base sequence shown in FIG. 9 was synthesized and purified into an upper strand and a lower strand according to the method of Example 2. Example 3 for each of 0.5 μ9 of two synthetic oligonucleotides with 1q
After terminal phosphorylation was performed according to the method of , annealing was performed.

After annealing, the double-stranded oligonucleotide is obtained in advance.
An approximately 460 bp DNA fragment (AvaI→I''i) containing most of the human TNFI signal
nd m ) and after ethanol precipitation, Example 3
A ligation reaction using T4-DNA ligase was performed according to the method of . After the reaction was completed, the target plasmid 11TNF4113 (approximately 5
．． 2K bp) was selected. This plasmid is a novel antitumor active polypeptide gene expression plasmid that encodes a novel antitumor active polypeptide in which the amino terminal 7 amino acids of TNF are deleted. Figure 9 shows the method for its construction. .

Furthermore, pTNF 401NN to pTNF 401A
An expression plasmid pTNF 416A (approximately 3.2K bp)
It was created. Figure 8 shows how to make it.

Expression type plasmid pTNF401Δ obtained in Example 4
and restriction enzymes C1a and 1- according to the method of Example 3.
After cutting with Iindl [l, polyacrylamide gel electrophoresis at a gel concentration of 5%] and agarose gel electrophoresis at a gel concentration of 0.8%), two products were produced according to the methods of Examples 2 and 3, respectively. DNA fragment <approximately 490 bp and approximately 2.7 K bp, both C1a: [(to)l-(i
ndI[[) was recovered from the gel.

Approximately 490b including the entire human TNF gene obtained here
The p DNA fragment was added to 50μ of 10mM Trisl-
ICJ (pl-17,4), 10mM M(I
It was dissolved in SO4 and 1mM dithiothreitol aqueous solution, 10 units of restriction enzyme 1-1arllT (Hoshuzo Co., Ltd.) was added, and a cleavage reaction was carried out at 37°C for 1 hour. After the reaction was completed, polyacrylamide gel electrophoresis (gel concentration 5%) was performed, and H1 to TN were analyzed according to the method of Example 2.
Approximately 390 bp DNA fragment containing most of Fll Mitsuko (
l-1ap■i→l-l ind m) was recovered from the polyacrylamide gel.

Furthermore, an oligonucleotide having the base sequence shown in FIG. 10 was synthesized according to the method of Example 2.

Purified. The terminals of 0.5μ9 of each of the four synthetic oligonucleotides obtained were phosphorylated according to the method of Example 3, and after annealing, T4-D
A ligation reaction was performed using NA ligase.

After the reaction, the obtained 2-terminal oligonucleotide was mixed with the previously obtained approximately 2.7K bp DNA fragment (ClaI
An approximately 390 bp (7) DNA fragment (
T4-D
A ligation reaction using NA ligase was performed. After the reaction is complete,
Escherichia coli C600r according to the method of Example 3
-111- strain, and select the desired plasmid 11T NF 604 (approximately 3.2K bp) from the transformed strain.
I like it! I selected ``JRuri 1''. This plasmid has the following amino acid sequence (2N> pro ASI)
ASI)-Lyspro-V al -A l
a-mouth is -Val -Vat-A laA 5n-
pro-G In -A Ia -G Iu -G
Iy-G InL eu-G In -T rp -L
eu-Δ5n-Ar(1-to rgAla-Asn-to la -L eu -L eu -A la -A s
nG IV -V at -Q lu -L eel-
8r(1-A 5l)-A 5nGln-Leu-Va
l-Vat-Pro-8er-GluG 1y-L e
u -T yr -1eu-Ile -T yr-3e
rG In-Val-Leu-Phe-11s-G
ly -G InG ly -Cys-Pro -S
er -Thr-mouth 1s-VaLeu -Leu -
Thr -I" is -Thr -11e -5erA
ro -I le -A 1a-Val -Ser
-Tyr -G InThr -Lys-Val -A
sn -L eu -L eu -5erA la
-Ile -Lys-3er -pro -CyS
-G InA r(]-G Iu -T hr -P
ro-G 1u-G ly -A laG Iu -A
Ia-Lys-pro-Trp-Tyr
-G luP rO-I le-Tyr-Leu-G
+y-G +y-VaP he -G In -L e
u-G Iu-L Vs -G ly -A 5tlA
r(1-Leu-8er-A 1a-Glu-11e-
AsnA rg-Pro-8sp-Tyr-1
cu -A S+)-p 11cA la-G 1u-
8er-G ly-G In-V at-TyrP
he-G ly -I Ie -I Ie -A
This is a novel antitumor active polypeptide gene expression plasmid that encodes a novel antitumor polypeptide represented by la -L eu (000 units) or a polypeptide in which Met is bound to its amino terminus, and is shown in Figure 10. We showed how to create it.

