JPH03262485A - Hybrid promoter operator - Google Patents

Abstract

NEW MATERIAL:The title operator wherein a first DNA fragment consisting of -35 range and -10 range of promoter of inducing manifestation of initial gene group of T3 phage of Escherichia coli and a second DNA fragment of controlling manifestation of the promoter are bonded at 3' side of -10 range of the first DNA fragment and at 5' side of the operator of the second DNA fragment. EXAMPLE:An operator of base sequence shown by the formula (underline parts successively show -35 range and -10 range and wavy line part shows operator range). USE:Production of protein and peptide by genetic engineering method. PREPARATION:A first DNA fragment is bonded to a second DNA fragment at the downstream of -10 range in the first DNA fragment and at the upper stream of the operator range of the second DNA fragment.

Description

Detailed Description of the Invention (Industrial Application Field) The present invention is directed to strongly expressing genes linked downstream (3' side) at least in Escherichia coli (prior art). When expressing a protein using recombinant DNA technology as a host, protein productivity is greatly affected by the efficiency of transcription of a structural gene encoding the protein into mRNA.

Transcription efficiency refers to the efficiency with which RNA polymerase initiates mRNA synthesis, and it depends on the so-called promoter strength, and is controlled by the base sequence of the promoter, that is, the -135 region and -10 region in the promoter. It is something that Gene transcription is the first step in gene expression (i.e., protein expression), and more efficient transcription can be achieved when attempting to obtain a large amount of a desired protein or peptide by genetic recombination technology. It is necessary to use a strong promoter.

By the way, if a strong promoter is simply introduced upstream (5° side) of the structural gene on the vector, host cells transformed with the vector will continue to express the desired protein, which will have a negative impact on their growth. As a result, the final expression level of the protein may decrease, or in some cases, the expression level may decrease in the subcultured host.

In order to avoid such a situation, conventional operations have been performed such as suppressing the expression of the promoter for a certain period of time and releasing the suppression under certain conditions.

(Problems with the Prior Art) Conventionally, the tryptophan promoter (referred to as trp) of Escherichia coli has been used as a promoter that is expressed only under certain conditions. Emtage, J.

S. et al., Nature, vol. 283, p. 171, 1983.
), the lactose promoter (lac),
I takura, ni, Sci ence, 19
8, p. 1056, 1977) or the E. coli phage PL promoter (Bernard, H. Gene, 5
Vol. 59, 1979).

For example, in lac, its expression is controlled by binding of a repressor protein to an operator region located downstream of the promoter region. In order to release the inhibition of lac, a lactose analog that impairs the binding between the repressor protein and the operator region may be added.

However, promoter operators such as lac, which can easily control expression, have a problem in that their expression power is relatively weak. In addition, tr, which has relatively strong expression power,
The problem with p is that it is difficult to control.

On the other hand, there has been provided a hybrid promoter in which a promoter with relatively strong expression power is combined with a promoter/operator that is easy to control, as described in JP-A-57-194790. Among them, rtacJ
The hybrid promoter of trp and IacUV5 promoter/operator, called trp, has both the strong expression power derived from trp and the ease of control derived from 1acUV5, and is particularly effective in producing proteins by genetic recombination. promoter/operator (in addition to the above publications, Natl, Acad, Sci
, USA 80. 21-25.
1983).

However, in recent years, promoters with expression power exceeding that of trp have become known, and the emergence of a promoter with performance exceeding that of tac is desired. In addition, the promoter described in JP-A-57-194790 by tac et al. has the problem that it cannot be easily manufactured because two promoters are linked between the 135 consensus region and the 110 consensus region. be.

This is because the expression power of the promoter is -35 and -10
This is because it is affected not only by the highly conserved base sequences of the consensus regions but also by the distances between these regions. Therefore, when producing such a promoter,
It is necessary to prepare a large number of samples in which the number of bases between the -35 and -10 consensus regions is changed.

(Means for Solving the Problems) The present inventors have discovered that one of the initial genes of Escherichia coli phage T3
By combining a first DNA fragment consisting of the region and -10 region with a DNA fragment that can control the expression of the fragment, a new promoter operator that can easily control expression and has strong expression power is created. They discovered what they could provide and completed the present invention.

That is, the present invention provides a first DNA fragment consisting of the 35 region and -10 region of a promoter that induces the expression of the E. coli T3 phage early gene group, and a second DNA fragment consisting of an operator region capable of controlling the expression of the promoter. , the 3' side of the 110 region of the first DNA fragment and the second DNA fragment.
This is a hybrid promoter operator formed by linking to the 5' side of the operator part of the A fragment. The present invention will be explained in detail below.

