JPH0322996A - Production of maturation protein using chimera leader peptide - Google Patents

Abstract

NEW MATERIAL:A chimera leader peptide having an amino terminal-side amino acid sequence liable to form an alpha-helix and a carboxyl terminal-side sequence of a leader sequence of a precursor protein on the carboxyl terminal side, wherein the precursor protein causes the processing in high efficiency in a host. USE:Secretion and production of maturation protein. PREPARATION:The objective peptide can be produced by preparing (A) an amino-terminal side amino acid sequence liable to form an alpha-helix and (B) a carboxyl terminal-side amino acid sequence providing a processing site by an enzyme existing originally in e.g. a yeast and linking the sequences A and B directly or through (C) an amino acid adaptor.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a method for efficiently secreting and producing a target protein, and particularly to an improved signal conjugate for efficiently secreting mature proteins.

[Conventional technology]

In the production of proteins by genetic engineering technology, as a method for efficiently secreting the target protein, the target protein is expressed as a fusion protein with prebropeptide (signal peptide + bropeptide) added to the N-terminus of the protein, and this is injected into the host. A method is known in which a certain protein is cleaved (processed) by a host enzyme within cells, and at the same time, a mature protein is secreted outside the cell. However, according to this method, two rounds of cleavage by host cell enzymes are required to excise the ripened protein from the fusion protein, which reduces the yield of the ripened protein and also reduces the yield of the matured protein. There is a problem that the body's fusion proteins become contaminated. As a means to solve these problems, a method can be considered in which the target protein is expressed as a fusion protein with only a signal peptide. Although this method allows a single cleavage to produce a mature protein, there are still problems in terms of processing efficiency and extracellular secretion efficiency. By the way, in the generally accepted "loop model," secreted proteins interact with the inside of the membrane with a basic amino acid located near the amino terminus of a signal peptide, followed by a sequence of hydrophobic residues that interact with the inside of the membrane. It is thought that the protein is inserted into the membrane through interaction with the lipid bilayer (Inouye, S., Wang + S.
．． + Sekigawa, J. , }Ialegou
a+S. & Inouye, M. Proc. Nat
l. Acad. Sci. USA. 14.1004-
1008. 1977). The common structural features of signal peptides are 1) the presence of a basic amino acid near the ξ-terminus, and 2) the presence of a cluster composed of hydrophobic ξ-noic acid residues in the center. , 3) The carboxyl terminus of the signal peptide that is cleaved by the signal peptide is an amino acid with a small side chain * in
As a result of investigating whether the leader sequence created by introducing mutations in vitro actually functions in cells or in an in vitro translation/transport system, we found that this cluster of hydrophobic amino acid residues There have been reports suggesting that conformation is important for the function of signal peptides. In particular, the importance of the α-helial chain structure formed in hydrophobic amino acid clusters is evident in E. coli L.
We investigated the interaction between the signal peptide of the aasB protein and a lipid monolayer, and by changing the strength of membrane pressure, we investigated the secondary structure of signal peptides that can and cannot penetrate the membrane using circular dichroism (CD) and Analysis by Fourier transform infrared spectroscopy revealed that signal peptides that can penetrate tend to form an α-helix structure, whereas signal peptides that cannot penetrate are more likely to form a β-helix structure. shown (Brigg
s, M.S. + Cornell, o, c,, Dlu
hy, R. A. & Gierasch, L.M.
Science 233, 206-208. 198
6). Based on these results, a model has been proposed in which the signal peptide first assumes a β-turn structure upon interaction with the membrane, and then transitions to an α-helical structure as it is inserted into the membrane.

[Intelligence B to be Solved by the Invention] The present invention is capable of efficiently converting a precursor fusion protein into a ripened protein by a single cleavage (processing), and at the same time efficiently secretes the ripened protein into extracellular secretion. The purpose of this study is to provide a novel leader sequence that can be easily carried out and a method for producing proteins using this. [Means for Solving the Problem] As a result of various studies based on the above-mentioned knowledge regarding protein processing and secretion, the present inventors have determined that an artificially designed amino acid sequence that is likely to form an α-helix has been When a chimera peptide having the carboxyl-terminal sequence of the leader sequence of the precursor protein on the carboxyl-terminal side, which is efficiently processed in the host cell used, is used as a leader sequence, efficient processing and cell processing can be achieved. It was discovered that exocrine secretion occurs together, and the present invention was completed.

Therefore, the present invention has an amino acid sequence that tends to form an α-helix on the amino terminal side, and a sequence on the carboxyl terminal side of the leader sequence of a precursor protein that is efficiently processed in the host. The present invention relates to a chimeric leader peptide and a method for secreting and producing a target mature protein using the chimeric leader peptide.

(Specific description) 1. Normal human serum albumin contains many disulfide bonds in its molecule, and it can be obtained by recombinant DNA method using normal human serum albumin, which has the same three-dimensional structure as natural products. In order to produce , it is essential that these disulfide bonds are properly formed in the production host cell. It has recently been revealed that enzymes such as protein disulfide isomerase and beptidylbrolyl cis-trans isomerase are involved in regulating the normal three-dimensional structure.
In prokaryotic cells such as Escherichia coli and Bacillus subtilis, which contain few proteins with S-bonds and complex 3D structures, enzyme systems related to 3D conformation (folding) do not have a strong effect even if they exist. is expected. On the other hand, cells of eukaryotic higher organisms including humans are known to secrete many proteins with complex higher-order structures (including I! protein and other modified proteins) to the outside of the cell. It is known that yeast, which is a lower eukaryotic microorganism, secretes proteins through a pathway very similar to that in cells of chewing milk (Huffaker, T.
C. and Robbins, P. W. J. Biol
．． Chem. 257+ 3203-3210 (198
2); Snyder, M. D. in Ginsb
Urg, V. & Robbins, P. W. (ed
s. ) Bjology of Carbohydra
tes, Vol. 2. Wiley, New York
k, (1984). pp. 163-198).
Therefore, as the host in the present invention, yeast or mammalian cells are preferable, and yeast is particularly preferable. Chime-1-゛-Pepti' α-
Examples of amino acid sequences that tend to form helices include amino acid sequences with a high proportion of leucines, for example, amino acid sequences containing a plurality of consecutive leucines. Furthermore, in addition to leucine, there are other amino acids that have a strong tendency to form α-helices, and there is also the possibility of forming α-helices in homovoripebutides, and electrically neutral amino acids such as alanine, methionine, and phenyl alanine,
Examples include tyrosine. The leader sequence of the precursor protein that provides the processing site in the chimeric leader peptide of the present invention and is efficiently processed in the host used is the signal peptide of secretory invertase SUC 2 when the host is yeast. , acid phosphatase PH05 signal peptide, MFα1 signal peptide, killer toxin signal peptide, etc. can be used, and the C-terminal processing site of these has, for example, the following amino acid sequence.

PHO 5 11FKSVV
YSILAASLANAMFαl.
MRFPSIFTAVLFAASSALA Killer toxin MTKPTQVLVRSVS ILFF ITLL
The HLVVA chimeric leader peptide of the present invention has two parts, namely, an amino terminal amino acid sequence that tends to form an α-helisox, and a carboxyl terminal amino acid sequence that provides a processing site by an enzyme naturally present in the host, e.g., yeast. Amino acid sequences are linked with or without an adapter (made up of one or more amino acids), and these structures or portions can be arbitrarily combined. An example of such a sequence is the amino terminal side containing multiple consecutive leucines and the secreted invertase S.
Sequence consisting of the carboxy terminal side including the processing site of the signal conjugate of UC 2: Met Lys L
eu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu
u Leu^TG AAG TTG TTG CTC
CTC CTT CTT TTG CTCTAC TT
C AAC AAC GAG GAG GAA GAA
AAC GAGPhe Leu Phe Ser
AlaTTC
TTG TTC TCT GCT AAG
ATT TCT GCC8AG AAC AA
G AGA CGA TTC TAA AG
A CGG can be mentioned. In this sequence, the upper row shows the amino acid sequence, and the lower two rows show an example of a DNA sequence encoding this amino acid sequence. The DNA encoding the chimeric leader peptide of the present invention includes:
It may be a sequence that is expressed in the host used, but a certain DNA sequence from codons that are frequently used in the host is preferred. For example, when the host is yeast, codons that are frequently used in yeast are already known, and a DNA sequence encoding a leader conjugate can be designed using these codons. Examples of proteins secreted extracellularly as mature proteins by the expression system of the present invention include various proteins produced by genetic engineering techniques.

For example, interferons, interleukins, granulocyte-macrophage colony-stimulating factor, prochymosin,
Endoglucanase I1α-ξlase, epithelial length factor, β-endorphin, calcitonin, somatomedin C
1 insulin, the thrombin inhibitor hirudin, and the like.