Example 6 (Confirmation of expression) Expression vector 11AA41°p obtained in Example 4
TNF 401NN or rlTNF 401A or the novel antitumor active polypeptide gene expression plasmid IITNF 41G obtained in Example 5, I) TN
F416A or I) Escherichia coli C600r-m- strain carrying TNF604 was grown in M9 medium [o, 6% Na2HPO40] containing 30-50 μg/- ampicillin, 0.2% glucose and 4 m'j/- casamino acids.
,3% 2HP○4-0,05%Na CR-0,1%
After sterilizing N1-14 (J aqueous solution (Proa, 4) in an autoclave, Mg50 was separately sterilized in an autoclave.
．． 4 aqueous solution and CacR2 aqueous solution at a final concentration of 2, respectively.
Add to give a total of mM and o, i mM. ]250
M-2 treatment, OD! ,, Kao, 7 Nidatsusurumachi, 37℃
Shaking culture was performed. Then, a final concentration of 50 μg/
-3-β-indoleacrylic acid was added to the culture solution, and the shaking culture was continued at 37°C for 12 hours.

After collecting E. coli cells by centrifugation, PBS buffer F
- (20ml/vl containing 150mM NaC5
The bacterial cells were washed using J acid buffer, +11-17.4). After washing, the bacterial cells were soaked in 10-PBS.
Suspend in buffer and use an ultrasonic generator (Kubota,
200M type> to destroy the bacterial cells, and then remove the bacterial cell residue by centrifugation.

A portion of the obtained E. coli lysate was treated with Tris-
mouth C2 buffer' (pl-16,8), S
DS, 2-mercaptoethanol, glycerol,
Final 81 degrees 60mM, 2%, 4%, 10% respectively
N': Le, J: In addition to sea urchin, 5DS-polyacrylamide gel electrophoresis [Meiki, Genetics, 31.43 (1977
)] was carried out.

The separation gel was 12.5%, and the running buffer was SDS.
, Tris-glycine system [Su, Ni, laemmNat
ure, 227. 680 (1970)] was used. After the electrophoresis was completed, the protein in the gel was stained with Coomassieble R-250 (Bio-Rad) to confirm the expression of the novel antitumor active polypeptide gene. A part of the results are shown in FIG.

In addition, the gel after staining was processed using Chromato Sugyana (Shimadzu, C8).
-930 type), the proportion of the produced novel antitumor active polypeptide in E. coli cytoplasmic protein was calculated. As a result, the expression plasmid pTNF,
Enhanced production of novel antitumor active polypeptides in E. coli harboring 416 was demonstrated by the expression plasmid pr NF 41
Approximately 50% of the cases of 6A
41 and Expression Plasmid 1) The usefulness of TNF 416A was demonstrated.

Example 7 (Evaluation of activity) The activity of the novel antitumor active polypeptide was measured using the Ruf
It was carried out according to the method of f. That is, a sample of 100μ of the E. coli lysate containing the novel antitumor active polypeptide obtained in Example 6 was diluted in a medium, and 4×105
Mouse 9Z941 fibroblast cells (ATCC
CCl-929) suspension was mixed in a 96-well tissue culture microplate (Costar). At this time, Acdinomycin D (Cosmegen, Manzu Pharmaceutical Co., Ltd.) with a final concentration of 1 μ9/mfl is added. As the medium, Eagle's Minimum Ethical Medium (Hinaga Pharmaceutical Co., Ltd.) containing 5% (vol/vol) fetal bovine serum was used. After culturing the above micropreys 1 to 1 at 37°C for 18 hours in air containing 5% carbon dioxide, 0.5% (wt/vol) was added to a crystal violet solution [5% (vol/■01) methanol aqueous solution]. ) was used to dissolve crystal violet and stain live cells. After washing off the excess crystal violet and drying it, add 10% of the remaining crystal violet.
Extracted with 0.5% SDS aqueous solution at 0 μm, and the 595n
Measure the absorbance at
proportional to the number of surviving cells. Therefore, we determined the dilution factor of E. coli lysate that corresponds to 50% of the absorbance of the control without adding the diluted solution of E. coli lysate containing the novel antitumor active polypeptide using a graph (for example, Fig. 12), and calculated the dilution factor by unit. From Figure 12, 100μ of E. coli lysate containing human TNF protein encoded by expression plasmid 11TNF416A.
Escherichia coli lysate containing a novel antitumor active polypeptide encoded by the expression plasmid IITNF604 has an activity of approximately 1.5X 108 units.
μdan is about 1. It was revealed that each of them had an activity of about 108 OX units.

