JPH03262500A - Inspection of dysentery bacillus and/or intestinally intruding colibacillus and primer suitable for same inspection - Google Patents

Abstract

PURPOSE:To inspect the subject bacterium in high sensitivity by using a combination of primers for sense strand and antisense strand complement to gene of dysentery bacillus, etc., as a cell to be tested, enzymatically amplifying DNA fragment of said gene and detecting. CONSTITUTION:A combination of primers comprising a primer for sense strand and a primer for antisense strand complement to gene specifically existing in dysentery bacillus or intestinally intruding colibacillus is used as a DNA system of a cell to be tested and a DNA fragment containing a part of said gene is amplified by polymerase chain reaction(PCR) method using DNA polymerase as enzyme, then resultant amplified DNA fragment is detected by an electrophoresis method or a method using a specific probe to inspect dysentery bacillus and/or intestinally intruding colibacillus.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Field of Application] The present invention relates to a method for testing Shigella and/or enteroinvasive Escherichia coli using novel primers.

The present invention also relates to a novel primer suitably used in the above testing method.

Diarrheal diseases caused by Shigella and enteroinvasive Escherichia coli occur widely throughout the world, and are still important infectious diseases, especially in developing countries. This symptom is extremely severe and requires prompt diagnosis and treatment. Food contamination by the bacteria has also become a problem, and food testing for the bacteria is required for the purpose of preventing infection and identifying the source of infection.

Again, a rapid and sensitive method is desired.

[Prior Art] A conventional method for detecting the above-mentioned bacteria is the Sereny test using guinea pigs (Sereny, B., A.
cta.

Microbiol, Acad, Sci, Hung,
2.293-2961955) and testing methods that use cultured cells. In addition, an EIA method using a specific antibody against the antigen derived from the 140 megadalton plasmid involved in the pathogenicity of Honjo (Kenichi Ito, Moriko Nakamura, Haruo Watanabe et al., Japanese Journal of Bacteriology, Vol. 41, p. 414, 1986) was developed. ing. In addition, recently developed DNA probes include Japanese Patent Application Laid-open No. 61-44000 and U.S. patent A.
There is application No. 888194.

The former is a method of testing by hybridization using a Bam1 (I fragment) of approximately 27 kilobases (kb) or less, which contains many genes involved in cell invasion, as a probe.

The latter uses the 1paB gene fragment, 1paC gene fragment, and 1paD gene fragment contained in the BamHI fragment as probes.

[Problems to be Solved by the Invention] Among the conventional methods described above, the Seleny test and the method using cultured cells require time and expense, and the EIA method requires a complicated and time-consuming preparation method for antiserum, and the test itself requires approximately It took 20 hours. Furthermore, since the above conventional methods use animals, it is difficult to raise them. In addition, in methods using probes, it is difficult to prepare probes, and operations such as bacterial culture and hybridization take a long time, and furthermore, radioactive isotopes (R1) must be used due to low sensitivity. There are issues such as prevention of radioactive contamination and management of radioactivity.

An object of the present invention is to provide a method for testing Shigella and/or enteroinvasive Escherichia coli, which is more sensitive than conventional methods, and is also simpler and faster.

Furthermore, another object of the present invention is to provide complementary primers that can be suitably used in the above testing method.

[Means and effects for solving the problem] In order to solve the above problem, the invention of claim 1 provides a method for testing Shigella and/or enteroinvasive Escherichia coli. is a primer complementary to a gene specifically present in Shigella and enteroinvasive Escherichia coli,
A combination of a sense strand primer and an antisense strand primer is used in the DNA system of the cell to be tested, a DNA fragment containing a portion of the gene is amplified by an enzymatic method, and the amplified DNA fragment is detected. In claim 1, which is characterized in that 1paB, 1paC, 1pa
D, invE, 1nvG.

Such as 1nvJ or 1nvK. In particular, the nucleotide sequence of invE has been determined by Watanabe et al.
tanabe, H.

Arakawa, E., Ito, Kato,
J., Nakamura, A., J.

Urnal of Bacteriology 172
Volume 619-629 1990). This gene (inv
E) Surface antigens (jpaB, 1pa) involved in cell invasion
C or jpaD), and bacteria lacking this gene cannot invade cells and cause symptoms.

The complementary primer is a single-stranded DNA complementary to a part of the specific gene, and preferably has a length of 2 to 100
It is a nucleotide, more preferably an oligonucleotide of 10 to 40 nucleotides.

