JPH0358794A - Production of heterogeneic product by yeast - Google Patents

Abstract

PURPOSE:To enable the secretion of a heterogeneic product out of a host yeast cell in high efficiency by connecting a signal sequence, etc., of Rhizopus to a gene of the objective heterogeneic product and transforming a host yeast cell. CONSTITUTION:A gene coding the objective heterogeneic product is connected to the downstream of a gene coding a signal peptide [having the amino acid sequence from Met(1) to Ala(21) of the formula I] of an acid protease originated from a mold Rhizopus niveus and coding a precursor region [having the amino acid sequence from Ala(22) to Glu(66) of the formula I]. A host yeast cell is transformed with a recombinant vector containing integrated chimera gene produced by the above process and the transformed yeast cell is cultured to obtain the objective heterogeneic product.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention is directed to the extracellular production of heterologous gene products such as proteins or peptides in yeast using the signal peptide and precursor region of fungal acid protease. Regarding the law.

[Conventional technology and its challenges] Recent advances in genetic engineering technology [This has made it possible to produce useful gene products using artificial recombinants.
It is beginning to be widely used.

In the production of proteins, peptides, etc. (hereinafter referred to as "heterologous gene products") by genetic recombination methods, it is significant to secrete and produce these heterologous gene products outside the microbial cell for the following reasons.

(1) There is no excessive accumulation within the bacterial body, and the growth of the host is unlikely to be affected.

(2) Production can be increased because it accumulates in the culture medium.

(3) There is no degradation by intracellular protease.

(4) There are not so many types of secreted proteins and purification is easy.

Traditionally, in order for a certain protein to be secreted and produced,
It is known that a sequence called a signal peptide consisting of about 20 amino acids is required at the amino terminal side (Blobel, G. and Dobbers
tein, B. ;J. Cell Bjol. ,67,
835 (1975)). Therefore, many researchers have studied the secretory production of proteins using these signals (edited by Tadahiko Ando and Kenji Sakaguchi, Basic Microbiology Course 8 Genetic Engineering). Progress has been made centered on Bacillus subtilis, which is known to secrete large amounts of enzymes, and a secretion vector using Bacillus subtilis as a host has been developed and reported. The structure of this secretion vector is that in addition to the origin of replication and selection marker gene required for normal vectors, there is a DNA portion encoding a signal peptide whose transcription is controlled by a strong promoter, and a gene for the target protein downstream of it. Examples include those that are connected. The signal sequence of this secretion vector is Hasillus amyloliquifaciens (Basi)].os amylolique.
facience) (Palva, T et
al: Gene, ]9.43 (198])) and B. subtilis α-amylase (Yamazaki, H. et al.:
J. Bacteria]. , ]. 56, 327 (1
983)), alkaline protease (Vansan
tha,N. and Thompson, L. D. :
J. Bacterio1. , 165,837 (19
86)) and neutral protease (Honjo, M.
et al: The 3rd Inter-nat
ional Conference of Genet
j. cs and biotechno]ogy of
Bacilli at Stanford University
．． , Abstract, p. 52 (1985)) and Hasilus licheniformis (B.1ichenif)
ormis) derived venicillinase (Fujij,
M. et al. : J. Gen. Microbio
]. , 128. 2997 (1982)) are used. Furthermore, examples of heterologous gene products secreted using Bacillus subtilis include β-lactamase derived from Escherichia coli and Staphylococcus aureus (St
aphyrococcus aureus), and in these cases, it has been reported that about 3 g of protein is produced outside the bacterial cells per 1 liter of culture (Vansantha, N. aureus).
nd Thompson, L. D. :J. Bacte
rio1. , 165, 837 (1986)).

As described above, the secretion vector system using Bacillus subtilis as a host has been extremely effective for secretory expression of genes derived from microorganisms, especially prokaryotic cells, but when producing human gene products using this system, For example, when a certain long hormone is secreted and produced, at most only about 10 mg can be secreted and produced per liter of culture, and it is currently difficult to secretely produce gene products derived from eukaryotes.

Recently, there has been interest in fungi as hosts for secretory production in eukaryotes (Kenji Sakaguchi: "Filamentous Fungi", p: 192,
Tadahiko Ando, Kenji Sakaguchi (eds., Microbiology Fundamentals 8 Genetic Engineering). Especially Aspergillus (Aspergillus)
Those of the s) genus are used in the production of industrial enzymes, and culture 1
Systems that produce more than JOg of protein per liter are also known. For example, recently Aspergillus α-
The amylase gene was self-cloned, and production of over 10 grams of protein per liter of culture was reported (
Novo Indus 1 Re, Japanese Patent Publication No. 63-272988).

However, as an expression system for heterologous genes, fungi have many problems, such as low transformation efficiency, a small number of currently available promoters, and little research into the details of the expression mechanism.