As the structural genes encoding these proteins, cDNA, chemical DNA, DNA, or genomic DNA can be used according to conventional methods. As an example, the gene encoding human serum albumin A (cDN^
) has already been cloned, and its nucleotide sequence and the amino acid sequence deduced from the nucleotide sequence are disclosed in the patent application filed in 1983.
- Described in detail in 037453. Therefore, in the present invention, a plasmid pu containing this cDNA is used.
c. IIsA-CFI etc. can be used as a source of the gene encoding human serum albumin A. The method for producing these plus ξ leads will be described later as a reference example. It is said that the BORI A sequence and the AATAAA signal, which are present downstream of the 3' end of the BOIA and AATAA^Sig coding sequences, contribute to the stability of eukaryotic RNA (Berg ann and Br
as4erman Biochemistry, 16
．． 259-264 (1977); Huez et al., Pr.
oc. Natl. Acad. Sci. USA.
78. 908-911 (1981)). Therefore,
Preferred jl of the present invention! In this case, these sequences are placed downstream of the cDNA encoding human serum albumin A. As the polyA sequence and the AATAAA signal, for example, these sequences naturally associated with human serum albumen A cDNA can be used. A human serum albumin A gene containing these sequences has already been cloned and is described in Japanese Patent Application No. 63-037453.

As a source of these sequences, for example, λgill (IS
A-IA) can be used, and its production method will be described later in Reference Examples. In the present invention, any promoter can be used as long as it functions in yeast cells. However, in the present invention it is preferred to use constitutive promoters rather than inducible promoters. When induction is performed using an inducible promoter, human serum albumin rapidly accumulates in cells, and intermolecular disulfide bonds are destroyed, resulting in molecules with non-natural three-dimensional structures. This is because there is a possibility.

Yeast promoters that are weakly inducible or constitutive and have strong activity include, for example, alcohol dehydrogenase (MDII 1 ) 7'' promoter, glyceraldehyde-3-phosphate dehydrogenase (
GAP) promoter, and phosphoglycerate kinase (PGK) promoter, and in the present invention,
This will be explained specifically using the ADH I promoter as an example. Approximately 2,10 containing the yeast ADli 1 gene (ADCI)
The base sequence of the 0 base pair region has already been determined, and AD
In addition to the approximately 1.100 base pair sequence encoding O1, 7
50 base pairs of 5' untranslated sequence and 320 base pairs of 3' untranslated sequence are known (Bennetzen, J.
and}la mouth. B. J. Biol. Chem. 2
57. 3018-3025 (1982)).

The Goldberg-Hogness box (TATA box), which is considered to be a recognition sequence by RNA polymerase during transcription, is located at 128 of the translation initiation codon ATG.
It is located upstream of the Sph I recognition site (position -128), and it is said that ADH I promoter activity is not lost even if the region upstream of the Sph I recognition site located at position -410 is deleted (B
aker. fire. and Young, T. , Natur
e 300. 724-728 (1982) ). A
D}l I promoter-driven transcripts account for at least 1% of the total poly(A) RNA in normal yeast [^ll
I1erer+G. Methods
o1. 101+ 192-201 (1983))
．． 1, 2, read-through in two-color, two-transfer
) has been reported to reduce the amount of gene products [for example, Zaret+K. S. and Sherme
n. F. , Ceil, 563-573, (1
9B2) ). In order to prevent this phenomenon, it is preferable to provide a terminator downstream of the structural gene to be expressed. An example of placing a yeast starter downstream of a foreign gene to increase gene expression is, for example, PG
There has been an experiment in which calf chymosin was expressed using a sandwich vector consisting of a K promoter/terminator, and it has been reported that introduction of a terminator increases expression several to ten times (Mellor et al. Gene 241
-14 (1983). ,1. ．． Terminators derived from various genes can be used as terminators for this purpose; for example, terminators such as the ↑RP5 (tributophane synthase) gene and the CYCI (iso-1-cytochrome C) gene are used. ．． In the case of transcription involving a strong promoter, it is considered more convenient to control expression if a strong terminator is placed downstream of the promoter to prevent read-through. Therefore, in the present invention, it is preferable to use, for example, a gene terminator having a strong promoter, such as the DHI terminator or the GAP terminator.

Although the elements directly related to expression contained in the expression plasmid of the present invention have been described above, the expression plus fruit of the present invention further contains a yeast replication origin and a marker gene. There must be. As the yeast replication origin, for example, a yeast-derived 2n brass ξ DNA replication origin can be used. As the marker gene, a commonly used marker gene can be used, such as a gene that confers drug resistance to the host or a gene that complements the nutritional requirements of the host. Furthermore, since it is necessary to reproduce the plus ξ-d in Bacillus major during the recombinant operation of the plus-a-d, the plasmid of the present invention is a shuttle vector containing an E. coli origin of replication and a marker gene. preferable.

A commercially available plus-adjusted pJDB207 or the like can be used as a vector that has the basic requirements as a shuttle vector. The yeast marker gene in this plasmid pJDB207 is LEU2, which encodes β-isobrobyl malate dehydrogenase, a leucine biosynthesis enzyme.
It's a gene. Matasato Kori Gokami Therefore, in the preferred expression plasmid of the present invention, a promoter and a leader sequence encoding a pre-sequence are linked to a shuttle vector comprising a yeast replication origin and I marker gene, and an E. coli replication origin and marker gene. The gene encoding human serum albumin A, the BoliA sequence, and a terminator are inserted in this order. 2. Transformation of a host yeast by the plasmid of the present invention can be carried out according to a conventional method, and a specific example thereof is described in Example 4.

3. stretch
A host yeast strain transformed with an expression plasmid containing the structural gene of the target protein can be cultured using normal yeast culture methods. For example, it can be cultured in a natural complete medium such as YPD or an incomplete medium such as SD medium with 1% yeast extract added.

The target protein secreted extracellularly after culture can be recovered by various methods. After performing concentration and partial purification by fractional precipitation with ethanol, acetone, ammonium sulfate, etc., isoelectric precipitation, ultrafiltration, etc., the target protein can be highly purified by combining various chromatography and the above partial purification methods. You can expect it. [Effects of the Invention] According to the present invention, high cleavage efficiency is expected by utilizing the processing site of the leader sequence derived from the host cell protein. Furthermore, the cleavage of the leader sequence in the present invention occurs in one step, thus allowing accurate removal of the leader sequence (signal peptide). On the other hand, by arranging an amino acid that tends to form an α-helix in the amino terminal region of the signal peptide, the signal peptide can be made to adopt a structure that facilitates membrane penetration.

Due to the above reasons, efficient membrane passage of the fusion protein and accurate removal of the leader sequence are possible, and as a result, highly efficient intracellular transport and extracellular secretion of the matured protein can be carried out. .

Next, this invention will be explained in more detail with reference to Examples. In the following examples, unless otherwise specified, enzyme reactions were carried out under the following conditions.

EcoRI (--ppongene: 12 units/m
), Claal (New England Biolapse; 5 units/Id), llind lll (Nippon Gene; 12 units/d), Xhol (Takara Shuzo; 12
Digestion of DNA by unit/I11) and BamH1 (2, 35 units/d): DNA
1 μg 1 enzyme, and IOX t'coR I buffer (IM Tris-HCI (pl 7.5
), 100mM MgClg, 500mM NaC
l) Add sterile distilled water to 3 pl to make 30d.

Insulate at 37°C for 1 hour to complete cutting. Sail
(Nippon Gene.15 units/lJ1) is I
100mM instead of OX EcoR I ill buffer
Tris-HCI (pH 7.5). 7
0mM Mgct. , 1.75M NaCl, 7
0mM ethanol/L/, 2mM E
DTA, 0. Using 1% bovine serum albumin,
Also, in the case of Msp l (tlpa II) (Nippon Gene; l2 unit/Il!), roomM
Tris-HCI (pH 7.5), 100n+MC
lg. using 60mM NaCI and Ssal
(Ningbong Gene; l5 units/Ha) is 20
0mM MCI, 60mM Tris-HCI
(pH 7.9), using 60mM MgClz.

Bacterial alkaline phosphatase treatment: DNA1f
f, restriction enzyme E! coR I and old ndII [1t each
Add sterile distilled water to 2 pl of I1 and IOX EcoR 1 buffer to make 20 JII, incubate at 37°C for 1 hour, and then heat at 90°C for 15 minutes to inactivate the enzyme. Next, sterile distilled water 38J11 and bacterial alkaline phosphatase 2J1L (Takara Shuzo 0.5 units/JIl) were added and kept at 37°C for 1 hour, followed by phenol extraction and the resulting aqueous layer was used for ethanol precipitation.

T4 DNA ligase treatment: e.g. vector DNA
1n, vector DNA and equimolar amount of DNA fragment, IOX ligase buffer (660aM Tris-HC
I (pH 7.5), 6 6RIM Mgch,
100mM dithiothreitol, 1mM ATP
) 3 j1! Then, add sterile distilled water to T4 DNA ligase 1t11 (Takara Shuzo, approximately 400 units/p1) to make 30I11 and incubate at 16°C overnight.