When the specific gene is invE, the complementary primer is the following five oligonucleotide primers 5°-ATATCTCT of the invention of claim 10.
ATTTCCAATCGCGT-3', 5°-AAAA
GGCTAATGAATCTCTTAG-3°, 5°-
CCTTGATACAAATTTGCCCCCG-3°
,3'-GGGAAGCGATTTTCAACTG-
5° or 3' -GCCCTATATTAAAGAGC
GGTAG-5゜ (in the formula, A, C, G, and T mean deoxyribonucleotides having adenine cytosine, guanine, and thymine bases, respectively. The same shall apply hereinafter.) or a primer having equivalent complementarity thereto. do. Here, primers with equivalent complementarity are primers that lack a certain base, have some extra bases, or have a slightly different base sequence compared to the base sequence above, as long as the complementarity is not hindered. This primer is also included in the above-mentioned complementary primers. The primers do not necessarily need to be purified, but when used as probes as described later, it is preferable to purify them in terms of test accuracy.

The combination of complementary primers is a sense strand primer for elongating a strand homologous to the mRNA of the specific gene, and the mR of the specific gene.
This combination includes at least one of each of the antisense strand primers for extending a strand that is complementary to NA. In this combination, if the sense strand primer and the antisense strand primer have complementarity, primer dimers will be formed and the amplification efficiency of the desired specific DNA fragment will be reduced. It is preferable that the sense strand primer has no complementarity.

In the method of the present invention, the selection of the primers and their combinations is very important; if oligonucleotides with low specificity are used as primers, DNA fragments other than the target portion may also be amplified. If a loop structure or a GC-rich portion exists, the signal may not be amplified at all. Furthermore, as described above, if the combination of primers is incorrect, primer dimers will occur, and the efficiency of amplifying the specific DNA fragment of interest will deteriorate.

When the specific gene is invE, the sense strand primers include three types of oligonucleotide primers 5'-ATATC having the following base sequences.
TCTATTTCCAATcGcGT-3'5'-AA
AAGGCTAATGAATCTCTTAG-3° or 5'-CCTTGATACAAAATTTGCCCCCC
G-3' or at least one primer having the same complementarity as these, arbitrarily selected, and two types of oligonucleotide primers 3°-GGGAA having the following base sequences as antisense strand primers.
GCGATTTTCAACTG-5' or 3'-G
At least one of CCCTATATTAAAGAGCGGTAG-5' or primers having equivalent complementarity thereto can be arbitrarily selected to form the complementary primer combination. That is, for example, specifically, there are six types of combinations (I) to (VI) shown below.

(I') 5'-ATATCTCTATTTCCAA
TCGCGT-3' and 795 816 3' -GGGAAGCGATTTTCAACTG-5
'1010 1028 (■) 5°-ATATCTCTATTTCCAATCG
CGT-3' and 795 816 3' -GCCCTATATTAAAGAGCGGTA
G-5'1155 1176 (I[[) 5'-AAAAGGCTAATGAATC
TCTTAG-3' and 871 892 3' -GGGAAGCGATTTTCAACTG-5
'1010 1028 (■)5°-AAAAGGCTAATGAATCTCT
TAG-3' and 871 892 3' -GCCCTATATTAAAGAGCGGTA
G-5゜11551176 (■)5゜-CCTTGATACAAATTTGCC
CCG-3' and 929 9
503'-GGGAAGCGATTTTCAACTG
-5'1010 1028 or (W) 5'-CCTTGATACAAAATTTGCC
CCCG-3' and 929 950 3' -GCCCTATATTAAAGAGCGGTA
G-5゜1155 1176 The numbers listed below in the above base sequence correspond to the base sequence numbers of the invE gene in the portion to which the primers have complementarity. The invE gene consists of approximately 1600 bases, and its base sequence number is +1 from the deleted end of pEA151.
(The above-mentioned document, Journal of Bact
eriology vol. 172 pp. 619-629 199
0 years).

One or more of the primers (I) to (VI) above may be replaced with a primer having the same complementarity as each of the primers. Furthermore, when the combinations (I) to (VI) above are used, the number of types of primers can be reduced and it is economically preferable, but it is also preferable to use the other five types of primers according to the invention of claim IO or the same complementarity as them. 1 from primer
In addition to the combinations (I) to (VI), one or more primers may be selected as a combination of the complementary primers described above. In this case, as will be described later, there are multiple types of the amplified DNA fragments.