On the other hand, yeast (S
accharomyces cerevisiae) is also well known. In this system, the use of strong promoters for genes of enzymes mainly related to glycolysis is being advanced, and because it is easy to perform genetic analysis, it is being used as an experimental material for studying the mechanisms of gene expression and growth control. .

However, the representative yeast, baker's yeast (Saccharomyces cerevisia)
e) has not attracted much attention as a host for secretory production because it produces almost no protein.

However, recently, the mold Rhizopus (Rhizopus)
glucoamylase (Ashikari, Te
tal. : Appl, Microbiol. Bi
otechnol. 30. 515 (1989) )
Acidic protease derived from Yamashita, Mucor (Yamashita, T. et al.: Mo
l. Gen. Genet, 210, 462 (19
87)) is baker's yeast (Saccharomyces
cerevisiae) per liter of culture.
It was reported that 0 mg or more was secreted and produced, proving that the secretory ability of baker's yeast was much higher than previously thought.

However, only those using α-factor are widely used as secretory vectors for baker's yeast (
Brabe, A. J. et al. :Proc.
Natl. Acad. Sci. USA, 81.
4642 (1984)), the situation was still insufficient for industrial use.

[Means for Solving the Problem] The present inventors have discovered that the disadvantage that yeasts such as baker's yeast have a small amount of secreted proteins is, conversely, a major advantage in the production of heterologous gene products, in that they have fewer contaminant proteins. Focusing on this, we proceeded with our research, believing that if we could increase the secretion amount of a foreign gene product in yeast, we would be able to obtain an excellent secretion vector system.

Acidic protease produced by fungi is produced as a zymogen (precursor, pro-form), and then the pro-domain is removed by autolysis or other proteases, allowing it to show sufficient activity as a mature protease. As mentioned above, acidic protease derived from Rhizopus is efficiently secreted in baker's yeast.
We hypothesized that the pro region of Rhizopus acid protease plays an important role in secretion and protein stabilization, in addition to its function as an activity modulator.

Based on these findings, the present inventors connected the signal sequence etc. of Rhizopus to the gene of the target heterologous gene product and transformed host yeast cells with this. The present invention was completed by discovering that it can be secreted externally.

Therefore, the present invention relates to the filamentous fungus Rhizopus niveus (Rh
A chimeric gene is created by connecting a gene encoding a target heterologous gene product downstream of a gene encoding a signal peptide and precursor region of acidic protease derived from (Izopus niveus), and a recombinant vector incorporating this chimeric gene is used to infect a host yeast. This is a method for producing a heterologous gene product, which is characterized by transforming cells and culturing the host yeast cells.

The signal peptide and precursor region of the present invention is represented by the amino acid sequence of the following formula: Met Lys Phe
Thr Leu Ile Ser Ser Cys
Val20 Ala Leu Ala Ala Met Thr
Leu Ala Val Glu30 Ala Ala Pro Asn Gly Lys
Lys Ile Asn Ile40 Pro Leu Ala Lys Asn Asn
Ser Tyr Lys Pro50 Ser Ala Lys Asn Ala Leu A
sn Lys Ala Leu60 Ala lys Tyr Asn Arg Arg L
ys Val Gly SerGly Gly Ile
Thr Thr Glu(66)(I) (In the formula, Net(1)-Ala(21) represents a signal peptide and Ala(22)-Glu(66) represents a precursor region) This peptide sequence (I) The gene sequence encoding
It can be obtained from acidic protease-producing bacteria belonging to the filamentous fungus Rhizopus niveus by the following conventional method. That is, the total DNA is obtained from the acidic protease-producing bacterium by a known method, and this is cut with a restriction enzyme such as Sau3AI to obtain a DNA fragment, and from this fragment, a gene library of the acidic protease-producing bacterium is obtained. Next, DN encoding acidic protease
Detect A, use phage vectors and/or plasmid vectors, add the necessary restriction enzyme cleavage sites by site-directed mutagenesis using synthetic DNA, and delete DNA encoding unnecessary amino acids for acidic protease. It can be obtained by

Connecting a gene encoding a peptide downstream of the gene encoding the signal peptide and precursor region can also be performed by a known method.

That is, the cDNA is converted into a DNA code I by a conventional method, and after adding necessary restriction enzyme cleavage sites and linkers as necessary, the DNA encoding the signal 11 signal peptide and precursor region (1) obtained above is extracted.
This is done by ligation with A in the usual manner.

A host enzyme [3] was transformed with the expression vector into which the chimeric gene obtained as described above was introduced, and the host enzyme JO
The desired heterologous gene product can be obtained from the culture by culturing it by a conventional method.

Transformation of host yeast can also be performed according to known methods.

Although the transformed host yeast is cultured under general culture conditions, a particularly preferred culture method is at a temperature of about 30'C, using YPD medium (%
Examples include a shaking culture method using yeast extract, 2% polypebutone, 2% fructose, and the like.

Examples obtained according to the present invention include Rhizopus acidic protease T itself, Rhizopus ribonuclease Rh, amylase, lipase, etc., but other substances may also be used.