A promoter that induces the expression of the E. coli T3 phage early gene group refers to a DNA sequence that has a promoter function and is present in the genome of the E. coli phage T3 group. The same applies even if the base is deleted, substituted, or inserted. As naturally occurring T3 phage early gene promoters, three promoters (A Al12ゝA3 promoter) located at the left end of the phage genome and forming a cluster are known (Nucleic
Ac1ds Re5earch Volume 14,
No. ll, Section 4696, 1986).

In the present invention, in addition to these three naturally occurring promoters, as explained above, promoters derived from these promoters and mutated artificially as well as naturally mutated can basically be used. Derived from these promoters,
Any promoter may be used as long as it has a promoter function.

Hereinafter, a promoter called A3 (hereinafter referred to as A3 promoter) among naturally occurring promoters will be explained as an example, but it goes without saying that the following explanation also applies to A1 and A2 promoters.

Specifically, the A3 promoter consists of a base sequence represented by the following formula (2).

Formula ■; 5-TTAAACAAAGTGG 3-AATTTGTTTCACC AACTGTTGTACTTCATTCA3” T5= (However, the symbols in the formula are the same as those used in the general field of genetics) The hybrid promoter-operator of the present invention provides its expression power. The first DNA fragment is a promoter that induces the early gene group of the T3 phage as described above, for example, A3 consisting of the base sequence shown by the formula (2) above.
Derived from promoter. The first DNA fragment does not contain all of these promoters, but consists of the -35 region and -10 region, and in the present invention, only fourteen of these promoters are included.
It does not include the flanking area upstream of the 135 area such as 3 areas. Here, for the -35 and -10 regions, the formula (2) is underlined.

=35 region is rT T G A CAJ, -10
The region is rTAcGATJ. These first DNA fragments can be prepared from natural T3 phage, or can be prepared by artificial synthesis as shown in the Examples.

Specifically, the second DNA fragment used as the second DNA fragment in the present invention and consisting of an operator region capable of controlling the expression of a promoter is, for example, a region that does not contain a promoter region such as the -10 region. Iac located on the 3' side.

This is a fragment consisting of an operator region such as a PL operon. Among these, a portion located downstream of the 110 region of the lac operon, ie, an operator portion that does not include the 110 region that is the promoter region, is preferred because it is easy to operate to control the expression of the first DNA fragment.

Specifically, this lactose operator region is calculated by the following formula■
It contains the base sequence shown below.

Formula ■ 5-GTGTGGAATTGTGAGCGGA3-CA
CACCTTTAACACTCGCCTTAAACAATT
TCACAC3-ATTGTTAAAGTGTG 5- (However, the symbols in the formula are the same as above.) The above arrangement (■) is a conventionally known arrangement, for example, as disclosed in Japanese Patent Laid-Open No. 5
No. 7-194790.

Therefore, the above-mentioned sequence can be prepared by referring to these documents, and can also be prepared by artificial synthesis.

Here, the second DNA fragment does not need to contain, for example, the same or all of the base sequence (2) above, and may be anything that can control the expression of the promoter.

In the present invention, the first DNA fragment and the second DNA fragment are located downstream of the first DNA fragment and the second DNA fragment.
It is attached upstream of the operator region of the NA fragment. In other words, a new hybrid promoter operator is prepared in which the bases existing between the 135 region and the 110 region, which are closely related to the expression ability of the promoter, are unchanged from those of the promoter providing the first DNA fragment. be. Here, the hybrid promoter to be prepared
In the operator, a base that does not participate in any function may exist between the -10 region and the operator region. These bases may be derived from the first DNA fragment, the second DNA fragment, or may be artificially added. However, the presence of many additional bases between the -10 region and the operator region may affect the expression power of the promoter and the control power of the operator, so it is desirable that the number of such bases be small.

The promoter of the present invention comprises a first DNA fragment derived from a T3 promoter having strong expression power and the first DNA fragment.
It is formed by binding a second DNA fragment that can control the expression of the A fragment. As explained above, the first DNA
Fragments include T3 promoter (A A or A
3 promoter) 1 2 can be used, and as the second DNA fragment, a fragment derived from the 1acSPL operon can be used. Among them, the one in which the fragment derived from A3 promoter and the fragment derived from lac are combined has strong expression power,
It is easily controllable.