The cells to be tested are, for example, cells in diarrheal stools or foods in which Shigella bacteria and/or enteroinvasive E. coli are thought to exist, and bacterial cells attached to them;
The DNA system of the cell means a system containing the DNA of the above cell. This DNA can be heated or treated with proteinase K.
The vines are prepared from the cells to be tested using conventional methods, such as those using

This DNA does not necessarily need to be purified.

For example, when the cells to be tested are bacterial culture fluids, DNA is prepared by heat treatment of the bacterial culture fluid in which the culture medium components are still present, and then the DNA is prepared by the polymerase chain reaction method (hereinafter referred to as PCR method) described below without purification. ) and other enzymatic methods. However, if blood is present in the cells to be tested, porphyrin will inhibit the PCR method described below.
The DNA system of the cell is obtained by removing porphyrin using a conventional method.

In the present invention, the enzymatic method refers to a method of amplifying specific DNA using an enzyme, such as 5aiki.

The PCR method reported by R, K. et al.
e Vol. 239, pp. 487-491, 1988, Japanese Patent Publication No. 6
l-274697), its modified method and its improved method (hereinafter referred to as P
CR method, etc.). According to these PCR methods, specific DNA fragments can be amplified from a small amount of sample. If a polymerase that is thermostable at the DNA cleavage temperature, such as Taq or Tth polymerase, is used as the DNA polymerase used in PCR methods, etc., replenishment of the enzyme is hardly required.
The R method etc. can be made into a simpler and faster method. In the PCR method, at least two types of primers are required, namely the sense strand primer and the antisense strand primer, and these primers are short single-stranded DNA complementary to a portion of the DNA to be amplified. be. The combination of these two types of primers is added in excess, and the template DNA containing the DNA to be amplified and 4
In a system containing a species of deoxyribonucleoside triphosphate and a DNA polymerase, only the portion of DNA sandwiched between the two primers facing each other is amplified. That is, the above two primers are single-stranded template DN.
It anneals to A, DNA polymerase works, and the amount of DNA sandwiched between the two primers facing each other doubles. Now, if we go back to the beginning and unravel the double-stranded part by heating and perform the same operation, this time, in addition to the same reaction as before, the other primer will also anneal to the DNA synthesized from the previous primer. Since it becomes a template, the area sandwiched between both primers is increased four times. By repeating this series of operations, it is possible to exponentially increase only the portion sandwiched between the primers. In other words, theoretically, the portion of DNA sandwiched between the primers will be amplified 2N times by performing the above series of operations N cycles. DNA polymerase can synthesize hundreds to thousands of bases per minute, so one cycle can be completed in 5 to 7 minutes.For example, 25 cycles of amplification can be completed in about 3 hours, and the efficiency of each cycle is 90%. %, then (1+
It is an excellent method for amplifying specific DNA in a short period of time.

In the testing method according to the invention of claim 3, the DNA fragment to be amplified by PCR method etc. is a DNA fragment containing a part of a gene that is specifically present in Shigella bacteria and enteroinvasive Escherichia coli.
This is fragment A. The size of the DNA and A fragments needs to be large enough to be amplified by PCR, so it is desirable that the size is about 4000 base pairs (bp) or less. Also, if it is too small, it will be difficult to distinguish it from the primer dimer.
It is desirable that the length is 50 bp or more. Furthermore, in order to be efficiently amplified in a short time, a more preferable size is about 50 to 1000 bp. Also, this amplified DN
The A fragment is determined by the combination of primers used in the method of the present invention. That is, the DNA fragment sandwiched by the primers used is amplified. For example, a gene specifically present in Shigella and invasive Escherichia coli is invE, and the combination of primers complementary to this gene is (I) (I) 5'-ATATCTCTATTTCCAAT.
CGCGT-3' and 795 816 3' -GGGAAGCGATTTTCAACTG-5
If ゜1010 1028 is selected, a primer for the sense strand starting from the position number 795 and a primer for the antisense strand ending at the position number 1028 are used in the PCR method, so the DNA fragment to be amplified has the base sequence. This is the part from 795 to 1028 of the number.

Therefore, in the invention of claim 6, the combination of primers used is a combination of any one of (I) to (VI) plus any one or more of the other types of primers of the invention of claim 10. If used, there will be one or more specific DNA fragments to be amplified.