5'-phosphorylation of the Gakai fragment by T4 polynucleotide kinase: 50mM Tris-HCI (
pH7. 6), 10+M MgCh, 5+
*Amount of each DNA fragment (approximately 30 pmoles) was added to 6 units of T4 in a solution (25 lJ1) containing M dithiothreitol, 0.2 s + M ATP.
Polynucleotide Kinase (Takara Shuzo) at 37°C, 60
The 5' end is phosphorylated by treatment for 1 minute. Mix the solution containing the phosphorylated fragment (total 100 m)
Anneal by leaving in a 100°C water bath for 5 minutes and then cooling at room temperature. Add 2I11 T4 DNA ligase and incubate overnight at 16°C to ligate the fragments to form double-stranded fragments. E. coli DNA polymerase I reaction: 1ug of DNA, DN
A polymerase I (κlenow fragment, Takara Shuzo 3.5 units/d”) 1 pl, 1 mM dXTP
(mixture of dATP, dGTP, dCTP, TTP) and IOX buffer (70a+M Trfs-
HCI (pH 7.5), 1 mM EDTA,
200mM NaCl. 7 0mM MgCh]3
Add sterile distilled water to the ul to make a total volume of 30d, and heat at 37°C.
Keep warm for 30 minutes. Probe labeling: 1n synthetic DNA, 50pci r-”P-ATP aqueous solution (3000Ci/smog), (50mM
Tris-HCI (pH 7.5), 10mM
10I containing MgClz, 5o+M DTT, l O unit T4 polynucleotide kinase (Takara Shuzo)
After reacting the Ll solution at 37°C for 1 hour, unreacted nucleotides were removed using Njck-colua+n (Pharmacia) according to the manufacturer's protocol, and ff!
Obtain P-labeled DNA (I x 10”cpm
/ 1 carcassoNA/4oOm). Hybridization: The DNA-fixed membrane is mixed with hybridization solution (6
XSSC (I XSSC is 0.15M NaCI,
O. Ol5M sodium citrate, pl+'7.0),
5X Denhart & (0.1% bovine serum albumin, 0
．． 1% Ficoll, 0.1% polyvinylpyrrolidone)
, O, 5% SDS, 100n denatured salmon sperm DNA) 1
Incubate at 42°C for 3 hours in 0mg. Discard the liquid, add probe IXIO'cp+i/d, hybridization'l (110 ml, and heat at 80°C for 3
Keep warm for minutes. Next, keep warm at 42°C overnight. Discard the solution, wash the membrane with 2xssc for 5 minutes at room temperature, and then wash the membrane with 2xssc for 5 minutes at room temperature.
Wash by sc at 60'C for 30 minutes. In addition, when creating a plasmid by enzymatic reaction,
E. coli 118IQ1 is transformed using the enzyme reaction mixture according to a conventional method, transformants are selected according to an appropriate conventional method depending on the E. coli marker gene, and clones containing the desired plasmid are selected by, for example, ξnibrevalization. A method in which DNA extracted from a transformant is cut with various restriction enzymes and analyzed by electrophoresis (for example, M
aniaLis, T., Frirsch, E. F., &
Sambrook, J. Molecular cloni
ng A Laboratory Manual
Cold Spring Harbor Laborat
ory 1982). Then, the selected clones were cultured, and plasmid D was extracted from the bacterial cells according to a conventional method.
The desired recombinant plasmid was amplified and recovered by extracting NA. This method was performed as necessary for each step of the recombinant operation.

To facilitate insertion of the DNA encoding the assembled chimeric signal peptide into the vector, the 5' end was
The R I sticky end sequence was used. In addition, the 3'-terminal side contains a codon for alanine, which is an amino acid at the carboxyl terminal of the invertase signal peptide portion, followed by an adapter nucleotide, in order to directly link to the DNA encoding the partner protein to be expressed as a fusion protein. The sequence was designated as the Nae 1 recognition sequence. Furthermore, this Nae
Since the 1 recognition sequence GCCGGC also contains the 11 pan recognition sequence CCGG, it is also possible to link it to the prejudicial protein gene having the Hpa II sticky end sequence. In order to construct a DNA encoding this chimeric signal peptide, the following four oligodeoxyribonucleotides were synthesized.

1.5'2.5'3.5'4.5' -AATTCATGAAGTTGTTGCTCCTCC
TTCTTTTGCTCTT-AG^^CAAGAAG
AGC88AAGAAGGAGGAGC88CAACT
TCATG-CTTGTTCTCTGCTAAGATT
TCTGCCGGC-GCCGGCAGAAATCTT
After the 5' ends of AGCAG Hewei fragments 2 and 3 were phosphorylated by the action of T4 polynucleotide kinase, Hewei fragments 1 and 4 were mixed and annealed. Then, by treating with T4 DNA ligase, a DNA encoding the full length chimeric signal peptide was produced. The produced double-stranded DNA has the following sequence.

Met Lys Leu Leu Leu Le
u Leu Leu Leu5' AATTC
ATG AAG TTG TTG CTC CTC C
TT CTT TTGG TAC TTC AA
C AAC GAG GAG GAA GA
AACI! coRI Leu Phe Leu Phe Ser Ala L
ys lie Ser AlaCTC TTC T
TG TTC TCT GCT AAG A
TT TCT GCC GGCGAG AAG
AAC AAG AGA CGA TTC TAA A
GA CGG CCGNae I Hpa ■ The double-stranded DNA encoding the chimeric signal bebutide is 5
The ' end is an ECOR I sticky end and the 3' end is a blunt end, and in order to amplify this, pUc19 is
The larger fragment obtained by double digestion with R r and Sea I was ligated to create plasmid pLlc-LY3. Plasmid pUc-HSA-Cll (patent application 1986)
-037453), a C is placed in front of GAT, which encodes Asp, which is the amino terminal amino acid of mature human serum albumin A, and this CGAT sequence prevents the Cla I sticky end sequence. , the human serum albumin A cDNA contains the old ndl[[ site in the 3' untranslated region, so double digestion with Cla I and old ndlII can encode complete mature human serum albumin A. cDNA
It is possible to extract ptlc-LY3 from Eco
A 63 bp double-stranded fragment obtained by double digestion with Rl and HpaII was used to create a recombinant plasmid plJc-ISA-CH which encodes mature human serum albumin A and further contains a cDNA sequence spanning its 3' untranslated region. EcoR
The larger fragment obtained by double digestion with I and Cla I was ligated by the action of T4 DNA ligase to create a recombinant plasmid pUc-LY3-USA. The plasmid ptlc-LY3-HSA was converted to EcoR.
The 5' phosphate group was removed by digestion with alkaline phosphatase. To this, EcoR on both ends
A Eco-Xho-Eco linker with a sticky end and an internal Xho I site was ligated using T4 DNA ligase to create a plasmid p
This plasmid ptlC-X-LY3-HSA was used to generate Uc-X-LY3-HSA, which is a former ndII! After cleavage and dephosphorylation by alkaline phosphatase treatment,
This linearized plasmid was transformed into a recombinant plasmid pUC-ISA.
-M (Reference Example 4) was ligated to the old ndlll fragment (approximately 200 bp) containing the 3'-untranslated region (BoIJ A addition signal and Boli A sequence) of the human serum albumin A cDNA sequence to create a recombinant plasmid pU.
cLY3-HSA-^ was obtained. This plus ξ de is Xho
2. obtained by double digestion with I and BamHI. The Okb fragment was digested with yeast alcohol dehydrogenase (
Yeast expression vector pA containing the promoter and terminator of AD}l I') gene (ADCl)
H6-10-Neo-ATE! (Reference example 7)
I-BasH l fragment (8.1 kb), artificial signal peptide and mature human serum albumin A
An expression recombinant plasmid pJDB-ADH-LY3-HSA-A was created to produce a fusion protein with. Escherichia coli containing this brass ξ
ia parallel HBIOI/pJDB-ADH-LY3-HS
^-A was internationally deposited with the Institute of Microbiology, Agency of Industrial Science and Technology as FERM BP-2455 on June 8, 1989 under the Budapest Treaty.