As a hybrid promoter operator of the present invention, one 35 region of the A3 promoter sequence shown in the formula,
-10 region and a portion derived from the lac operator region shown in formula (2), which has a base sequence shown by the following formula (1) or (2).

Formula ■ CACGGTACGATGTGTGG GTGCCATGCTACACACC A A CT G T T G T A C
T T CA T T CTTAACACTCGC
CTATTG GTGCCATGCTATTAACA GAGCGGATAACAATTA 3”CTCG
CCTATTGTTAAT 5 (However, the symbols in the formula are those used in normal genetics, and the symbols indicate the -35 region or -10 region, respectively, and the wavy line indicates the operator region.) Formula ■ 5- TTGACAACATGAAGTAAG3-
AACTGTTGTACTTCATTCAATTT
CACACA 3- TTAAAGTGTGT 5 (However, the symbols in the formula are those used in normal genetics, and the symbols indicate the -35 region or -10 region, respectively, and the wavy line indicates the operator region.) The above formula (■) or In (■), -35 derived from the above formula (■)
The first DNA fragment consisting of the region and -10 region (underlined part) is a second DNA fragment consisting of the part located downstream of the -10 region (operator region double wavy line part) derived from the formula (2) above.
It is a combination of two parts and one without an additional base in between.

The hybrid promoter operator of the present invention consisting of the base sequence represented by the formula (1) or (2) above has a second DN
Since the A fragment has a lac operator region, its expression can be achieved by introducing a gene encoding a repressor protein such as 1acl or 1aclq into a vector or into the host genome, or by introducing it into the host genome. It can be easily controlled by utilizing these genes present in the human body.

(Effect of the invention) The hybrid promoter-operator of the present invention is
By using a sequence consisting of an operator region that can control the promoter as the second DNA fragment, it is possible to control the DNA (usually a drawn gene...) connected downstream (3-side). It is something that is strongly expressed in certain conditions. Therefore, it is suitable for industrially producing proteins or peptides using genetic techniques. Since such a hybrid promoter/operator has the characteristic that its expression can be easily controlled, it is particularly effective in cases where the expressed protein interferes with the growth of the host.

The present invention provides a novel hybrid promoter-operator. In the field of genetics, where it is necessary to search for and use the most appropriate expression system for the expression of various proteins, the hybrid promoter of the present invention, which has strong expression power and easy controllability of expression, is useful. The operator responds to such requests.

The hybrid promoter-operator of the present invention is
Parts of the promoter, 135 region and 110 region, are derived from the same promoter. Therefore, it has the characteristics that it can be prepared without considering the number of bases in the second region IHI, and moreover, it can be easily prepared artificially.

(Examples) Examples will be described below to explain the present invention in more detail, but these are only examples of the present invention and are not intended to limit the present invention.

Example I DNA part derived from A3 promoter and part 1 of 1aC
Plasmid pA3 consisting of the DNA portion downstream from the 0 region
-L5 was constructed.

Plasmid pKK232-8 (vector for promoter strength test expressing chloramphenicol resistance gene (hereinafter referred to as CAT) manufactured by Pharmacia, cat
2μg of DNA of No. 27-4925-01) was added to 50μ
m* solution (10mM Tris-HCl pH 7, 5, 50mM)
MNaC! .

37 with Sal I (5 units) and Hind III (5 units) in 1mM dithiothreitol).
Digested for 1 hour at ℃.

After the reaction, the reaction solution was extracted with equal amounts of phenol/chloroform, and twice the amount of ethanol was added to precipitate and collect the digested plasmid DNA. The recovered plasmid DNA was added to 10 μl of TE buffer (10 m M 1-Lis-HCl pH 8, 0, 1 m M E D T A ).
dissolved in. Hereinafter, this solution will be referred to as DNA solution A.

Synthetic NA of the following formula (3.8μg; 100pm100p
and synthetic NA■ (3.8μg; 10100p le)
1 in 50 μl of 5mM MgCl2 solution at 70°C.
After heating for 0 minutes, annealing was performed by further heating at 37° C. for 30 minutes. The solution containing this annealed synthetic DNA and (2) will be referred to as DNA solution B hereinafter.