In the present invention, when Rhizopus acid protease (2), which does not have a precursor region, is expressed in bread fermentation, no activity or protein is observed inside or outside the bacterial cell, as shown in the Examples below. In the case of Rhizopus ribonuclease Rh, the signal peptide is present in a very small amount (approximately 7 μg per liter of culture solution) in bread lW mother.
) only secrete and produce bonuclease Rh, but the production amount increases dramatically by introducing the precursor region. For example, for Rhizopus acid protease, it is about 50 mg per liter of culture solution, and for ribonuclease leaf, it is about 4.0 mg per liter of culture solution. 0
Production of 1.0 mg of target protein was observed.

[Effects of the Invention] As described in -1- below, the present invention is capable of transporting a target protein or peptide downstream of the precursor pro-region of Rhizobus-derived acidic protease to the outside of the bacterial cell by baker's yeast. This makes it possible to produce useful proteins.

[Example] Hereinafter, the present invention will be explained in more detail by giving Examples.

Example 1 Preparation of mutated acidic protease gene: A gene having a mutation in the precursor region of acidic protease was prepared by the method shown below.

(].) Preparation of plasmid pYPR 2731 (])
Construction of Rhizopus gene library Acidic protease producing bacterium (R. niveus Yamazaki)
IFO 4810) to the method of Hynes et al.
s, M. J. et al. , Molec. C
ell. Biol. , Vol. Total DNA was isolated by E. E., 1930).

This DNA was partially digested with the restriction enzyme Sau3AI, and fractions of 8 to 15 kb were collected by sucrose density gradient centrifugation.
This 8-15 kb DNA fragment was ligated with BamHI-treated vector pBR14 322 using T4 ligase, and E. coli JA221 was transformed to obtain a Rhizopus gene library as an ampicillin-resistant transformant. E. coli was transformed using a conventional method.

(2) Screening of gene library In order to select transformants, a probe for acid protease gene detection was prepared.

The probe was prepared using Met-Va1-Asp, which is a part of the N-terminal amino acid sequence of acidic protease.
-Tyr-Glu-Asn-Asp-Val-Glu-
Regarding the Tyr portion, from the codon corresponding to the amino acid sequence, 3'-TAGCANCTPATPCTQTT
32 kinds of synthetic DNA oligomers (17-mer probe) consisting of 17 bases of -5゛ and 3'-TTACT
16 types of synthetic DNA oligomers (14-mar probe) consisting of 14 bases of PCAPCTNAT5''-1
5-1 was synthesized. Here, N is any base, P is A or G, and Q is T or C.

These DNA oligomers are combined with [γ-32P]ATP and T
It was labeled using 4 polynucleotide kinase and used as a probe for acidic protease gene detection. Colony hybridization to select clones carrying the acidic protease gene was performed using the method of Grunstein and Hogness (Grunstein, M. and
D. S. Hogness, Proc. Natl
．． Acad. Sci. USA. , vol. 72
．． 42°C, by a slightly improved method of 3961)
It took 48 hours. As a result of screening approximately 20,000 clones, the aforementioned 14mer probe and 17mer probe
As a clone that hybridizes to both probes,
Plasmids l) A clone carrying PR07 was selected. pPR○7 is 7. 4kb Rhizobus-derived DN
It has A fragment. In addition, Escherichia coli JA22 carrying pPR○7
1 clone is Escherichia coli
It was named SAM 760 and has been deposited at the 16th Institute of Fine Technology under the deposit number FERM P-9519.

(3) Removal of intron sequence from acidic protease structural gene The chromosome-derived acidic protease gene contains an intron consisting of 64 bases.

In order to remove this intron from the chromosome-derived gene,
Site-directed mutage was performed using chemically synthesized oligonucleotide fragments mainly according to the method of Zoller et al.
nesis) method was carried out. The operations used below are performed using T. maniatis (T. maniatis) unless otherwise specified.
tis et al: Molecular Cloni
ng, Cold Spring Haver Lab
Oratory, New York, 1982).

Plasmid pPRO7 containing the chromosomal gene of the acidic protease was treated with restriction enzymes SphI and SalI to create a 1.4 kb SphI-Sal containing intron.
I DNA fragment was obtained. The obtained DNA fragment was M
1 3m17-p19 (purchased from Takara Shuzo) sph:t-Sal I
The recombinant single-stranded DNA was obtained. Next, the obtained single-stranded DNA and 5'-GCATAAAGTGG
A mixed solution with synthetic oligonucleotide A200 having the structure ATGCAAACCACATATCAG-3' was mixed with 6
After processing at 0'C for 20 minutes, sequentially at 30C for 30 minutes,
Single-stranded DNA and synthetic oligonucleotide A2 were incubated at 4°C for 30 min and o'c for 20 min, respectively.
00 was combined. Thereafter, Klenow fragment, T4 DNA ligase, ATP and deoxyribonucleotide mixture were added to the above reaction solution, and after reacting at 12°C for 16 hours, it was transformed into Escherichia coli JM109. The transformed strain is
Selection was made using the standard Braak hybridization method. That is, using the synthetic oligonucleotide A200 labeled with [γ32P]ATP as a probe, a blank 18-block containing the mutated gene was selected. Single-stranded and replicative Farci I3-7 were prepared from this plaque.