Expression plasmid pJDB-ADH-LY3-HS^-A
The transformation of yeast fungus AH22 by
5)) (7) This was carried out using a slightly improved method according to the KUR method. First, YPD medium (2% polypebutone (Dlfco), 1% yeast extract (Dirco)
, 2% glucose) 5d to AI+22 strain (MATa,
1eu2-3. leu2-112. his4-51
9. Canl's YPD medium overnight culture 0.
1- and at 30℃ for about 4 hours (turbidity is 00 to 600
．． 5) was cultured with shaking. 2 at 4°C.
Centrifugation was performed at 00 rpm for 5 minutes to collect the bacteria.
0-0. I MLiSCN, of which 1
．． 5 d was collected and centrifuged at 2.00 Orpm for 5 minutes or 10.00 Orpm for 1 minute to collect bacteria. The obtained bacterial cells were 2 MLiSCN 1 0 j1! ,50%P
Resuspend in EG400Q46m and add 10Il1 D to it.
A NA solution (containing 5-10x DNA) was added, and the mixture was incubated at 30°C overnight. Sterilized distilled water (11d) was added to the suspension and gently shaken using a vortex mixer. Next 2
．． 000 rpm+m for 5 minutes or 10. 00Orpm
Centrifugation was performed for 1 minute, and the resulting bacterial cells were resuspended in 100 Il1 of sterile distilled water and placed on a selective agar medium (SD medium:
20n/d adenine sulfate, 20u/d arginine hydrochloride, 20g/d methionine, 20g/-histidine hydrochloride, 20n/IIi tryptophan, 20n/Idl uracil, 30n/-isoleucine, 30u/d lysine hydrochloride, 30 Yeast Nitrogen Base (Difco), 15% Amino Acid Insufficient Yeast Nitrogen Base (Difco) 5
% ammonium sulfate, 2% dextrose and 1.5% agar]. The resulting colony (Leu
) was suspended in SD medium 5- and cultured with shaking at 30"C for 2 days. Bacteria were collected by centrifugation at 2.000 rpm for 5 minutes at 4°C, and the cells were resuspended in 0.5 mL LM sorbitol. After centrifugation, the cells were suspended in 0.5 d IM sorbitol,
0.1% 2-mercaptoethanol, 400x/! d was resuspended in Zymolyase (Zymolyase-i00T Seikagaku Kogyo).

After incubating at 30°C for 30 minutes, the recovered spheroblasts were collected by centrifugation (2,000 rpm, 5 minutes) and incubated for 10 minutes.
0d solution 1 (501M glucose, 10mM ED
TA, 25-↑ris・ICI (pH 8.0
)) and then a solution of 2004 1N (0.2
After adding NNaOH, 1% SDS) and mixing well,
It was left on ice for 5 minutes. Add 150g of 5M potassium acetate, mix well and leave on ice for 10 minutes.
Centrifugation was performed at 4°C for 5 minutes at 00 rpm, and the obtained supernatant was transferred to a new tube. Add an equal amount of phenol/chloroform (1:1 mixture), stir vigorously, centrifuge (12.00 rpm, 5 minutes), transfer the resulting aqueous layer to a new tube, and mix well with 750 liters of ethanol using a vortex mixer. Mixed. Mixed liquid 15.00
ORPM, centrifugation for 5 minutes, and add 0.0% to the resulting precipitate. 5
After adding 70% ethanol (d) and shaking using a vortex mixer, the precipitate was collected by centrifugation at 15,000 rpm for 5 minutes. This DNA precipitate was dried under reduced pressure in vacuo, and then added to a 30 d TEil solution [1°OmM
Tris-1 {CI (pH 8.0). 1mM ED
TA). Blasmid pJDB-ADH-L
A DNA preparation obtained from a transformed strain of AH22 containing Y3-11sA-A was injected with various enzymes (for example, old r + dIIr).
．． Xho I. EcoRI, Basi
81, Sa, etc.) alone or in combination, and the resulting fragments were analyzed by agarose gel electrophoresis and polyacrylamide gel electrophoresis to determine the structure of brass ξ. 5. A single colony generated on SD (-Leu) medium.
0.01 fresh S[l(-Let+) medium,
Culture with shaking at 0''C for 2 days, and when OD,. reached approximately 2.0, 0.1 id of the culture solution was added to 5.0 d of YP.
Added to D medium. This was heated at 30°C for 24 hours. . .

The cells were cultured until the temperature reached approximately 3.0 O. 5+000 culture fluid
The mixture was centrifuged at 4°C for 10 minutes at rpm, and both supernatants were collected. An equal volume of 99% ethanol was added to the supernatant fraction, mixed, and then left at 4°C for 30 minutes. Next 12. OOOr
The mixture was centrifuged at 4°C for 10 minutes to obtain a precipitate.

This precipitate was added to 100 l of 1x loading (Loadi).
ng) 11 buffer solution (5% 2-mercabutoethanol, 0
．． 0025% Promophenol Blue, 2% SOS.
0.025M Tris-HCI, 8% glycerol)
The IOJ was dissolved in the electrophoresis gel (SDS-polyacrylamide gel: 4-20% concentration gradient gel 84 (
Width) x 90 (height) x 1.0 (thickness) (units are mm)
It was layered and analyzed.

The electrophoresis was carried out using a running buffer (0.025M Tris-11c).
I (pH 8.4), 0.192M glycine, 0
．． Electrophoresis was carried out for 60 minutes at a constant current of 60 mA using 1% SOS).The marker that was run at the same time was egg white lysozyme (1% SOS).
molecular weight 14,400), tribusin inhibitor (molecular weight 21,500), carbonic anhydrase (molecular weight 131,00
0), ovalbumin (molecular weight 45,000), calf serum albumin (molecular weight 66,200), phosphorylase B (molecular weight 92,500) (all B[0-RA
(manufactured by Company D). After the electrophoresis is completed, add Coomassie water according to the usual method.
Immunodetection was performed after staining with brilliant blue or Western blotting as described below.
After electrophoresis, the separated proteins were transferred to a nitrocellulose filter (BIO-RAD) using a Sartorius Setoxin dry blotter. filter, 1
After soaking in methanol for 5 min, 2 5 mM Tr
is-1ICi (pH 10.4)/20% methanol and brought into close contact with the electrophoresis gel. Add this to the above buffer solution,
and 20% methanol. 3M Tris-
HCI (p}110.0) and 25mM↑ris-MCI
(pH 9.4) / 4 A constant voltage of 6V was applied to the blotter using filter paper soaked in a buffer solution such as 6-amino-n-cabroic acid (pH 9.4). After 5 hours, the filter was washed with 20*MT containing 3% gelatin.
rts-HCI (p}17.5)/500 mM
After shaking in NaCl (TBS) solution at 37°C for 1 hour, the filter was washed by shaking in TBS/0.05% Tween-20 for 5 minutes. Next, the filter was shaken overnight at room temperature in a solution prepared by diluting an anti-human serum albumin rabbit antibody (Kappel Co., Ltd.) 2.000 times with TBS containing 1% gelatin. filter to 0.0
T B S (987
．． 5 (T-TBS)) for 5 minutes with shaking. After repeating this operation once more, filter the second antibody (goat anti-rabbit IgG antibody labeled with horseradish peroxidase, manufactured by BIO-RAD) in solution 40II11 diluted 3,000 times with TBS containing 1% gelatin. was shaken at room temperature for 1 hour. It was then washed twice with T-TBS for 5 minutes and twice with TBS for 5 minutes as described above. Detection of the band (ISA) was performed by immersing it in a solution of 30 flg of 4-chloronaphthol dissolved in 10 d of methanol and 30 Ii of TBS 50-30% hydrogen peroxide, and the color reaction was performed by diluting with distilled water. It was stopped by doing this.

(1) A human serum albumin A sample isolated from a molecular weight yeast culture was reduced with 2,1-mercaptoethanol and subjected to SDS treatment, followed by a 10%-20% polyacrylamide concentration gradient in SDS. Added to gel, Laewmli,
U,K. [Nature. 227. 680-6
85 (1970)]. Phosphorylase b (molecular weight 94,
000), bovine serum albumin (molecule 167,000)
, ovalbucin (molecular weight 43,000), carbonic anhydrase (molecular weight 30,000), soybean tribusin inhibitor 1 child 120,000), lactalbucin (molecular weight 114,100), and Coomassie Brilliant Blue. Proteins were detected by staining. A commercially available serum albumin purified from human serum was simultaneously run as a control, and its mobility was compared with that of serum albumin A secreted by yeast. As a result, yeast-produced human serum albumin A and human serum albumin showed the same mobility;
The molecular weight was 67.000. The results are shown in FIG.

(2) Electrical properties <NaLtve gel electrophoresis> A human serum albumin A sample isolated from a yeast culture solution was
62.5mM Tris-HC1. (pH 6.8)
, 15% glycerol, 0.001% promophenol blue solution, 4-15% polyacrylic ξ
Davis, R. using a gradient gel (pH 8.4).
．． J. [Ann. N. Y. ^cad. Sc1. , 1
21, 404 (1964)], and its behavior was compared with that of human serum Alpjuji purified from commercially available serum. In this electrophoresis, yeast-produced human serum albumen A and human serum albumen purified from commercially available serum showed the same behavior. The results are shown in FIG.

Isoelectric focusing> Isoelectric focusing is performed using LKB's Ampholine PA
Gplate pH range 3. 5-9. 5 according to the company's manual. As an isoelectric point standard, the company's PI marker; C-phycocyanin (pl4.7
5, 4.85), azurin (p15.65), porcine trifluoroacetyl globin (p15.9),
Pig ξ oglobin (p16.45), horse ξ oglobin (p+7.3), whale ξ oglobin (p18.3)
, and cytochrome c (pr10.6) were used.