As described above, according to the method of the present invention, when Shigella bacteria and/or enteroinvasive Escherichia coli are present in the cells to be analyzed, a DNA fragment containing a part of a gene specific to the bacteria can be easily extracted. amplified in a short time.

Various conventional methods can be used to detect this amplified DNA fragment, but
Since the NA fragment has been amplified, there is no particular need to use R. For example, it can be detected by electrophoresis based on the size of the DNA, or by using a specific probe labeled with non-R1. DNA amplified by methods etc.
Detection of fragments, ie Shigella and/or enteroinvasive E. coli, is possible. In the method of detection using a specific probe, one or more primers used in PCR methods etc. that are modified by a conventional method to the primer contained in the DNA fragment to be amplified can be used as the probe. .

For example, when amplifying a DNA fragment containing a part of the invE gene, 5°-CCTTGATACAAAATTTGCCCCCG of the five types of primers according to the invention of claim 10 is used.
-3° and 929 950 3' -GCCCTATATTAAAGAGCGGTA
When G~5'11.55 1176 is used as the primer combination, the DNA fragment to be amplified is from base sequence number 929 to base sequence number 1176. Therefore, the primer that can be used as a probe is 5''-CCTTGA contained in the above base sequence number 929 to 1176 among the five types of primers according to the invention of claim 10.
TACAAATTTGCCCCCG-3'929
950 3°-GGGAAGCGATTTTCAACTG-5°
or 1010 1028 3°-GCCCTATATTAAAGAGCGGTAG
-5'1155 1176 or at least one modified primer having complementarity equivalent to the above three types of primers can be used as a probe.

In the method of the present invention, since the DNA fragment to be detected is amplified, there is no particular need to modify the probe or label it using RI, such as digoxigenin-11.
The DNA fragment to be detected can also be detected with high sensitivity by labeling with -dUTP. Therefore R
This method has the advantage of not causing the radioactive contamination problem associated with method I, and does not require special equipment or skilled personnel. Furthermore, the primers of the present invention can automatically synthesize DNA in about 3 hours, and can be easily purified in about 3 hours.

Therefore, it can be used as an easily available probe.

EXAMPLES The present invention will be specifically explained below with reference to Examples, but the present invention should not be limited thereto.

(Example 1) PC of DNA fragment containing part of invE
Amplification by R method (1-A) Preparation of E. coli DNA containing invE First, in order to prepare DNA containing the invE gene derived from Shigella, recombinant plasmid pHW1273 containing the invE gene derived from Shigella and the ampicillin resistance gene was used. (p
ss120: :Tnl) (Watanabe,
H., Nakamura, A.

Infection and Immunity 48
Vol. 260-262, 1985) (1 copy/cell) of Ni-12D old strain of E. coli) IW1273 (obtained from the Department of Bacteria, National Institute of Preventive Health, Tokyo) was used.

The above E. coli was treated with Y containing ampicillin (50 μg/d).
T medium (contains 5 g of NaCl, 8 g of bactodoryptone, and 5 g of yeast extract per liter of distilled water) 200 to
A platinum loop was inoculated and cultured with shaking at 37°C overnight. The culture solution was centrifuged at 3,000 rpm for 30 minutes to collect the bacteria, washed with physiological saline, and then centrifuged again at 3,000 rpm for 15 minutes to remove medium components. I got it. To this was added 0.1 M NaCl,
0.1M Tris-HCI containing 10mM EDTA (
After suspending the bacterial cells by adding 3.6- solution (pH 8.0), 400 μl of lysozyme (40 μ/-) was added and stirred.
It was heated at 7°C for 10 minutes. Add 5% SDS to this solution, 0
．． 1 M NaCl, l OmM EDTA.
A solution of 1 M Tris-HCI (pH 8.0) was added and mixed by inversion, followed by heating at 60° C. for 20 minutes to disrupt cell membranes. A mixture of equal amounts of nerphenol and chloroform saturated with 50mM Tris-HCI (pH 7,5) was added to this and left to stand for 1 hour, and the upper layer was removed.
After adding chloroform and mixing, add 3000 ml of chloroform for 30 minutes.
Centrifugation was performed at rpm to obtain a DNA solution in the upper layer. This phenol/chloroform extraction was repeated two more times to remove proteins. Ether was then added to this upper layer and mixed, followed by centrifugation at 3000 rpm for 10 minutes, and the upper layer was removed to obtain a lower layer. After repeating this ether extraction two more times to remove phenol/chloroform,
71 Ll of ethanol was added and the mixture was allowed to stand at -70°C for 15 minutes. Thereafter, the DNA precipitate obtained by centrifugation at 3000 rpm for 20 minutes was washed with 70% cold ethanol and dried under reduced pressure. Add ribonuclease buffer (1mM EDTA, 0.15M NaCl) to this.
20mM) Lis-HCI (pH 7,4) containing 2
After adding and dissolving vtl, add heat-treated glue bonuclease (
10 mg/i) was added at 80μ and reacted at 37°C for 2 hours to remove RNA. After extracting this solution twice with phenol and twice with ether, 41 nl of cold ethanol was added and allowed to stand overnight at -20°C.