Synthetic NA■ (-main chain) 5- TCGACTTGACAACATGAAGTA
AGCACGGTACGATAATTGTGAGCGG
ATAACAATTA 3 Synthetic DNA ■ (-main strand) 3 = GAACTGTTGTACTTCATTCG
TGCCATGCTATTAAACACTCGCCTAT
TGTTAAATTCGA 5' (However, the symbols in the formula are the same as those used in the general field of genetics) 2 μl of DNA solution A and 10 μl of DNA solution B are combined at 50%
μm buffer (66mM Tris-HCl pH 7, 6, 5m
M MgCl2.5mM dithiothreitol, 0.6
After adding 74 DNA ligase (50 units) to the solution, the mixture was reacted at 16°C for 20 hours.

10 μm of this reaction solution was used to transform Escherichia coli (strain JM109) according to a known method, applied to an LB plate containing chloramphenicol at a concentration of 50 μg/ml, and left overnight at 37°C. The emerging E. coli colonies were inoculated into LB medium containing chloramphenicol at a concentration of 50 μg/ml, and cultured with shaking at 37° C. overnight.

Plasmid DNA was recovered from the resulting bacterial cell solution by an alkaline lysis method. The plasmid DNA is Sal
57 base pairs of D by digestion with l5Hind m
The target plasmid (pA3-
It was confirmed that L5) was obtained.

The procedure in this embodiment is shown in FIG.

Example 2 A plasmid (pKK t ac) expressing the CAT gene under the control of the tac promoter was constructed.

Plasmid pKK233- with tac promoter
3 (manufactured by Pharmacia, cat, no, 27-49:3
5-01) in 50 μm buffer (10 m
Ml-Lis-HCl 1) H7,5,50mM NaCl
, 1mM dithiothreitol) and Bam H
The DNA fragment was digested with I (5 units) at 37°C for 1 hour, and the resulting DNA fragment containing the tac promoter of about 350 base pairs was purified by electrophoresis. 10μ of purified DNA
m TE buffer (10mM Tris-HCl pH 8,0,1
m M E D T A ). this DNA
The solution will be referred to as DNA solution C hereinafter.

On the other hand, 2 μg of DNA of a vector for promoter strength test expressing plasmid pK K 2 B 2-8 was added to 5
0μm buffer (10mM) Lis-HCl pH 7,5,5
Digested with Bam Hl (5 units) in 0mM NaCl, 1mM dithiothreitol for 1 hour at 37°C. After the reaction solution was extracted with equal amounts of phenol/chloroform, twice the amount of ethanol was added to precipitate and recover the digested plasmid DNA. The recovered DNA was dissolved in 10 μm TE buffer. Thereafter, this DNA7@ solution will be referred to as a DNA solution.

5 containing 5 μl of DNA solution C and 5 μl of DNA solution
0 μl buffer (66mM) Lis-HCl pH 7,6
, 5mM MgCl2.5mM dithiothreitol,
T4 DNA ligase (50 units) was added to 0.6mM ATP) and reacted at 16°C for 12 hours.

The 10 μm reaction solution was used to transform E. coli (strain JM109) according to known methods and plated on LB plates containing 50 μg/ml chloramphenicol for 3
It was left standing at 7°C overnight. The resulting colonies were divided into 50μg/
ml of LB medium containing chloramphenicol was inoculated and cultured with shaking at 37°C overnight.

Plasmid DNA was recovered from the resulting bacterial cell solution by an alkaline lysis method. Bam of the plasmid DNA
It was confirmed that the target plasmid (pKKtac) was obtained from the digestion pattern obtained by digestion with HI and Eco RI.

The procedure in this embodiment is shown in FIG.

Example 3 The promoter strength of the plasmids constructed in Examples 1 to 3 was tested using the expression of the CAT gene as an indicator (W, V, S
baw, et al., J. Biol.

CI+em, 242.68719 [i7).

Plasmid p KKtac of E. coli (JMI09 strain)
, pA3-L5.

These transformed bacteria were hereinafter referred to as JM109/pA3L5,
JM 109/pKKtac.

Each of the transformed bacteria was inoculated into LB medium (hereinafter referred to as LB-Amp medium) containing 50 μg/ml ampicillin, and cultured with shaking at 37° C. overnight. 100μ
1 of the culture solution was inoculated into two test tubes containing 5 ml of LB-Anl p medium, and cultured with shaking at 37°C.

When the concentration of the culture solution reached 0D600-0.4, IPTG was added to one side to give a final concentration of 0.5 mM, and the shaking culture was continued for an additional 2 hours.

After culturing, 1 ml of the culture solution was centrifuged to collect bacteria.
00μm buffer (0,1M Tris-CI pH7
, 8), and then suspended again in 500 μl of buffer.