Yeast-produced human serum albumin A showed a similar pattern to human serum albumin purified from commercially available serum, with p
! It was separated into several bands from 4.8 to p15.2. The results are shown in Figure 5. (3) Amino-terminal amino acid sequencing Using yeast-produced human serum albumin A20x, the ε-terminal amino acid sequence was determined using Applied Biosystems' gas-phase protein sequencer 477A according to the company's manual. went. As a result, from the ξ-terminal amino acid, ASP-Ala-}1is-Lys-S
The sequence er-Glu-νal-^1a-His-Arg was identified and completely matched the previously reported amino-terminal sequence of human serum albumin. When calculated based on the recovery rate of the amino-terminal amino acid, it is thought that the amino-terminal amino acid in the standard used is more than 95% complete. In addition, no residual presequences due to incomplete processing were observed. (4) Reversed phase column chromatography based on HPLC behavior> The high performance liquid chromatography device used was a Shimadzu LC-6A Gradient-LC system, and TSK-g
Separation was performed using an el Phenyl-5PW RP power ram. Yeast-produced human serum albumin A, human serum albumin A purified from commercially available serum, and a mixture thereof were added to a column equilibrated with 0.1% trifluoroacetic acid aqueous solution, and 0.1% trifluoroacetic acid was added. Elution was performed by forming a linear gradient of acetonitrile concentration O-70% over 60 minutes. The flow rate at this time is lld/sh
It was in. Under these conditions, yeast-produced human serum albumin A eluted as a sharp single peak and was indistinguishable from human serum albumin purified from commercially available serum in terms of retention time on the column and peak shape. Furthermore, these mixtures also eluted as a single sharp peak, proving that these two human serum albumins behave exactly the same on a reversed-phase column. The results are shown in Figure 6. (5) Immunological properties Immune diffusion is described by OuchLerlony, O. [Pro
gr. ^llergy. 6. 30 (1962) l. After sedimentation lines, the proteins were deproteinized with physiological saline, and then the sedimentation lines were stained with Coomassie brilliant blue. The antiserum used was Cappe
Rabbit anti-human serum albumin antiserum purchased from Company I. Yeast-produced human serum Alpine A formed a sedimentation line that was completely fused with human serum albumin purified from human serum, and no difference in antigenicity between the two was observed using this method. The results are shown in Figure 7. US CL for screening by Braak hybridization for clones containing normal human serum albumin A cDNA.
A human liver cDNA library created using ONTECH's λgtll as a vector was used. Agtll
The recombinant phage was infected with Escherichia coli Y1090 as a host, and a total of 5.5 x 105 transformed Brake cells were formed on an LB agar medium, and the recombinant DNA was transferred to a membrane filter (Hybo-nd-N, As+ershas). After that. Three types of oligonucleotides labeled with P radioisotope (specific activity ≧10'cpm/av) were used as probes for screening (Benton and Da
vis Science 196+ 180-182 (
1977)). These three types of probes each have a Latmn
[Nucletc Acids Res 9. 61
03-6114 (1981)] of the sequence of human serum albumen cDNA, the 5' untranslated region (the region from 12 nucleotides upstream of the translation initiation ATG codon to the nucleotide before the ATG codon) and the translated region. (HS^-1), which contains the methionine codon at the amino terminal, that is, the part that codes for the amino acid leucine at position 9 from ATG (HS^-1), from glycine at position 248 to 260
The one encoding the th leucine (HSA-2)
, and the carboxyl terminal 58 from valine 576
Includes a 3'-untranslated region starting from the portion encoding the fifth leucine and the following 6 nucleotides (ISA
-3) is the same array. The base sequences of these probes are shown in Figure 6. The synthesis of this probe is automatic DNA
It was performed using a synthesizer, and the label was [T-! ″P)AT
I tried using P and polynucleotide kinase, U
200 λgtl that gave a positive signal in SA-2
DNA was prepared from 4 of the 1 clones (B
Lattner et al. Science 202+1279-
1284 (197B)) L, which was digested with EcoR I and the Southern plot of the digest hybridized with the ISA-2 probe (Southern, J.
Mol. l'llol+503-51.7 (1975)
)． Hybridized fragments were obtained from three clones, 1. 8 kb, 1. 4kb
, 1. It was 3kb long. Of this 1.8kb
and a 1.3 kb long fragment was subcloned into the pUc19 vector. Transfer this subclone to ISA
Colony hybridization (Grunstein and [1
ogness Proc. ．． Natl. Acad. Sc
i. USA 72+ 3961-3965 (1975
) ) was screened. This result}1sA −3
The clone λgtll (IIS
A1-A) was obtained. Various DNA fragments of this clone were inserted into base sequencing vectors M13mplB and Ill.
)19RF-DNA and the dideoxynucleotide termination method (Sanger, Fx Nic
klen, S., and Coulsor+. A. R.
Proc. Natl. Acad. Sci. IJsA
14+5463-5467 (1977)). On the other hand, two of the clones that gave positive signals in Braak hybridization of λgall clones using 13A-2 as a probe.
Braak hybridization was performed again on 0 cells using IIsA-1 as a probe, and a clone λgtll (HS^-■) giving 1 positive signal was obtained.

Phage DNA was prepared from this and Southern hybridization was performed on the EcoR1 digest using HSA-1 as a probe, and it was confirmed that a 1.25 kb fragment (IISA-[1) hybridized with the probe. The base sequence of this fragment was determined using the guideeoxynucleotide termination method.
ISA-II did not hybridize with the ISA-3 probe. As a result, ISA-n lacks the part encoding the carboxyl-terminal side, }ISAI-A lacks the part encoding the amino-terminal side of human serum albumin, and 30
It was found that the codon encoding the fourth serine (TCA) was changed to the opal codon TGA, which is a translation stop codon. The restriction enzyme map of these two DNA fragments is shown in Figure 8. The exact location of the enzyme 111 site was obtained from the final Salt Go sequence. As can be seen from Figure 8, USA I-^ and IIsAII
Place the two DNAs at appropriate positions (for example, Xba I or Ps
By cleaving them at the tl site) and recombining them with each other, it is possible to construct a cDNA that can encode the full length of the precursor protein of human serum albumin, which has a signal conjugate and a pro-conjugate sequence. San〇Koshi Theft Booth's House” IJc-Is^-CH
10 Brass ξ-do pUc containing DNA encoding a protein in which the signal conjugate of E. coli alkaline phosphatase (phoA) and normal human serum albumin A are fused.
-phoA-113A-A was produced as follows. EcoR from clone λgtll (HS^-■) containing HSA cDNA obtained from a human liver cDNA library.
The fragment resulting from the EcoR I and Xba 1 digestion was prepared and was added to the EcoR I and
The larger fragment of the double digest with ba I was ligated with T4 DNA ligase to construct recombinant plus fruit ptlc-11s^1Ex. The smaller fragment resulting from the double digestion of Aham and Sat 1 was purified from this plasmid.

This fragment encodes the 12th Lys to the 356th Thr of mature normal human serum albumen A protein. In order to construct a gene encoding mature normal human serum albumen A protein starting from the terminal end, the DNA sequence corresponding to the 5' end was prepared by annealing two chemically synthesized fragments. This combined DNA sequence was designed to be able to fuse with the DNA sequence encoding the signal conjugate of alkaline phosphatase.
It has a sticky end sequence CG generated by II and Cla I enzyme cleavage at the 5' end, and has a sequence encoding the 1st amino acid Asp to the 11th amino acid Phe of the mature normal human serum albumin A protein award. are doing.

This annealed DNA sequence is treated with T4 polynucleotide kinase to phosphorylate the 5'end;
Aham/SalI generated from pUc-}ISA-EX
The double digest 9 is mixed with pA, which is a typical E. coli multicopy cloning vector.
T 153 (manufactured by A+wersha@, Twigg,
A. J. and Sherratt, D. Nature
283 216-218. 1980) Cla l/
mixed with the larger fragment of the Sail double digest, and the three were ligated together using T4 DNA ligase.
A recombinant plasmid pAT-}ISA-CX was obtained. D on this positive ξ code encodes the amino acids Asp at position 1 to Phe at position 11 of normal human serum albumin A.
NA sequences are connected. pAT-HSA-CX co
Double digestion with R I/Xba I yielded a smaller fragment containing the DNA sequence encoding Asp 1 to Phe356 of normal human serum albumin A. On the other hand} cDNA encoding the carboxyl terminal side of ISA-A
A is obtained by preparing an EcoR I fragment into which a foreign cDNA sequence has been inserted from clone λgL1.1 (1!SA I-A) obtained from a human liver cDNA library, and inserting it into the EcoR I site of the pucta plasmid. It was cloned into Brass pUc-Is^-1.

From now on, ISA-. A double digest of Xba I/Hind m was prepared, which encodes Leu from amino acid position 358 of A to Leu at position 585 at the carboxyl terminus, and further contains 62 nucleotides of the untranslated region on the 3' side. EcoR obtained from pAT-HSA-CX
I/Xba I double digest and f! of pUc1B. c.
The oRI/Htnd m double digest was mixed with the larger fragment and ligated with T4 DNA ligase to create an m-recombined plasmid p[Ic-11sA-CI1 containing the entire cDNA of mature normal human serum albumin A.
I got it. The base sequence of cDNA encoding the entire amino acid sequence of mature normal human serum albumin A and the corresponding amino acid sequence are shown in Figures 11-1 to 11-3.