It was centrifuged at 3000 rpm for 20 min, and the resulting DNA precipitate was washed with 70% cold ethanol, dried under reduced pressure, and then diluted with 1 mM containing 0.1 mM EDTA.
Dissolved in solution 2- of Tris-HCI (PH 7,4).

It was stored frozen as a DNA sample solution.

(1-B) Selection and synthesis of oligonucleotide primers Base sequence of invE gene (Watanabe, H.
, Arakawa.

E., Ito, K., Kato, J.
Nakamura, A., Journal o
f Bacteriology Volume 172 619-62
9, 1990), specific oligonucleotide primers were selected using the following method.

From the N-terminus of InvE protein, ParB (Abele
s, A, L, .

Friedman, S. A., Au5tin.
, S, J, , J, Mo1. Biol, 1
85, pp. 261-272, 1985) and SopB
(Mori, H., Kondo.

A, , Oshima, A, , Ogura,
T, , Hiraga, S, , J, Mo1.
Bio1192, pp. 1-15, 1986), but the portion from the C-terminus had no similarity to known proteins (see the above document, Journal of Bacter
iology, Vol. 172, pp. 619-629, 1990)
. Therefore, repeat sequences, similar sequences, regions with high GC content, palindromic structures, and loop structures that may inhibit specific amplification are removed from the 3° portion of the invE gene that encodes the C-terminal portion of the InvE protein. After searching with a computer, the following five types of oligonucleotides were selected as primers.

That is, the following three types of primers were selected as sense strand primers, and 5'-ATATCTCTATTTCCAATCGCG
T-3795816 5'-AAAAGGCTAATGAATCTCTTA
G-3゜871 892 5' -CCTTGATACAAAATTTGCCCCCC
G-3゜929 950 The following two primers are used for antisense strands.
Species primers were selected.

3°-GGGAAGCGATTTTCAACTG-5'
1010 1028 3°-GCCCTATATTAAAGAGCGGTAG
-5'1155 1176 The numbers shown below in the nucleotide sequence are base sequence numbers, and are the same as above. These oligonucleotides were synthesized by DNA synthesis from Pharmacia, Sweden.
LKB Gene Assembler Plus
) and an anion exchanger (Sweden, Pha
A liquid chromatograph (FP manufactured by Pharmacia, Sweden) was used.
Purified by LC).

The above synthesis is performed automatically and takes approximately 3 hours.

The subsequent purification takes about 3 hours and is easy.

Escherichia coli has approximately 4.2 x 10 base pairs of DNA, but only a portion of it has been sequenced. Therefore, if the primers theoretically selected by the above method also anneal to the as-yet unknown nucleotide sequence of E. coli, parts other than the DNA fragment containing the invE gene will also be amplified.
Such primers cannot be said to be specific.

In order to confirm that only the specific portion of the invE gene was amplified by the five selected oligonucleotide primers, the following experiments (1-C) and (1-D) were conducted.

(1-C) Amplification of E. coli DNA fragment containing invE (
The DNA prepared in 1-A) was amplified using the PCR method described above. The primers synthesized in (1-B) were used as specific primers required in the PCR method.

As for the combinations of primers, that is, the combinations of the sense strand primer and the antisense strand primer, all six possible combinations (1) to (Vl) of the five types of primers were used, and each set was PCR method was performed on the following. The reaction solution whose composition is shown in Table 1 was covered with mineral oil using a DNA Thermal Cycler (
(manufactured by PERKIN ELMERCETUUS, USA). Heat denaturation at 92°C for 1 minute, annealing at 61°
After performing an extension reaction at 70°C for 2 minutes, heat denaturation at 92°C for 10 seconds, annealing at 61°C for 1 minute, and extension reaction at 70°C for 2 minutes were performed for 39 cycles. then 70
The mixture was kept warm at ℃ for 7 minutes.