Ultrasonication of the suspension (SEIKO5ONIC&MATE)
RIALS 7500 ULTRASON I
C-PROCESSOR 20W for 10 seconds) to disrupt the cells.

The cell disruption solution was centrifuged, and the supernatant was used as a sample for CAT (chloramphenicol acetyltransferase).

On the other hand, 0.1Fvl Tris-C1 pH7,8,0
, 1mM acetyl-CoA.

A mixed solution containing 0.4 mg/ml dinitrobenzoic acid and 0.1 M chloramphenicol was prepared.

2.5 μl of the appropriately diluted sample was mixed with 0.5 ml of the above mixture, and after reacting at 37°C for 1 hour, 412n
The absorption of m was measured. The narcotic activity that acetylated 1 nmol of chloramphenicol per minute was defined as 1 unit.

In addition, the protein concentration of the sample was measured using a BCA protein concentration measurement kit manufactured by Pierce.

From the above results, the CAT activity contained in 1 mg of protein in the cell lysate was calculated and used as an index of promoter activity.

The results are shown in Table 1.

According to Table 1, JM 109/p A 3-L
5 showed the same level of CAT gene expression as JM109/pKKtac, and IPTG
Strong CAT activity was detected only when .

This result shows that the promoter of the present invention, in which the first DNA fragment consisting of the 135 region and -10 region of the A3 promoter and the second DNA fragment consisting of the minimal functional sequence of the lac operator, is as strong as the tac promoter. It has the ability to express, and like the tac promoter, I
This shows that the promoter can be controlled by the addition of PTG.

Example 4 Human prourokinase gene was expressed using pA3-L5.

1 μg of plasmid pUKO2pm4 (human mutant prourokinase) DNA was added to 50 μm of buffer (10 mM
) Lis-hydrochloric acid pH 8, 0, 50mM NaCl, 10m
M M g CI 2 ) and further Dra
III (10 units) and Aatn (10 units) were added and reacted at 37°C for 2 hours. After treating this reaction solution with phenol, ethanol precipitation was performed to obtain DNA.
Fragments were recovered.

The plasmid pUKO2pm4 has the deposit number rDS
It has been deposited with the West German DSM as "M4257".

On the other hand, for the synthetic gene ■, two types of single-stranded DNA oligomers consisting of 74 bases and 73 bases were synthesized by the phosphor atomization method, and 1 μg each was mixed with 10 μl of reaction solution (66 mM Tris-HCl pH 7, 6, 5 m M M
g CI 2 ), heat-treated at 65° C. for 5 minutes, and then allowed to stand at room temperature for annealing.

Synthetic gene ■ (double strand) 5- GTGGTCGACAAGC3-GAC
CACCAGCTGTTCGTTCCACTTTTCGC
CACGTTAAGGTGAAAGCGGTGCAAG
GCGGAAACAAAACCTGACCCGCCTT
GTTTGGACTGAACATGAACTATGAA
GAGTTGTACTTGATAACTTCTCGTGA
CTG 3- CAC5- (However, the symbols in the formula are the same as above) The synthetic gene ■ has Dram and Aat at both ends.
It is the same as the end digested by If, and Sal r is inside.
and Hind m recognition site and the SD sequence of the metapyrotecase gene (hereinafter referred to as 0230SD).

6. Combine with the DNA fragment previously prepared from pUKO2pm4.
Gene ■ was added to 20 μl of buffer (66 mM Tris-HCl p
H7,6,5mM MgCl2.5mM dithiothreitol, 0.1mM ATP) and further T4D
After adding NA ligase (10 units) and ligating by reacting at 15°C for 5 hours, 5 μm of this reaction solution was used to transform Escherichia coli (3M109 strain).

Plasmid DNA was recovered from the resulting bacterial cell solution by an alkaline lysis method. It was confirmed that the target plasmid (pUKΔtac) was obtained by investigating the digestion pattern of various restriction enzymes on the plasmid DNA.

The procedure in this embodiment is shown in FIG.

Example 5 200μm buffer (10mM) containing 50μg of the previously prepared plasmid pA3-L5-Lis-HCl p
H7,6, MgCl2.60mM NaCl) with Sal
I (100 units) and Hind III (10 units)
0 units) was added and the mixture was digested at 37°C for 2 hours. The 57 base pair DNA fragment generated by this reaction was
It was isolated by E.

On the other hand, 50 μm buffer (10 mM) containing 5 μg of plasmid pUKΔtacDNA in Lis-HCl pH 7,
6, M g C12, 60mM NaC1) to S81
(100 units) and Hind I [I (1
00 units) was added and the mixture was digested at 37°C for 2 hours.