(4.) Construction of a gene with an EcoRI cleavage site A cleavage recognition site for the restriction enzyme EcoRI was placed upstream of the 5' side of the translation initiation codon ATG of the intronless acidic protease gene thus obtained. It was inserted using the same site-directed mutagenesis method.

The chemically synthesized oligonucleotide A211 has a 5'-G
It has the structure AACTTCATGAATTCAGTAGAA-3'. Using this combined oligonucleotide A211 and the single-stranded phage B-7 obtained in (3) above, site-directed mutagenesis was performed again according to the method of Zoller et al.

As a result, the target phage BC-1 containing a gene having an EcoRI cleavage signal sequence immediately before the translation initiation codon ATG of the acidic protease gene was obtained.

(5) Production of expression vector The Farsi BC1 obtained as described above has an EcoRI cleavage site inserted immediately before the translation opening codon ATG, and contains the first half of the acidic protease gene lacking an intron. Using this DNA, an expression vector was produced in which the acidic protease gene was directly linked to the expression control site (promoter) of the yeast-derived glyceraldehyde 3-phosphate dehydratase (GAP) gene.

In producing this vector, pYgap 87 (this plasmid is named SBMISI, FERM B
pYGIFLm2t2 (this plasmid was named Escherichia coli SBM 274 and was deposited as FERM P7727 on October 5, 1983 at the Institute of Microbiology, Agency of Industrial Science and Technology under the provisions of the Budapest Treaty) as P-382. Go 9 8
BP-221 was deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology on July 17, 1988, and furthermore, on December 26, 1988, BP-221
6) was used as the starting plasmid.

That is, the only B a m present in pYG FLm212
I-{ After cleaving the I cleavage site with a restriction enzyme, create a sticky end using DNA polymerase ■
Fill in L. Subsequently, H i n d TIT (5'-CAAGCTT) was added to that site.
G-3') A plasmid pYGIFLm232H with a Hindm cleavage site was produced by inserting a linker. In addition, pygap 87 was used to initiate translation of the GAP structural gene using the same site-directed mutagenesis method as shown previously. A cleavage recognition site for the EcoR restriction enzyme was created immediately before the ATG codon, and plasmid pYgap87E was produced. Plasmid pYGIFLm 21.2H
After complete cleavage with coRI and partial cleavage with HindIII by adjusting the reaction time, 8. A 0 kb fragment was isolated. Also, T) Yg
After cutting ap87E with EcoRI and 21 Hind IJI, 1.1. The kb fragment was isolated.

This fragment and 8. above. After ligation with the 0 kb fragment, Escherichia coli was transformed and plasmid pYGIFLm222 was obtained therefrom.

p Y G I F Lm produced in this way
222 and replicating type Farci BC-1 with EcoR King and Sa
{Wheat, digested with l.
A 7 kb fragment was recovered.

The plasmid obtained by ligating these DNA fragments was named pYPR273. Furthermore, this pY
Cut PR273 with SalI, and separately cut pPR○
Approximately 2.3 containing the second half of the acid protease gene of 7.
The kb Sal I fragment was recovered and ligated. As a result, two types of vectors were obtained depending on the method of inserting the SaI engineering fragment.

Among them, the one in which the acidic protease gene was correctly bound was selected by restriction enzyme analysis and named pYPR2731 (see Figure 1).

122 (1i) Method for constructing the delated acidic protease gene The delated acidic protease gene was constructed using a site-specific mutagenesis method (so-called Kunkel method) using a single-stranded M13 phage containing uracil. This method has already been sold as a kit by Bio-Rad (
MUTAGENETM IN VITRO MUTAG
ENESIS KIT, BID-RAD) Using this, mutant DNA was produced according to the method described in the instruction manual. The details are as follows.