Table 1 In Table 1, the 10x concentration reaction buffer is 500 dKCI.
, 100mM Tris-HCI (p)18.3) containing 15mM MgCl2.
TP) at 1.25 mM each, and DNA
The solution was a 100-fold dilution of the DNA storage sample solution prepared in (1-A), and the primers contained 1.25 μM each of the sense strand primer and the antisense strand primer.

(1-D) Detection of amplified DNA fragments After the amplification reaction, a portion of the reaction solution was mixed with a size marker for 5 minutes.
% polyacrylamide gel electrophoresis and staining with ethidium bromide. As a result, as shown in FIG. 1, DNA fragments of the expected size were confirmed with each primer combination. That is, in FIG. 1, lane 1 is the result of electrophoresis of a fragment obtained by digesting commercially available plasmid pBR322 with old nfl for control, and lanes 2 to 7
are the above-mentioned (1) to (Vl) as primer combinations, respectively.
) are the results of electrophoresis when each was used in the PCR method.

The DNA fragment amplified by PCR is the portion sandwiched between two primers. For example, in the case of lane 2, 5°-795 to 816-3' for the sense strand,
3゛1010-102 for antisense strand
Since a primer with a base sequence number of 8-5' is used, the DNA portion to be amplified is at base sequence number 795.
Therefore, the size of the DNA fragment to be amplified is 1028-795+1·234 bp. Similarly for other lanes 3 to 7, subtract the 5' salt base sequence number of the sense strand primer from the 5' salt base sequence number of the antisense strand primer and add 1 to that number.
The sum of the numbers is the expected size of the DNA fragment.

Actually, as shown in FIG. 1, lanes 2 to 7 are 234 bp, 382 bp, and 158 bp, respectively.
, 306bp, 10obp and 248bp
fragment was amplified and detected as expected.

In addition, each amplified DNA fragment was digested with the restriction enzyme old nfJ.
% polyacrylamide gel electrophoresis to confirm that all DNA fragments had been cleaved to the expected size.

Based on the above experimental results, combinations of the five primers (
It was confirmed that a portion of the invE gene could be specifically amplified using any of methods I) to (VI).

(Example 2) Testing of Detection Sensitivity The detection sensitivity when target bacteria were detected by the test method according to the present invention was tested as follows.

(2-A) Preparation of E. coli DNA containing invE To first prepare a DNA sample solution to be tested, -12DHI strain E. coli HW1273 was used in the same manner as in the first example. The above Escherichia coli was inoculated into YT medium IO- containing ampicillin (50 μg/d) by a platinum loop, and cultured with shaking at 37° C. overnight. A portion of this culture solution was diluted, the absorbance at 500 nm was measured, and ODi was determined.

The bacterial cell concentration of the culture solution was calculated as 0=4×10′ cells/mA′ and was 5.4×10′ cells/mj.

This culture solution is subjected to (i) heat treatment only, or (
ij) After treatment with proteinase, heat treatment was performed to prepare a DNA sample solution.

(i) Heat treatment method Culture solution 1- was treated at 97°C for 0 minutes to prepare a DNA sample solution.

(ii) Proteinase K and heat treatment culture solution 0.1-
After centrifuging and removing the supernatant, the pellet was mixed with a buffer containing a nonionic surfactant (50mM KCI, 2
．． 5mM MgC1z, O, Img/-gelatin, 0.45% Nonidet P40, 0.45% Tween 2
IOmM containing 0)ris-〇CI([)88.3)
) 8.9-. 3 μl of Broteinase K (20 μl/−) was added to this suspension 1-, heated at 50 to 60° C. for 1 hour, and then heat-treated at 95° C. for 10 minutes to prepare a DNA sample solution.

(2-B) Detection sensitivity Using the diluted DNA sample solutions obtained in (i) and (ii) above, an amplification reaction was performed by PCR method, and the detection sensitivity was determined. The primer combination is 5'-CCTTG
ATACA, AATTTGCCCCCG-3' and 3'
-GCCCTATATTAAAGAGCGGTAG-5
A combination (VI) consisting of ' was used.

As a diluent for the DNA sample solution, for the DNA obtained by method (i) in 50 μl of the reaction solution, dilute the solution at 1500° and 150°.
For the DNA obtained by method (ii), prepare a diluted solution (hereinafter referred to as DNA dilution solution) containing the amount derived from 00 or 150000 cells, and the amount derived from 15000 or 15000 cells, respectively. DNA was amplified by the PCR method as follows.