After this reaction solution was treated with phenol, ethanol precipitation was performed to recover DNA fragments.

20 μm buffer containing 1 μg of 57 base pair DNA fragment (10 mM) Lis-HCl pH 7, 6, 7 mM M
1 μg of pUKΔtacDNA cut with Sal I and Hind m was added to gCl2.60mM NaCl), and T4DN
A ligase (10 units) was added and the mixture was reacted at 15°C for 15 hours for ligation. Using 5 μm of the obtained reaction solution, colon r:4 (strain JM109) was transformed by a known method.

Plasmid D was obtained from the obtained transformed bacteria by alkaline lysis method.
NA was isolated. After that, the obtained DNA was puk
02-A 5.

The procedure in this embodiment is shown in FIG.

Example 6 The productivity of human variable prourokinase by Escherichia coli was measured.

Plasmids p U K O2 p m 4 and p U K
02-A5 was used to transform Escherichia coli (KY1436 strain) by a known method, and the resulting transformed bacteria were transformed into M
9mE medium (M9salt, o, 1% yeast extract, 0.2% glycerol, 2μg
/ml thiamine) for 30 minutes with shaking.

During the logarithmic growth phase, I
PTG was added and cultured for an additional 4 hours. After completion of the culture, bacterial cells equivalent to 100 D units were collected by centrifugation, suspended in 1 ml of 100 mM Tris-HCl (pH 8.0), and crushed by ultrasound.

The crushed solution was mixed with 1 ml of 50 m M Tris-HCl (pH 8).
, 9) and suspended in a solution containing 4M guanidine hydrochloride, 6
It was solubilized by standing at 0°C for 60 minutes. To this solution, add 3 ml of solubilizing solution (50 mM Tris-HCl pH 8.0
, 0.2mM glutathione (reduced form), 5mM E
DTA) was added thereto and allowed to stand at room temperature for 16 hours to perform refolding.

In order to convert prourokinase in the solution into active urokinase, 95 μm activation solution (100 m M) +
) Hydrochloric acid pH 8, OS 0.01% Triton X-1
00.5 μg plasmin) was added and left at 37° C. for 30 minutes.

After adding 25 µg of soybean tribucinin inhibitor to stop the plasmin reaction, 700 µm of urokinase substrate solution (50 m M Tris-HCl pH 8,0
,0.2mM urokinase synthetic substrate (S-2444
, Dai-Kyakuyakuhin Co., Ltd., 0.01% Triton X-100)
was added and reacted at 37°C for 30 minutes.

After stopping the reaction by adding 1000 μm of acetic acid,
The absorbance at 0.05 nm was measured and compared with the decomposition activity of a synthetic substrate (S-2444) of standard urokinase (manufactured by Midorijuji Co., Ltd.).

The results are shown in Table 2.

As a result, a plasmid (p
It can be seen that the equivalent prourokinase is expressed in the plasmid (pUKO2-A5) having the promoter of the present invention, as compared to UK-02).

Table 1 CAT activity (units/mg protein) Table 2 4,

[Brief explanation of drawings]

1st. 2. Figure 3 is Example 1 of the present invention. 2. 4. Plasmi constructed in 5 Here are the steps to build the code. It is also.

Claims (4)

[Claims] (1) A first DNA fragment consisting of the -35 region and -10 region of a promoter that induces expression of the E. coli T_3 phage early gene group and a second DNA fragment consisting of an operator region capable of controlling the expression of the promoter. 1 D
A hybrid promoter operator formed by linking the 3' side of the -10 region of the NA fragment to the 5' side of the operator part of the second DNA fragment. (2) Claim (1) characterized in that the second DNA fragment is derived from an operator region that does not include either the -35 or -10 regions of the lac operon.
Hybrid Promoter Operator as described in Section. (3) The hybrid promoter operator according to claim (2), which essentially consists of a base sequence represented by the following formula. Formula [There is a gene sequence] (However, the symbols in the formula are the same as those used in normal genetics, and the underlined parts represent -35 region or -1, respectively.
0 area, and the wavy line indicates the operator area) (4) The hybrid promoter operator according to claim (2), which essentially consists of a base sequence represented by the following formula. Formula [There is a gene sequence] (However, the symbols in the formula are the same as those used in normal genetics, and the underlined parts represent -35 region or -1, respectively.
0 area, and the wavy line indicates the operator area)