4I11 oligonucleotide having the following sequence; 1.
AATTCATGAAGTGGGTTACTTTCA
TCTCTTTGTTGTT2. AGAACAAG
AACAACAAAAGAGATGAAAGTAACCC
ACTTCATG3. CTTGTTCTCTTCT
GCTTACTCTAGAGGTGTTTTCAGAC
G4,CGCGTCTGAAAACACCTCTAGA
GTAAGCAGAAG, Matteucci. M
．． D. and Caruthers, M. l+. ,Tet
rahedron Letters 2L 719 (
An automated DNA synthesis machine (Applied Biosys
TEMS model 380B) was used. The oligonucleotide fragments were 5'-phosphorylated with T4 polynucleotide kinase, annealed, and then T4
They were ligated using DNA ligase to obtain a single double-stranded DNA encoding the prebro sequence. Plasmid pUc-1ISA-CI (Reference Example 2) containing cDNA of normal human serum albumen A was digested with restriction enzyme Ec.
Double digestion with oRl and hcIal yielded the larger fragment, which was combined with the above combination! DNA and T4 DN^
The plasmid pLlc-1ts was ligated by ligase.
- Created El. The plJc-1ISA-EH plasmid was treated with EcoRI to open the ring, and the 5'-phosphate group was removed with bacterial alkaline phosphatase, and the powerful Xho I recognition site was extracted from the 5'-^ATTCTCGAC GAGCTCTTA8-5' sequence. The resulting product was ligated with an Xho I linker containing T4 DNA ligase to create a circular plasmid pUc-X-ISA.

? i ■ 'A ATAAA
(7) Human serum albumin A cDNA 3
λgtll (HSA-IA) (Reference Example 1, FIG. 8) containing the c. A DNA-containing DNA fragment was obtained, which was ligated to plasmid pUc18 cut with EcoR1 to create plasmid p[IC-I
SA-1' was obtained. This plasmid pUc11SA
-1' was cleaved with old ndnl to obtain a smaller fragment containing the HSA boliA sequence and AATAAA signal, which was opened with old ndll [treatment and treated with alkaline phosphatase to remove the terminal 5' phosphorus. pUc-X-HSA with acid group removed p[Ic-X-1
We created a 1sA-A plasmid. A commercially available Plus ξ-do pJDB207 (Amersham) was used as the basic Escherichia coli-yeast shuttle vector of Boosmid JOB-NeO. In addition, commercially available brass ξ-do pNEo (Pharmacia) was used as a Neo (aminoglucoside phosphotransferase 3' (1)) gene source. Plasmid pNEo was converted to former ndI [[ and Eco
Double digestion with R I yielded the larger fragment. Then the following sequence: EcoR I Hind I[I
A double-stranded oligonucleotide having the above was ligated and circularized to the larger fragment of pNEO using T4 DN^ ligase to obtain plasmid pNeo-PL.

The double-stranded oligonucleotide has EcoR at its 5′ end.
l sticky end sequence, old ndI[l end at the 3' end, and llindll. Xho
1 and Sea 1 site. Therefore, the plasmid pNeOPL has multiple restriction enzyme cleavage sites upstream of the Neo gene. Next, this plasmid pNeO-PL
was double digested with old ndlI [and Baa+H I,
A 1.4kb fragment was obtained. Plasmid pJDB2
07 was double digested with old ndlll and BamH I to obtain a vector fragment containing a 2μ yeast replication origin, marker gene LH02, etc. Next, these fragments were ligated using T4 DNA ligase to obtain plasmid pJDB-NeO. 100 g of chromosomal DNA of 22 yeast strains AII was reacted with 1 unit of Sau3A I at 37°C for 15 minutes (200aZ of 5 (] wM Trts-HCI (pH
7. 5), 7d MgCh, 50mM NaCl
middle), 10m 0. 5M EDTA (pH 8.
0) was added and reacted for 65°CIO to inactivate the enzyme. 5% sig sugar TE (TE: 10n+
M Tris-HCI (pH 7.5) 1mM ED
TA) and 20% sig sugar-TE to complete the density gradient! 1
It was made using 2d. The above reaction solution was layered on top of this gradient, and using a Beckman SW41 rotor, 22Krp was added.
- and centrifuged at 16°C for 15 hours.

After centrifugation, each fraction was electrophoresed, and 15 kb to 2
Add 50 d of 3M sodium acetate solution (pll5.2) to both portions containing the 0 kb fragment, then add 1 d of ethanol, mix well, and let stand at -20°C overnight to precipitate the DNA. . Centrifugation (15 Krpm, 5
The DNA precipitate was collected. This precipitate was washed with 70% ethanol and then dried under reduced pressure. Through the above operations, 5n DNA was obtained.

Transfer this DNA1fi to the 2K EMBL 3 arm (St
Ra Tegene), and 350 units of 74
It was mixed with DNA ligase (Takara Shuzo) and reacted overnight at 16°C (reaction solution = 10Ill of 50+M↑ris-H).
CI (pH 7.5), 10mM MgClg
, 10mM DTT, 1mM ATP) and 1 μl of the above reaction solution, an in vitro packaging reaction was performed using the GIGA-PACK Plus kit (Strategene. IGP6-P).

As a result, 3 X 10'pfu of E. coli P23
92 strains (hsdR 514 (rk-, mk') + s
upE44, supF58, IacYI+galκ
2, galT22, a+etB1, trpR55
．． (P2)) was obtained. 10
00 pfu of phage was added to 50.1 P2392 cells and incubated at 37°C for 20 minutes.
Top-Agarose (0.7 in LB medium (1% tributone, 0.5% yeast extract, 1% NaCl)
% agarose) with a diameter of 90 mm.
(LB medium + 1.5% agar). Five such plates were prepared and cultured overnight at 37°C to form plaques. Plaques with formed plaques were stored at 4°C for 1 hour.

tlybond-NIEi (Amersham) was brought into close contact with the agarose surface and left in a vacuum chamber for 2 minutes. Peel the membrane from the agarose and place it with the adhesive side up at 0. 5N NaOH,
Soaked with I M NaCl (soaked: = 3MM filter (Whatman) for 5 minutes. Membrane was soaked with 0.
5M Tris-HCI (p}17.2)
．． 1. The membrane was transferred onto a 3MM filter soaked in 5M NaCl and allowed to stand for 5 minutes, washed with ZXSSC solution, and air-dried.

Wrap the air-dried membrane in Saran wrap, irradiate it with UV light, and remove the DNA.
was fixed on the membrane. This membrane was coated with a probe ADH (5'ATGTCT ATC
CCA GAA ACT CAA AAA GGT G
TT). After washing, the membrane was wrapped in Saran wrap, tightly attached to XRA-5 film (Kodak), and exposed to -7 using an Intensify screen.
It was exposed for 5 hours at 0°C. After development, scrape off the blur that gave the hybridization signal with the tip of a Pasteur pipette and add 100aZ
OTM solution (10 mM Tris-HCI (pH 7)
．． 5) Suspended in 10mM gch) and left at room temperature for 20 minutes. Suspension 0. 5 ul was diluted with 1- TM solution, and 5 ul of it was diluted with E. coli P 2 by the method described above.
392, and plated on a plate with a diameter of 90 mm to form a plaque. The formed plaques were again subjected to plaque hybridization as described above to obtain bositip clones consisting of a single plaque. Scrape off the positive blur with the tip of a Bathstool pipette and pipette with 50μ
1 of P 2392 cells and allowed to stand at 37°C for 20 minutes, the solution was added to 2 d of LB medium, 10*M MgSO. In addition, the cells were cultured with shaking at 37°C for 6 hours.

100lI of chloroform! The cells were then completely lysed using a vortex mixer and centrifuged at 2,500 rpm for 5 minutes to obtain a supernatant. This supernatant contained toI0 order phages. 100 I to 800 d of this supernatant
1 liter of 5M NaCl was added, then 540# isobrobanol was added, mixed well, and allowed to stand at -20"C for 20 minutes. Centrifuged, the resulting precipitate was washed with 500 liters of 70% ethanol, and dissolved in 200 μ of TE. Ta.

Add lp1 (60 units/p!) of DNase I (Takara Shuzo) and 2p of IMMgCh, and heat at 37°C for 30 min.
It made me feel resentful. TE saturated phenol from Loop 1 was added and mixed using a portex mixer. 1 2Krp
The mixture was centrifuged for 5 minutes, and the resulting water was extracted once with phenol/chloroform (1:1). To the resulting aqueous layer, add 20II1 of 3M sodium acetate (pH 5.2), add 500ml of ethanol, and centrifuge to remove the DNA.
was precipitated. The resulting precipitate was washed with 70% ethanol, dried under reduced pressure, and dissolved in 50 ttl of TE. Through this operation, phage DNA equivalent to 1n was obtained.
To the obtained solution i20J11, 2.2L of 1O2 concentration Ec was added.
oR Ill street liquid [0. 5M NaCl. 0.
5M Tris-HCI (pfl7.5)
．． 70mM MgCh) and 1pA (5 units/μ0 of EcoRI (Nippon Gene) and 11 of ll11).
Add 0mg/1 of RNase A (Sigma), 3
The reaction was carried out at 7°C for 1 hour. After the reaction, perform 0.7% agarose electrophoresis and identify the DNA band as ■νb according to the standard method.
Blotted onto ond'N membrane. Hybridization of the DNA-bound Hybond-N membrane was performed under the same conditions as Braak hybridization. Among the several clones obtained in this way, λ−
In ADr, the probe was found to bind to an 8.4 kb EcoR I fragment.