The composition of the reaction solution used in the PCR method is shown in Table 1.
Use an appropriate amount of the DNA dilution solution as a solution, and add Taq
The composition of the reaction solution was the same as shown in Table 1, except that 2.5 U/- of DNA polymerase was used and distilled water was added until the total volume of the reaction solution reached 50 μl.

This reaction solution was covered with mineral oil and set in a DNA thermal cycler. Heat denaturation at 92°C for 1 minute, annealing for 61'CI minutes, extension reaction at 70'C for 2 minutes, heat denaturation at 92°C for 10 seconds, annealing at 61°C.
39 cycles of C1 minute and extension reaction 700C2 minutes were performed. Thereafter, it was kept warm at 70°C for 7 minutes. This simple and rapid PCR method theoretically amplifies the amount of DNA in the sample solution by about 240 times.

20 μl of a solution containing DNA amplified by the PCR method in this way was subjected to 5% polyacrylamide electrophoresis with a size marker, stained with ethidium bromide, and injected into
A DNA fragment containing part of the E gene was detected. The results are shown in Figure 2.

That is, in FIG. 2, lane 1 shows the results for a reaction solution containing no DNA and corresponds to a blank. Lanes 2 to 4 are (i) 150,000 and 15,000, respectively, when the DNA sample solution was prepared by the heat treatment method.
and 1500 cell-derived DNA is contained in 50 μl of the reaction solution. A 248 bp fragment was detected in lanes 2 and 3, that is, E. coli was detected. However, lane 4, ie, DNA derived from 1500 cells, was undetectable.

Lane 5 shows the pBR322 fragment as a control for fragment size.
This is the result of electrophoresis of fragments digested with old nfl.

Lanes 6 to 9 are the results when the DNA sample solution was prepared by (ii) proteinase K and heat treatment method,
Lanes 6 to 9 show the results when DNA from 15,000, 1,500.150, and 15 cells was contained in 50 μl of the reaction solution, respectively.

A 248 bp fragment was detected in lanes 6 to 8,
In other words, E. coli was detected. However, DNA derived from lane 9, ie, 15 cells, was undetectable.

From the above results, it can be seen that the method (i) using only heat treatment in a 50 μl amplification reaction system results in at least 15,000 or more (h)
in the proteinase and in the heat treatment method, at least 1
If there is DNA derived from 50 or more cells, it is invE.
It was possible to detect E. coli containing the gene. This is about 7 to 100 times more sensitive than the conventional probe method using RI. That is, it was confirmed that the testing method according to the present invention has better detection sensitivity than the conventional method.

(Example 3) Detection of invasive Escherichia coli (EIEC) Clinically isolated bacteria (27 strains of EIEC and 8 other pathogenic Escherichia coli strains) were used as samples, and the method of the present invention and conventional methods such as the Sereny test, the cell invasion test, and the cell surface The test results were compared with the EIA method using antiserum against the antigen (Kenichi Ito, Moriko Nakamura, Haruo Watanabe et al., Japanese Journal of Bacteriology, Vol. 41, p. 414, 1986), and its specificity was confirmed.

(3-A) Preparation of DNA from Samples The 35 clinically isolated strains described above were cultured overnight at 30°C on an ordinary agar medium. Each platinum loop at 1 mM ED
A DNA sample solution was prepared by suspending the DNA in a solution of 10+nM Tris-HCI (pH 8,0) containing TA and heat-treating it at 97°C for 10 minutes.

(3-B) Amplification of DNA by PCR method The specific primer combination required for PCR method is 5'-C
CTTGATACAAAATTTGCCCCCG-3° and 3゛~GCCCTATATTAAAGAGCGGTAG
-5° was used.

The composition of the reaction solution used in the PCR method is shown in Table 1.
The reaction solution composition was the same as that shown in Table 1, except that the DNA sample solution prepared in (3-A) above was used as solution A, 5 μl of Taq DNA polymerase, and 22 μl of distilled water were used.

This reaction solution was covered with mineral oil and set in a DNA thermal cycler. Heat denaturation at 92°C for 1 minute, annealing at 61'CI, extension reaction at 70°C for 2 minutes, heat denaturation at 92°C for 10 seconds, annealing at 61' CI.
C. for 1 minute and extension reaction at 70.degree. C. for 2 minutes for 39 cycles. Thereafter, it was kept warm at 70°C for 7 minutes.