First, a single-stranded M13 phage containing a portion of the acidic protease gene and uracil was prepared (see Figure 2).
. In other words, plasmid pYPR2731 is converted to restriction enzyme Ec
A DNA fragment of approximately 0.6 kb containing part of the 5' side of the acidic protease gene was obtained by cutting with oRI and Sal. The obtained DNA fragment was M13mpl9 (
It was inserted into the EcoRI-23--SalI site of E. coli MV1190 strain (included in the Bio-Rad site-directed mutagenesis kit) (included in the Bio-Rad site-directed mutagenesis kit).
c-proAB). thi, supE, Δ(sr
irecA)306::TnlO(tetr)[F7
:traD36, proAB, 1acIqZΔold5]
) to prepare phage II) IMPR1. Similarly, plasmid pYPR2731 was digested with the restriction enzyme SalI, and approximately 2 kb of DNA containing a portion of the 3' side of the acidic protease gene was obtained by cutting the plasmid pYPR2731 with the restriction enzyme SalI.
Phage p by inserting into the SalI site of pl9.
IMPR2 was prepared. A single-stranded plasmid containing uracil based on these phages;) IMPR1-
U,p IMPR2-U were prepared respectively. That is, CJ236 strain (dut
, ung, thi, relA; pcJ105(C
mr)) was cultured overnight, then cultured in L medium containing 30 μg/m chloramphenicol (10 g per liter).
Inoculate 10 μl of tryptone, 5 g yeast extract, 5 g sodium chloride (autoclave sterilization) and culture for 6 hours. Add 1-3 x 106 F-24 cells, culture overnight at 37°C, centrifuge the culture and collect the supernatant. 174 volumes of ammonium acetate/polyethylene glycol solution (3.5M ammonium acetate, 20% polyethylene glycol 8000
) and leave it in a water bath for at least 30 minutes. After centrifugation, the precipitate was diluted with 200 μl of TE solution (10 mM.}Lis-HCl.
pH 8.0, 1mM EDTA) in a water bath for 30 minutes.
Let stand for a minute. Insoluble matter was removed by centrifugation, once with phenol, and phenol/chloroform (phenol: chloroform: isoamyl alcohol = 24 = 24:1).
The mixture is extracted twice with chloroform and twice with chloroform, and the aqueous layer is collected and precipitated with ethanol. Finally 10-20
A phage DNA sample was prepared by adding μl of TE.

The mutation treatment was carried out by O. lpmole phage DNA and 2-
1 μl to 3 pmole of mutant brimer (Goshu DNA)
Add 10x annealing buffer (200mM Tris-HCl pH-25-7.4.20mM magnesium chloride, 500mM sodium chloride) and distilled water to a volume of 10 μl. 75℃
Heat-treated for 5 minutes, and then gradually cooled to 30°C over a further 40 minutes. 10x synthesis buffer (5mM each deoxynucleic acid triphosphate, 10mM ATP, 100mM)
1μ1 of lithium hydrochloric acid (pH 7.4), 50mM magnesium chloride, 20mM dithiothreitol), T4DN
Add 1 μl of A polymerase and 1 μl of T4 DNA ligase, react for 5 minutes in a water bath, and then incubate at 25°C for 5 minutes.
react for 90 minutes at 37°C.

Add 90 μl TE and save. 3 of this DNA solution
-10 μl is used to transform 7MV1190. After transformation, spread on agar in L medium and incubate overnight at 37°C.
190 culture solution) and cultured for 6 hours to prepare single-stranded phages and replicative (double-stranded) phages.

To select DNA in which the desired mutation has occurred, if a new restriction enzyme site is created due to the mutation, use that as a marker; otherwise, select a single phage at random and select one DNA from each. Selection and confirmation were made by preparing stranded DNA and examining the DNA base sequence. The DNA base sequence was performed using a fully automatic DNA sequencer manufactured by Devon Co., Ltd. according to the instructions.

(iii) Construction of an acidic protease gene without a precursor region The construction of an acidic protease gene without a precursor region involves introducing new restriction enzyme sites before and after the part corresponding to the precursor region of the acidic protease gene. It was produced by recombining using the site (see Table 1).

In other words, D synthesized at the connection site between the signal region and the precursor region.
NA A219 (5'-GAGCTGCTCGAGA
CGGCAAG-3') and X h. Phage pIM21.9 having an O I restriction enzyme recognition site was constructed. Furthermore, synthetic DNA A220 (5'-CAA C C G
A G G A. ．． T C C A. G T G
GC-3'') was used to construct phage pIM21.9-220 having a B am H king restriction enzyme site.

In this way, the p King M21.9-220 power) and the replication type (
Double-stranded) DNA was prepared. Approximately 1 μg of this DNA is
-5 units of restriction enzymes XhoI and B a m H
pIM21.I was simultaneously cleaved and then blunt-ended with 5-10 units of mung bean nuclease, followed by self-ligation using a ligation kit sold by Takara Shuzo to completely delete only the precursor region.
We were able to obtain 9-220Δ1. On the other hand, pYPR2
In order to remove the region not directly related to the acidic protease structural gene in the 2 kb fragment of Sal I in 7 3 1, we used a single-stranded phage r containing uracil, IMPR2U.
and mutated synthetic DNA A]78 (5'-GCCAATT
AAGTCGA. A plasmid pIM]78 having a recognition site for the restriction enzyme Sa]-■ immediately downstream of the translation stop codon of the acidic protease gene was prepared using CTACTTTT28-C(,-3'). From this plasmid, approximately 0.0.
5k. The Sal I fragment of b was added to approximately 2k of pYPR2731.
By replacing the Sal I fragment of b with yeast glyceraldehyde 3 immediately downstream of the acidic protease gene.
- Plasmid pYPR2831 in which the terminator region of the phosphate dehydrogenase gene was connected was obtained. Furthermore, EcoRI of Sal■ located in two locations in this plasmid
T4-DN
A filled-in plasmid pYPR2831ΔS was created using A polymerase and four types of deoxynucleic acid triphosphates. This plasmid was cut with EcoRI and SalI and pIM21. 9 − 2 Ec of 20△1
oRI-Sa] was ligated with a 0.6 kb fragment. Plasmid pYPR2841 containing the acidic protease gene with the entire precursor region removed by
was built.