Twenty percent of the remaining DNA solution was injected with E under the conditions described above.
It was cut with coR I and the fragments were separated by 0.7% agarose gel electrophoresis. 8. 4kbEc
Cut out the agarose fragment containing the oRI fragment,
Glass powder method (Gene Clean”, Bto
DNA was separated and purified from agarose using a method (Company 101). The DNA eluted in 10 J of TE was
Ligation reaction with pUcl9 cut at R1 (30n
g pllc19,5 0+eM Tris-IICI
(pH7.5). 1 0+M MgC1g. 1
0a+M DTT, 1mM ATP, 350
Unit T4 DNA ligase/30l, 16°C, 2
time] and 5 Jll of the reaction solution was used to transform Escherichia coli JM107. 50 n/t of transformed E. coli
ul X -Gal (5-bromo4-chloro-3
- indolyl-β-D-galactoside) 5 ml PTG (
isobrovir-β-D-thiogalactobyranoside). 5
0I! L-plate containing t/d ampicillin (X-C
plate) and allow colonies to form. The uncolored clones were treated with 50n/5-L containing ampicillin.
It was inoculated into medium B and cultured overnight at 37°C to allow the bacteria to grow. DNA was prepared by the ξ prevaluation method, and the final ethanol precipitate was added to 50 Jl! It was dissolved in TE. ! Five parts of the DNA prepared using FI were cut with EcoRI (50mM Tris-HCI (pH 7.5)).
)． 7d MgClg, 50d NaCl
．． 1 mg/d RNaseA, 5 units EcoR 1/15u! ), 0.7% agarose gel electrophoresis was performed, and it was confirmed that the 8.4 kb EcoRI fragment was inserted into pUc. Furthermore, using the Southern method, we confirmed that this fragment binds to the probe. Clone p obtained in this way
EcO8.4 DNA was purified and 0. 5 n sau
Completely decomposed with 3AI (50+M Tris-1tcL
(9H'7.5). 50mM NaCl,
7mM MgClg, 4 units Sau3AI/
DNA fragments were separated by 0.7% agarose gel electrophoresis in 15 JII at 37°C for 2 hours).

From the agarose fragment containing the 1.6 kb fragment, C
The DNA was collected in IOJTE using "EneC1ean". This was ligated with pIJC119 cut with Basal l, and extracted with Escherichia coli MV118 using pressure response solution 5J11.
4 was transformed. The transformed E. coli was spread on X-G plates and colonies were allowed to form. DNA from colonies that did not develop color was prepared by minipreparation and analyzed. 5dDNA! Col? I and old ndII [5 units HcoR 1% 5 units old ndlI [) and 6 units Sphl were respectively analyzed by gel electrophoresis.
．． 6kb fragment, in the latter 1.0kb
Clones producing the fragment were selected. The clone thus obtained, pSau 1. DNA of 6
was prepared and used in the following experiments. DNA5ff was cut with Sea I and Sac I (1
0e+MTris-HCI (pll7.5).
2 0iM KCI, 711M MgC1g, 20
:L2yto Seal, 20uninote Sacl/50
pl, 37°C, 2 hours). After the reaction is complete, extract with phenol-chloroform and precipitate with ethanol to obtain D.
The DNA precipitate from which the NA was collected was treated with 50 pI Exo Il.
l buffer (50mM Tris-HCI (ptl8.
0), i00mM NaCI. 5d Mg
Clz, 10mM 2-mercabutoethanol)
dissolved in. In another tube, 50d of MB buffer (40111M sodium acetate (pH 4.5), 100%
mM NaCl. 2iM ZnC1g, 10
% glycerol) and placed in water. 18 to DNA solution
Add 0 units of Exo■ nuclease (Takara Shuzo),
The temperature was kept at 37°C. Five samples were taken every 30 seconds after enzyme addition and transferred to a tube containing MBII street solution. After sampling, place the tube on ice at 65°C for 5 minutes.
The mixture was incubated for 30 minutes, then cooled to 37°C, 50 units of mung bean nuclease was added, and incubated at 37°C for 30 minutes. After the reaction, this solution was extracted with phenol saturated with TE, and the DNA was recovered by ethanol precipitation. Recovered D
NA was dissolved in 30 Pa of TE. Take Eva and 2d IO
X lysis solution (500mM Tris-HCI (
pH7. 5), 100mM MgCIz,
Add 100mM RoTT, 10mM ATP),
16p1 TE, 1 pi ↑4 DNA ligase (3
50 units/IJ1) was added and kept at 16°C overnight. Next, incubate at 70"C for 10 minutes to inactivate the ligase, and then add 0.2MKCI to 2J and SIIal to 1I.
1 liter (10 units/jt!) was added and kept at 37°C for 1 hour. Next, it was kept warm at 70°C for 5 minutes and then transferred to water. This was used to transform MV1184, and the transformants were cultured overnight at 37°C to form colonies.

DNA was prepared from the colonies, and clones with deletion mutations were detected. Next, single-stranded phage DNA of a clone in which the deletion had occurred was prepared. Phage DNA was obtained using 7 DEAZA-Dideoxy Seikgo and Nsing Kit (Takara Shuzo) according to the manufacturer's manual.
Sequencing was performed, and a clone pDE6-10 was obtained that had a deletion upstream of ATC to iobp. The DNA of pDE6-10 was prepared, and the DNA was completely digested with EcoRI, dissolved in 10(ld) of TE. Ta.

2 liters of this solution! 1 with 100 ng of Xho linker (AA
TTGCTCGAGC) was added and mixed with 1 bar of IOX ligation solution, 1 bar of T4 DNA ligase (350 units), and 6μ of sterile distilled water, and the ligation reaction was carried out in a total of 10tt1 reaction solution (16℃, 2 time). The enzyme was inactivated by incubation at 70°C for IO minutes, and 1 d of 0.5 M
After adding NaCl and 5 units of EcoRl and incubating at 37°C for 30 minutes, this was used to incubate E. coli MV11.
84 was transformed.

DNA was prepared from the resulting colonies, and clones that were not cleaved with EcoR I but were cleaved with Xho I were selected. In this way pDE6-10 (Xho) (
Promoter cassette vector) was obtained.

Escherichia coli containing this vector pDE6-10 (Xho) MV1184/
pDE6-10 (Xho) was submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology, as part of the FERMP-10
311).

pEcO8. 4 1 pg to 4 units of Bal
(10mM Tris-}ICI (p
H7. 5), 7 o+M MgCh/20J.
37°C, 1 hour). Next, add 3 IMNaC1,
4 units of Sph I was added and kept at 37"C for 1 hour. After the reaction, 0.7% agarose gel electrophoresis was performed to separate the lkb fragment, and GeneClean
DNA was extracted. The recovered DNA was ligated with pUc11B cut with sph I and Slla I, and M
V1184 was transformed. D from the transformed coupon
NA was prepared and clones containing the inserted fragment were searched. This DNA was prepared and the InDNA was cut with sph I and old ndI [l XEcoR I buffer, 4 units Sphl, 12 units old ndlu],
．． 2% agarose gel electrophoresis was performed, the 0.33 kb fragment was isolated, and the DNA was extracted by Gene Clean. This is Brass pMMTV-
PLI was ligated with 50 ng of 11indI [5.7 kb fragment obtained by double digestion with I and sph 1] (total reaction volume: 20 μl). After the reaction, Escherichia coli Jl'll07 was transformed and colonies were grown on an L-plate containing ambicillin (L-amp plate). Prepare DNA from colonies,
The inserted DNA was examined by restriction enzyme analysis, and a clone containing the desired fragment was obtained. DNA was prepared from the clone and 0.5n thereof was cut with old ndIIr. Incubate at 70°C for 5 minutes, transfer to ice, and add lJnI 1.
mM dXTP (dATP, dGTP, dCTP,
dTTP (each containing 1mM) and 2 units of DNA polymerase (κlenow fragment) [Takara Shuzo] were added, and the mixture was incubated at 37°C for 30 minutes. Phenol・
After deproteinizing with chloroform, the DNA was precipitated with ethanol. The DNA was dissolved in IOJ's 1x ligation solution, 350 units of T4 DNA ligase was added, and the DNA was incubated at 16°C.
I kept it warm overnight. After inactivating the ligase by treating at 70°C for 10 minutes, 0. 5 M NaCl'f i.
2pt, add 12 units of old ndlll, 37゛C
It was treated for 30 minutes. Using this, Escherichia coli JM107 was transformed. A part of the colony that had been formed on the Lap plate was cultured in a L-amp liquid medium (L-amp plate without agar). DNA was prepared from the obtained bacterial cells, and DNA was obtained in which the old ndlll site was lost.

