JPH0322985A - Production of human serum albumin a by yeast host using yeast acidic phosphatase signal sequence - Google Patents

Abstract

NEW MATERIAL:A DNA having DNA sequence coding yeast acidic phosphatase pH05 signal sequence and cDNA coding human serum albumin A existing downstream of the DNA sequence. USE:Used to produce mature human serum albumin A. PREPARATION:A DNA coding signal peptide of acidic phosphatase is synthesized and bonded to cDNA coding mature human serum albumin A.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention relates to a method for producing aged human serum albumin 8 using yeast, and a genetic system therefor. According to this method, mature human serum albumin A is secreted extracellularly, so its recovery and purification are easy, and it is extremely preferable for industrial production.

[Conventional technology]

Until now, a method using Escherichia coli (La
kn et al., Nucleic Acids Res. i+
6103-6114, 1981; Latta et al., B
iotechnology 5 + 1309-131
4. (1987); JP-A-58-150517)
, method using Bacillus subtilis (Saunders et al., J. Ra
cteriol, 169+2917-2925. (
19B? ) ), and a method using yeast (E tch
Everry et al., Biotechnology i,
? 26-730, (1986)) is known. However, the serum albumin produced by these methods has a somewhat different amino acid sequence from normal human serum albumin, and the produced serum albumin may become an insolubilized precipitate, have a low processing efficiency of signal peptides, or be released from the cells. It has been reported that there are problems such as difficulty in secretion.

(Problem B to be Solved by the Invention) Therefore, the present invention secretes mature human serum albumin A into the extracellular or periplasmic space in a soluble form and in the same three-dimensional structure as natural serum albumin A; The purpose of the present invention is to provide a method for industrially producing large amounts of human serum albumin by allowing it to accumulate in the blood, thereby facilitating recovery and purification.

[Means to solve the problem]

In order to achieve the above object, the present invention provides (1) D
DNA having an NA sequence and a cDNA encoding human serum albumin A present downstream of the DNA sequence; (
2) DNA having a DNA sequence encoding a yeast acid phosphatase PH05 signal sequence, a cDNA encoding human serum albumin A, and a poly(A) sequence in this order; (3) A promoter and promoter capable of functioning in yeast ≧ (4) an expression plasmid in which the DNA described in (2) above is inserted between the inator
) yeast transformed with the expression vector described in (3) above; and (5) cultivating the yeast described in (4) above;
Provided is a method for producing mature human serum albumin A, which comprises producing and secreting mature human serum albumin A and collecting it.

(Specific description) I. Normal human serum albumin contains many disulfide bonds in its molecule, and in order to produce normal human serum albumin with the same three-dimensional structure as natural products using recombinant DNA methods, these are necessary. It is essential that disulfide bonds are properly formed in the production host cell. It has recently been revealed that enzymes such as protein disulfide isomerase and pbutidylbrolyl cis-trans isomerase are involved in regulating the normal three-dimensional structure.
In prokaryotic cells such as Escherichia coli and Bacillus subtilis, which contain few proteins with S-bonds and complex three-dimensional structures, the activity of enzyme systems related to 3D folding is not strong, even if they exist. is expected. On the other hand, cells of eukaryotic higher organisms, including humans, are known to secrete many proteins with complex higher-order structures (including glycoproteins and other modified proteins); It is known that yeast, which is a homoeukaryotic microorganism, secretes proteins through a pathway very similar to that in mammalian cells (Huffaker, T.C.
, and Robbins, P.J. J. Bio1
, Chee+. lfqe, 3203-3210 (1
982); Sr+ider+M. D. in Gi
nsburg, V. & Robbins, P.W.
(eds.) Biology of Carbohy
drates, Vol. 1, 2. Willey, New
York, (1984), pp. 163-198
)． For this reason, yeast is used as a host in the present invention.

Producing human serum albumin A in yeast with the L±stopLbrebro sequence as a leader sequence placed at the ξ-terminal side,
In order for the processing system possessed by yeast cells to produce mature human serum albumin A, two precise processing steps must occur. Since these processes directly utilize the yeast's own systems, yeast precursors such as invertase, acid phosphatase, and MFα1 protein are used, rather than processing the leader sequence of human serum albumin A, an exogenous precursor protein. Processing of protein leader sequences may occur more accurately and with higher efficiency. If mature human serum albumin could be produced in the form of a preprotein with only a signal peptide attached to it, rather than from a precursor structure with a Brebro sequence, and the mature protein could be secreted, the protein processing process could be simplified. This is thought to reduce the possibility of cleavage occurring at an unfavorable site, which is often seen when expressing chimeric proteins, which are a fusion of the signal peptide of the Yeast Protein Award and a heterologous protein, in yeast. Signal peptides suitable for this purpose can be any protein that can be secreted by yeast, and signal peptides from different proteins as well as yeast proteins can be used. In the present invention, the signal conjugate of acid phosphatase, which is well known as Beriblastum protein, is used. Acid phosphatase is a protein that is synthesized in yeast in the form of a preprotein, undergoes signal bebutidase cleavage at the endoplasmic reticulum membrane, and then passes through the plasma membrane and migrates to the peribulum. DNA encoding the signal conjugate of acid phosphatase can be synthesized with mature human serum albumin A.
Expression can be carried out in yeast in a form directly linked to a cDNA sequence encoding. An example of this signal conjugate is shown in Example 1. Lumin AUM Gene (cDNA) encoding human serum albumin A
has already been cloned, and its nucleotide sequence and the amino acid sequence deduced from the nucleotide sequence are disclosed in Japanese Patent Application No. 1983-
037453.