(jv) Construction of acidic protease gene with part of the precursor region deleted The acidic protease gene with part of the precursor region deleted was constructed by looping out part of the gene using synthetic DNA.

Single-stranded phage pIMP R1 containing the aforementioned uracil
．． - U and synthetic DNA A308 (5”GCT
GCACCCAA. CGGATCCGCCAAAAAAT
Phage plasmid pIM308 was prepared by removing 19 amino acid residues from the 22nd alanine to the 40th broline counting from the N-terminal methionine using the above-mentioned site-directed mutagenesis method using GCACTT-3'). In addition, another synthetic DNA A3 10 (5'-GCACTT
AATAAGGCTCTCGAGGCCAGTGGCT
A phage plasmid pIM310 in which 15 amino acid residues from the 51st alanine to the 65th threonine from the N-terminus were removed was also prepared using phage CT-3'). EcoR
The fragment was cut with both ① and SalI, and a fragment of about 0.6 kb containing part of the acidic protease gene was isolated. This fragment was added to the E of the plasmid pYPR2831ΔS described above.
Plasmid pY ligated with coRI-SalI 7.5 kb fragment and capable of replication and selection in baker's yeast
PR2842 and pYPR2843 were obtained.

(V) Examination of activity expression in baker's yeast by an acidic protease gene lacking part or all of the precursor region. Baker's yeast R27-7C-IB (MATα, trpl, ur
a3, his3, lue2), and transformants R-2841, R-2842 and R-2843 were selected for each plasmid with tryptophan auxotrophy.

Furthermore, as a control, plasmid pYPR2831 containing the entire acid protease region and pYE209 not containing the acid protease gene (this plasmid consists only of the yeast expression plasmid vector, and the pYGIFL
After partially decomposing m222 with Hind III,
(obtained by collecting a fragment of about 7kb that does not contain the GAP promoter etc. and performing self-ligation)
transformants Baker's yeast R-2831 and R-20 using
I got a 9.

Transformation was performed using the method of Ito et al. using lithium chloride (I
to, H. et al., J. Bacteriol
, 153, (1983)). The obtained transformant was added to 5 ml of YPD medium (1% yeast extract, 2% 3%
2- Voynopeptone, 2% fructose),
Acid protease activity was measured using the culture supernatant after 8 hours of shaking culture.

Acid protease activity was measured using hemoglobin as a substrate. i.e. 0.1M containing 2% hemoglobin
Add 100 μl of the baker's yeast culture solution to 100 μl of potassium acetate buffer (pH 4.0) and react at 37° C. for 60 minutes, then add 200 μl of 0.4 M trichloroacetic acid and let stand for 5 minutes in a water bath. The reaction solution is centrifuged, and 80 μl of 0.4 M sodium carbonate is added to 20 μl of the supernatant for neutralization.

The amount of protein in this sample was measured using a protein quantification kit manufactured by Pierce, Inc., and the activity of acidic protease was determined using the activity of releasing 1 mg of protein per minute as one unit.

As a result, the transformant with the acidic protease gene having the complete precursor region showed an activity of about 2000 units, but the baker's yeast transformed with the acidic protease gene lacking part or all of the precursor region showed an activity of about 2,000 units. No activity was detected.

Furthermore, a plate agar medium containing casein (0.67% yeast nitrogen base (DIFCO), 2% glucose, 1
% hammer sten casein (MERCK) 2% agar,
The acid protease production ability was investigated by halo formation with 0.001% each of leucene, histidine, and uracil, but even at 37°C for 1 week, R-2841<R-2842
and R-2843 strain, no halo formation was observed at all.

From this, secretory expression of the acidic protease gene requires
It has become clear that this precursor region plays an important role.

(Margin below) = 34 Table Synthetic DNA Name DNA Base Sequence Variation Site AI78 5゜-GOJtTTAAl7Q HiroCTA
[TI'lcomplete[1-3' Introduction of Sa11 site A219 5'-GAAGCIETQJuQm
Prefectural lie 3' Introduction of XhoI site A 2
20 5'-CAACEAGGATCCAGTGGC
-3゜ 8am+IT Introduction of T site A3
[1fl 5'
-3' 22-40 ma'ff)7? :/l#l
lIllMA 310 5'
-3' Deletion of amino acids from 51 to 65 Example 2 Secretory expression of Rhizoblast ribonuclease I/ase Rh gene: (i) Obtaining cDNA of Rhizobial ribonuclease Rh Boteto dextrose medium containing 0.5% RNA (
Difco) 400 ml for 2 days with shaking culture, or
After collecting the bacterial cells of 810) using a glass filter, the bacterial cells are washed 2-3 times with distilled water.