(3-C) Detection by electrophoresis 20 μl of the reaction solution obtained by PCR was subjected to 5% polyacrylamide gel electrophoresis with a size marker, and detected by staining with ethidium bromide. As a result, only when the 27 bacterial strains that were positive using the conventional method were used as samples.
A specific DNA fragment containing the vE gene was detected, but was not detected in the eight strains that were negative using the conventional method. In other words, the results were completely consistent with the conventional method. Therefore, it was confirmed that the testing method according to the present invention has specificity.

(3-D) Detection using a probe 5% polyacrylamide gel electrophoresis was performed in (3-C) above, and the gel stained with ethidium bromide was Southern transferred and the oligonucleotide 3′ of the present invention
-GGGAAGCGATTTTCAACTG-5° labeled with digoxigenin-11-dUTP was used as a probe and detected in a non-R1 manner using a detection kit (DNA labeling & detection kit product number 1093657) manufactured by Boehringer Mannheim, West Germany. As a result, the position of a specific DNA fragment was detected only in positive bacteria.

Therefore, it is not necessary to label the probe with RI as in the conventional probe method, and the target bacteria can be detected. Furthermore, the easily prepared primer according to the present invention can be used as a probe.

[Effects of the Invention] According to the testing method according to the invention of claims 1 to 9, Shigella and/or enteroinvasive Escherichia coli can be detected with higher sensitivity than conventional methods. Therefore, it is possible to test even a small number of samples. It is also possible to test using a non-RI method that does not pose risks such as radioactive contamination.

According to the test method according to the second aspect of the invention, the DNA fragment to be amplified is efficiently amplified, so that the test can be performed more quickly.

According to the testing method according to the invention of claim 4, since the PCR method can be automated, testing can be performed more quickly and easily.

According to the testing method according to the invention of claim 8 or 9, specific probes are easily available.

The primer according to the invention of claim 10 is easily available,
Can be suitably used in the inspection according to the present invention, and
It can also be used as a probe. It can also be used to amplify specific DNA fragments for purposes other than such testing.

[Brief explanation of drawings]

Figure 1 shows the results of polyacrylamide gel electrophoresis stained with ethidium bromide when the amplification reaction was performed using each primer combination (I) to (VI) in (1-D) in the first example. Showing gel. FIG. 2 shows 15 to 1 in (2-B) in the second embodiment.
This figure shows a polyacrylamide gel electrophoresis gel stained with ethidium bromide when an amplification reaction was performed using an amount of DNA derived from 50,000 cells.

Claims (10)

[Claims] (1) A combination of a sense strand primer and an antisense strand primer, which is complementary to a gene specifically present in Shigella and enteroinvasive E. coli, is applied to the cells to be tested. DN of
A method for testing Shigella and/or enteroinvasive Escherichia coli, which is used in the A system and comprises amplifying a DNA fragment containing a part of the gene by an enzymatic method and detecting the amplified DNA fragment. (2) The method according to claim 1, wherein the DNA fragment has a size of 50 to 1000 base pairs. (3) The method according to claim 1 or 2, wherein the enzymatic method is a polymerase chain reaction method. (4) The method according to claim 3, wherein the DNA polymerase used in the polymerase chain reaction method is thermostable at the DNA strand cleavage temperature. (5) The method according to any one of claims 1 to 4, wherein the specifically existing gene is the invE gene. (6) The following three primers are used as the sense strand primers.
Select at least one of the primers that are the nucleotide sequence of the species [there is a gene sequence] or the primers that have the same complementarity as these, and use the primers that are the following two nucleotide sequences as the primers for the antisense strand [ 5. The method according to claim 5, wherein at least one primer is selected from primers having the same complementarity as the gene sequence] or these primers. (7) The method according to any one of claims 1 to 6, wherein the method for detecting the amplified DNA fragment is either electrophoresis or a method using a specific probe. (8) The method according to claim 7, wherein at least one of the complementary primers contained in the DNA fragment to be amplified is used as the specific probe. (9) The specific gene is the invE gene, and the specific probe is a primer with the following base sequence [there is a gene sequence] and is included in the DNA fragment to be amplified, or a primer equivalent to these. 9. The method according to claim 8, wherein at least one primer having complementarity is arbitrarily selected and used. (10) Primer with the following base sequence [There is a gene sequence] or [There is a gene sequence] or primers with equivalent complementarity to these