Expression type plasmid pTNF416A obtained in Example 6
The total amount of protein contained in Escherichia coli leipii 1 containing the human TNF protein encoded by or the novel antitumor active polypeptide encoded by the expression plasmid rlTNF604 was determined using the Protein Assay Kit (Bio-Rad).
It was determined using a standard curve using bovine serum albumin. When the specific activities of the human TNF protein and the novel antitumor active polypeptide were calculated from the expression levels, activity values, and protein quantification results obtained above, the values shown in Table 1 were obtained. Table 1 shows that the novel antitumor active polypeptide has a specific activity approximately 1.4 times that of the antitumor active polypeptide encoded by the expression plasmid DTNF416Δ.

55-

[Brief explanation of drawings]

Figure 1 shows the nucleotide sequence of the designed human TNF gene, and
The figures show the base sequences of chemically synthesized synthetic oligonucleotides. Figures 3, 4 and 5
The figure shows plasmid pTN containing the human TNF gene.
FI port R, how to create pTNF2N and pTNF3,
They are shown below. Figure 6 shows how to create the human TNF gene expression plasmid 1) TNF 401NN, Figure 7 shows how to create A41 into the expression vector p, and Figure 8 shows how to create the human TNF gene expression plasmid +
) The methods for constructing TNF401A and the novel antitumor active polypeptide gene expression plasmid pTNF416A are shown respectively. Figure 9 shows the method for producing the novel antitumor active polypeptide gene expression plasmid 1) TNF416, and Figure 10 shows the production method for the novel antitumor active polypeptide gene expression plasmid 1] TNF604. be. FIG. 11 shows the expression results of the novel antitumor active polypeptide gene. FIG. 12 shows the results of measuring the activity of the novel anti-liver cancer active polypeptide.

Claims (1)

[Claims] (1) The following amino acid sequence [There is a gene sequence. ] [There is a gene sequence. ] A novel physiologically active polypeptide represented by (2) The polypeptide according to claim 1, characterized in that Met is bound to the amino terminus. (3) The following amino acid sequence [There is a gene sequence. ] [There is a gene sequence. ] A recombinant plasmid containing a DNA region encoding a novel physiologically active polypeptide represented by the following formula or a polypeptide having Met bound to its amino terminus. (4) The DNA region has the following base sequence [there is a gene sequence]. ] [There is a gene sequence. ] Single-stranded DNA represented by and its complementary single-stranded DNA
The plasmid according to claim 3, characterized in that it contains a double-stranded DNA consisting of A. (5) The DNA region has the following base sequence [there is a gene sequence]. ] [There is a gene sequence. ] Single-stranded DNA represented by and its complementary single-stranded DNA
The plasmid according to claim 3, characterized in that it contains a double-stranded DNA consisting of A. (6) The plasmid according to claim 3, wherein the plasmid is plasmid pTNF604. (7) The following amino acid sequence [There is a gene sequence. ] [There is a gene sequence. A recombinant microbial cell transformed with a recombinant plasmid containing a DNA region encoding a novel physiologically active polypeptide represented by the following formula or a polypeptide having Met bound to its amino terminus. (8) The microbial cell according to claim 7, wherein the microbial cell is Escherichia coli. (9) The following amino acid sequence [There is a gene sequence. ] [There is a gene sequence. ] A recombinant microbial cell transformed with a recombinant plasmid containing a DNA region encoding a novel physiologically active polypeptide represented by 1. A method for producing a novel bioactive polypeptide, which comprises producing and accumulating the bioactive polypeptide and separating the novel bioactive polypeptide from the resulting culture. (10) There is the following amino acid sequence [gene sequence] in an effective amount for antitumor. ] [There is a gene sequence. ] A pharmaceutical composition containing a novel physiologically active polypeptide represented by the following formula or a polypeptide having Met bound to its amino terminus.