The cells were frozen in liquid nitrogen, crushed with a hammer, and mixed with 20 ml of 4M guanisium isothiocyanate solution (Molecular cloning page 4).
．． 189 method) and 20 ml of sterile water,
Add 20 ml of a solution of Fuconinore: Kuguchirobonorem: Isoamyl alcohol (24:24:1) and mix well. Then freeze in liquid nitrogen and thaw in running water for 2
Repeat once. Furthermore, in that state, 180 rpm 3
After mixing for 0 min, at 3,000 rpm
Centrifuge for 30 min and add CsCl to the supernatant at Ig/2.5
Add at the rate of ml. 5. Approximately 8.5 ml of this solution.
7MCsCl/0.1M EDTA (pH 7.5) solution]. ．． Layer it in a centrifuge tube containing 2 ml and heat at 30 K]
Centrifuge at 5°C for 22 hours. 250μ1 of the precipitate
0mM Tris/5mM EDTA/:
Suspend in I% SDS solution and extract with 250 μl of chloroform=1-butanol (4:].) solution. Transfer the aqueous layer separately to a test tube and add 250 μl of 10mM to the organic layer.
Tris/5mM EDTA/]% SDS solution is added and extracted again. The water-36- layer is combined with the previous one and ethanol precipitation is performed by adding 0.1 volume of 3M ammonium acetate solution and 2.2 volumes of ethanol. Repeat the ethanol precipitation twice. With this operation, 3.73 mg of total RNA was obtained from approximately Log bacterial cells.
was gotten. This total RNA was applied to an oligo dT cellulose column in a conventional manner to obtain 233 μg of polyA RNA. cDNA synthesis was performed on 2 μg of this BoliA RNA using a Boehringer Mannheim cDNA synthesis kit. After ligating EcoRI linkers to both ends of this cDNA, it was ligated to λgtlo to prepare a cDNA library. Plaque hybridization was performed on this cDNA library using the previously obtained genomic DNA encoding R Nase Rh as a probe. Hybond N (Hybo) is used as a hybridization filter.
nd-N (Amersham), and the hybridization conditions were according to Amersham's instructions. As a result, 5 positive clones were obtained. Of these, the largest of the closet fragments is
When we determined the terminal base sequence of R Nase R
It was revealed that the cDNA encodes the region downstream from the 36th amino acid from the N-terminus of h.

Therefore, using this cDNA as a probe, further cDNA
The library was screened and 8 new positive plaques were obtained. The nucleotide sequence of the longest inserted fragment was determined. As a result, c
It turned out to be DNA.

This gene was inserted into the EcoRI site of pUc118 to create pUC 1 1. 8 Rh2-8 was obtained.

In addition, E. coli transformed with this plasmid is E.
scherichja Coli S A M 1
It was named 386 and submitted to the Institute of Microbiology, Agency of Industrial Science and Technology, Microbiology Laboratory No. 10851 (FERMT)-10
8 5 1. ) has been deposited as.

38- (ii) Construction of a plasmid for expression of the Rhizopus ribonuclease Rh gene in baker's yeast In order to express the Rhizopus ribonuclease Rh in its intact form, the full-length Rhizopus ribonuclease Rh
pUc1 18Rh2-8 to Sa containing the DNA gene
A 0.8 kb fragment containing the Rhizopus ribonuclease Rh cDNA gene was isolated by I and EcoRI partial digestion, and the 7.5 kb fragment from YPR2831 as described above was isolated.
A plasmid that can be replicated and selected in baker's yeast, in which the Rhizopus ribonuclease Rh gene is linked downstream of a strong promoter derived from the glyceraldehyde 3-phosphate dehydrogenase gene of baker's yeast by ligation with the EcoR A SalI fragment of pYGRh2-8 was constructed (see Figure 3). In addition, in order to utilize the precursor region of the Rhizopus acid protease gene, we used the aforementioned uracil-containing single-stranded phage pIMPR1--39-U and synthetic DNA A303 (5'-GCCAG
TGGATCCGTTCCTAG-3') was used to restore the precursor region of the acidic protease gene using the restriction enzyme Ba.
Plasmid pengine M303 was constructed into which an mH engineering recognition site was introduced. Additionally, pUC1 1 8Rh2 contains the full-length Rhizopus ribonuclease Rh cDNA gene.
-8 to 0 by partial digestion with SalI and EcoRI.
A fragment containing the 8kb Rhizopus ribonuclease Rh cDNA gene was isolated, and the E of M13mp19 was isolated.
It was subcloned into the coRI-SalI site and the CJ236 strain was used as described above in the site-directed mutagenesis method to obtain a single-stranded fascia pIMRh2-8-U containing uracil. This phage and synthetic DNA A305 (5'-
Plasmid pI in which a restriction enzyme BamH recognition site was created after the signal sequence of the ribonuclease Rh gene using TTACAACGGATCCCAGTGG-3')
M305 was obtained.