Next, 0. 5 n DNA to 4 units - 7 units of Bam
l{cleaved with 1.12 units of Sph I (10
mM Tris-HCI (pll7.5).
150sM NaCl, 7mM MgCIz)
. By 1.4% agarose gel electrophoresis, 0. 34kb
The DNA fragments of Gerie Clea were isolated and
DNA was collected in 10μ TE at n. This is 30n
pTA153 of g was ligated with a 3.5 kb fragment obtained by cutting with Bamll1 and Sph I. E. coli JM107 was transformed with the reaction solution, and L-amp
Colonies were formed on the plate. Part of the colony L
- DNA from the obtained bacterial cells by culturing in ampl body medium
and the size of 0.42 kb BamH I-S
We searched for clones that gave al I double digests (DNA fragments). DNA obtained from clone 0.5
The shoulder was cut with Barin Hl and Sat I, the 0.42 kb fragment was separated by 1.4% agarose gel electrophoresis, and the 0.42 kb fragment was purified with 5% TE using Ger+e Clean.
It was collected inside. This is converted into Bamll I-Sal
A ligation reaction was performed with 10 ng of pUc-119 cut with I. Escherichia coli MV1184 was transformed using 1 tll of the reaction solution, and plated on an XG plate to form colonies. DNA was prepared from the white colonies, and a fragment with the inserted fragment was obtained (pUc-ATE; terminator cassette vector). Escherichia coli Esch containing this vector pUc-ATE
er ich ia parallel MV1184 (pUc-^T
E) has been deposited with the National Institute of Microbial Technology, Agency of Industrial Science and Technology as FERM P-10310.

Promoter cassette vector pDt! 6-10 (Xh
o) 0. 5g old ndn! and Xho I, and a 1.6 kb fragment was separated by 0.7% agarose gel electrophoresis. On the other hand, pJDB-Neo O
．． 5irg was cut with llindlll and Xho I and the 8 kb fragment was isolated.

The two were ligated and introduced into Escherichia coli JM107 to obtain ambicillin-resistant colonies. DNA was obtained from the colony and the inserted fragment was confirmed (pA}16-10-Neo
).

pJDB-Neo O. 5 n to Bawl I and S
It was cut with al I and a fragment of approximately 8 kb was isolated. On the other hand, 1n puE-ATE was digested with BaIIl}lI and Sail, and a 0.42 kb fragment was isolated. The two were ligated, and E. coli JM107 was transformed with the formed brass ξ-d to obtain anhinrin-resistant colonies. DNA was prepared from these colonies, and it was confirmed that they contained the desired brass ξ-doped pJDR-Neo-ATE, pJDl'1Neo-ATE 0.
5 N was cut with old ndlll and Xho I, and about 8k
A fragment of b was obtained. On the other hand, pD [! -6- 10
(Xho), 1.6kb old ndlII-Xho
1 fragment was recovered. The two were ligated, and the transformed plasmid was used to transform E. coli JM107.

The DNA of ampicillin-resistant colonies was examined and a clone containing the desired plasmid (pAH6-10-Neo-ATE) was found. Escherichia coli containing this vector
codanJM107/pAIl6-10-Neo-AT
E is the first microbiological research institute at the Institute of Microbial Technology, Agency of Industrial Science and Technology.
No. 0309 (FORM P-10309).

4. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the process of constructing plasmid pUc-LY3-11s8. Figure 2 shows the expression plasmid pJDB-ADH-LY3-
The process of producing 1sA-A is shown. Figure 3 shows the transformant AH22 (pJDB-ADfl-LY3-}lsA- containing human serum albumin cDNA.
A) (D) Normal mature human serum albumin A produced in culture Nyori is subjected to SDS polyacrylic acid gel electrophoresis and detected by Coomassie brilliant blue staining. Figure 4 shows normal human serum produced in yeast. The results of comparing the behavior of albumin A and human serum albumin derived from human serum in native polyacrylamide concentration gradient gel electrophoresis are shown.

FIG. 5 shows the results of comparing yeast-produced normal human serum albumin A and human serum albumin derived from human serum in isoelectric focusing.

FIG. 6 compares the behavior of yeast-produced normal human serum albumin A and human serum albumin derived from human serum in reversed phase chromatography.

FIG. 7 shows yeast-produced normal human serum albumin A and human serum albumin derived from human serum.
The results are shown below.

Figure 8 shows the cDNA (t{SA cDNA) encoding the entire normal human serum albumin 8 of this invention, as well as the cDNA encoding the 3' end (ISA-IA) and 5 used in the construction of this cDNAO. The restriction enzyme map of the cDNA (ISA-n) encoding the ' terminal side is shown. Figure 9 shows the nucleotide sequences of three probes used for screening human serum albumen A cDN^. FIG. 10 shows the process of constructing plasmid ptlc-HSA-Cll. Figures I1-1 to 11-3 show human serum albumin A.
The base sequence of cDN8 encoding the entirety of .

Figure 12 shows the process of producing plasmid pUc-X-HSA-A. Figure 13 shows the process of constructing plasmid pJDB-NeO.

Figures 14-1 and 14-2 show the ADH I promoter cassette vector pDE6-10 (Xho) of the present invention.
The process of fabrication is shown below. Figures 15-1 and 15-2 show the process of constructing the ADH I terminator cassette vector p[Jc-ATH. FIG. 16 shows the yeast expression vector (ADII I sand german vector) pAH6-10-Neo-ATI!
The process of fabrication is shown below. Patent applicant Toa Fuel Industry Co., Ltd. Patent attorney Patent attorney Aoki Patent attorney Ishida Patent attorney Fukumoto Patent attorney Akira Yamaguchi Patent attorney Masaru Nishiyama α 3. Human serum derived date SA Figure 5 1, 4. Molecular weight standard 2. Human serum derived mouth SA. Yeast production mouth SA 日SA-1 5'-AffiGGAAATAAAGGDing T4^C
CCACTTCA Ding TGTGC
A-2 5'- AAGGTCCGCCCTGTCA
Ding CAGCJCATTCAAGCffiΔTCTCC-
3'Gjy248-Leu260+corresponding area HS
A-3 5'-T/6ATGTTATAAGCCTA
AGGCAGCTTGACTTGC▲GCA#: -
3'9 ■ 11-1 land 11-2 GAG TTT AAT GCT GAA A
CA TTC ACC TTC CAT GC
Ashihashi taA↓ ^hashi LJ8 (J M;U
T(i(;'1"1"T GUC GAG
GAG GGT AAA AAA CTT 11-3rd page 1 continuation @Int. C.I. ' Identification code Office reference number C 07 K 99:00

Claims (1)

[Scope of Claims] 1. A protein having an amino acid sequence that tends to form an α-helix on the amino terminal side, and a sequence on the carboxy-terminal side of the leader sequence of a precursor protein that is efficiently processed in the host on the carboxyl-terminal side. A chimeric leader peptide with a chimeric leader peptide. 2. The chimeric leader peptide according to claim 1, wherein the amino acid sequence that tends to form an α-helix is a sequence that is relatively rich in leucine. 3. The chimeric leader peptide according to claim 1, wherein the host is yeast, and the leader sequence of the precursor protein is a SUC2 signal peptide, a MFα1 signal peptide, a PHOS signal peptide, or a killer toxin signal peptide. 4. The following amino acid sequence: MetLysLeuLeuLeuLeuLeuL
euLeuPheLeuPheSerAlaLysIl
The chimeric leader peptide of claim 1 having eSerAla. 5. DNA encoding the chimeric leader peptide according to any one of claims 1 to 4. 6. The following base sequence: ATGAAGTTGTTGCTCCTCCTTCTTT
TGCTCTACTTCAAACAACGAGGAGGA
AGAAAACGAGTTCTTGTTCTCTGCT
AAGATTTCTGCCAAAGAACAAGAGAC
The DNA according to claim 5, which has GATTCTAAAGACGG. 7. A plasmid comprising the DNA according to claim 5 or 6. 8. A fusion protein comprising the chimeric leader peptide according to any one of claims 1 to 4 and a target protein. 9. The fusion protein according to claim 8, wherein the target protein is human serum albumin A. 10. DNA encoding the fusion protein according to claim 8 or 9. 11. A recombinant DNA in which a promoter, the DNA according to claim 10, a terminator, a poly A addition signal, and a poly A sequence are linked in an expressible manner. 12. An expression plasmid containing the recombinant DNA according to claim 11. 13. A host transformed with the expression plasmid according to claim 12. 14. A method for producing a protein, which comprises culturing the host according to claim 13, secreting the target protein as a mature protein outside the host cells, and collecting the target protein.