-40- 0.75kb Sal IB a m from pIM305
H I fragment, 0.2 kb EcoR from p-engine M303
The I-BamHI fragment and the 7.5 kb EcoR A Sal fragment were prepared from the aforementioned pYPR2831, and the three fragments were simultaneously ligated to create the signal and precursor region of the Rhizobus acid protease gene downstream of the baker's yeast promoter. A plasmid pYGRNAP-Rh, which can be replicated and selected in baker's yeast, was constructed by connecting a chimeric gene in which Rhizopus ribonuclease Rh genes are linked in the same reading frame (see Figure 4).

(iii) Examination of production amount of Rhizopus ribonuclease Rh by transformed baker's yeast. Plasmids pYGRh28 and pYGRNAP containing the above-mentioned expressible Rhizopus ribonuclease Rh gene.
-Baker's yeast R27-7C- using Rh
I B (MAT(Z, trpl, ura3, h i
s3, 1ue2) and transformants with each plasmid with tryptophan auxotrophy, R
-Rh2-8 and R-RNAPRh were selected. Furthermore, using vector only p'YE209 as a control,
Transformant baker's yeast R-209 was obtained. One platinum loop of the obtained transformant was inoculated into 5 ml of YPD medium, and 2
Acid protease activity was measured using culture supernatants obtained during shaking culture for 4, 48, and 78 hours (see Table 2).

The activity of ribonuclease Rh was determined by the method of M.R. McDonald et al.
n Enzymology II, ed. by S.
P. Colowick and N. 0. Kaplan
, Academic Press Inc. , New
York (1955)).

O. containing 0.5χ RNA. LM acetate buffer (pH 5.
0) Add 100 μl of baker's yeast culture soil to 100 μl.
1 and react at 37°C for 5 minutes or 1 hour. To stop the reaction, add 100 μl of MacFadyne reagent (0.25
% uranium acetate, -42-2.5χ 1.lichloroacetic acid). After removing the precipitate by centrifugation, the test needle was diluted 12 times with distilled water.
Measure the absorption at 260 nm.

In this method, the activity when the change in absorbance for 5 minutes was 1 was defined as 1 unit. The results are shown in Table 2.

Table 2 As is clear from the results, when the culture supernatant bonuclease activity was measured after 72 hours, R-Rh2
-8, culture supernatant 1 m. Although only 0.08 units of activity per P-R h2-8 (7) was observed for R-RNAP-Rh, 43.9 units of activity per P-R h2-8 (7) approx.
It boasted an age of 550 times -43. ri・zofu゜sribonuk l/
It is known that the specific activity of Ase Rh is 1.1 units per 1 mg of protein L'1, and it is estimated that
This means that 4-O mg of paste bonuclease Rh was produced by baker's yeast per liter of Issei. In the transformant bread yeast eR-209 using vector-only pYE209 as a control, the activity of bonuclease Rl1 in the culture supernatant (J) was below the detection limit.

[Effects of the Invention] As described below, the precursor region of Rhizoblast acidic protease plays an important role in secretory production of proteins, and this region can be used to generate other genes (for example, Rhizoblast acidic protease Rh). By constructing a chimera with this gene) and expressing it as a chimeric protein in yeast, it is possible to efficiently secrete and produce a heterologous gene product outside the bacterial body.

[Brief explanation of drawings]

FIG. 1 is a drawing showing a manufacturing process diagram of pYPR273]. FIG. 2 shows the vector pYPR2841, p
FIG. 2 is a drawing showing a manufacturing process diagram of YPR2842 and pYPR2843. FIG. 3 is a diagram showing a manufacturing process diagram of plasmid pYRh2-8 in which the ribonuclease Rh gene is linked to a yeast expression vector. FIG. 4 is a drawing showing a production process diagram of plasmid pYGR NAP-Rh, which can be expressed in yeast and has the ribonuclease Rh gene connected downstream of the precursor region of the acidic protease gene. Above 145-1 Figure-625-

Claims (3)

[Claims] (1) The filamentous fungus Rhizopus niveus (Rhizopusni)
A chimeric gene is created by connecting a gene encoding a target protein or peptide downstream of the gene encoding the signal peptide and precursor region of acidic protease derived from S. veus, and a recombinant vector incorporating this chimeric gene is used to infect host yeast. A method for producing a target protein or peptide, which comprises transforming cells and culturing the host yeast cells. (2) The host cell is baker's yeast (Saccharomyce).
2. The method according to claim 1, wherein the method is scerevisiae. (3) The heterologous gene product is Rhizopus ribonuclease R.
The manufacturing method according to claim 1, wherein h.