Therefore, in the present invention, plus ξdoρDC-HSA-C}I, etc. containing this cDNA can be used as a source of the gene encoding human serum albumin A. The methods for producing these plasmids are described below as reference examples. It is said that the boliA sequence and the AATAA^ signal, which are present downstream of the 3' end of the bofuA and AATAAA signal coding sequences, contribute to the stability of eukaryotic aII RNA (Bergmann and Brawerman Bfoches+i*try).
t Jofi, 259-264 (1977) iHu
ez et al., Proc. Nat 1. ＾cad. s
ci. IIs^. 78, 908-911 (198
1)). Therefore, in a preferred embodiment of the present invention, these sequences are placed downstream of the cDNA encoding human serum albumin A. Boli A sequence and AATAAA
As a signal, for example, human serum albumin AeDN
We can use these sequences that are naturally associated with A. Human serum albumin A containing these sequences
The gene has already been cloned and a patent application filed in 1983-
037453. For example, λgtll (HSA4^) can be used as a source of these sequences, and the method for producing it will be described later in Reference Examples. In the present invention, any promoter can be used as long as it functions in yeast cells. However, in the present invention it is preferred to use constitutive promoters rather than inducible promoters. When induction is performed using an inducible promoter, human serum albumin rapidly accumulates within cells, and intermolecular disulfide bonds may be disrupted to produce molecules with non-natural three-dimensional structures. This is because of its nature. Among weakly inducible or regulated yeast promoters, those with strong activity include, for example, alcohol dehydrogenase (ADH I) promoter, glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter, and There is a phosphoglycerate kinase (PGκ) promoter, and in the present invention, the ADH I promoter will be specifically explained as an example. Approximately 2,100 yeast cells containing the DHI gene (ADCI)
The base sequence of the base pair region has already been determined, and ADH
In addition to the approximately 1.100 base pair sequence encoding 1, 75
A 5' untranslated sequence of 0 base pairs and a 3' untranslated sequence of 320 base pairs have been determined (Bennetzen. J and Hall, B.J. BIo1, Chem.
257, 3018-3025 (1982)).
The Goldberg-Hogness box (TATA box), which is considered to be the mtJ & sequence by RNA polymerase in transcription, is located at 1 of the translation initiation codon ATG.
It is located 28 bases above (position W at -128), and ADH r promoter activity is detected by Sphl at position -410! ?
It is said that even if the region upstream of the + site is deleted, it will not be lost (Beier, D. and Young, ↑., Nat.
ure Shihito, 724-728 (19B2)). A
Transcripts driven by the DII I promoter account for at least 1% of the total poly(A) RNA in normal yeast [Aan
erer+G. Methods Enzymo1
, Wang, Ql, 192-201 (1983))
．． , E:]” 22L2 transcription (read-through)
) has been reported to reduce the amount of gene products [for example, Zaret+K. S. and Sherm
en. F. ．． Cell technology, 563-573. (
1982)). In order to prevent this phenomenon, it is preferable to provide a terminator downstream of the structural gene to be expressed. An example of increasing gene expression by placing a yeast promoter downstream of a foreign gene is an experiment in which calf chymosin was expressed using a sand inch vector consisting of a PGK promoter/Yuichika promoter. It has been reported that the introduction of Yuichi ξinator increases expression by several to ten times (Mellor et al. Gene 2
4+1-14 (1983) ). Terminators derived from various genes can be used for this purpose, such as the TRP5 (}ributophane synthesis enzyme) gene and the CYCI (iso-1-cytochrome C) gene.
Terinators such as genes are used.

In the case of transcription involving a strong promoter, it is thought to be more convenient to control expression if a strong terminator is placed downstream to prevent read-through. Therefore, in the present invention, it is preferable to use, for example, an ADH I terminator, a GAP terminator, etc., which are gene terminators having a strong promoter. Although the elements directly related to expression contained in the expression blank of the present invention have been described above, the expression blank of the present invention further includes yeast replication origins and marker genes. must be included. As the yeast replication origin, for example, the replication origin of 2μ plasmid DNA derived from yeast can be used. As the marker gene, commonly used marker genes can be used, such as genes that confer drug resistance to the host and genes that complement the nutritional requirements of the host. moreover,
Since it is necessary to replicate the positive ξd in E. coli during the recombinant operation of the positive ξd, the positive ξd of the present invention is preferably a shuttle vector containing an E. coli replication origin and a marker gene. As a vector having the basic requirements for a shuttle vector, a commercially available vector such as PlusDan pJDB207 can be used. The yeast marker gene in this plasmid 9JDB207 is the LED 2 gene encoding β-isobrobyl malate dehydrogenase, which is a leucine biosynthetic enzyme. Therefore, in a preferred expression plasmid of the present invention, a promoter and a leader sequence encoding a presequence are ligated to a shuttle vector comprising a yeast replication origin and marker gene and an E. coli replication origin and marker gene. The gene encoding human serum albumin A, the BoliA sequence, and a terminator are inserted in this order. 2. Transformation of host yeast with the plasmid of the present invention can be carried out according to conventional methods, and a specific example thereof is described in Example 4. The host yeast strain transformed with the expression plus ξ containing human serum albumin cDNA can be cultured using conventional yeast culture methods. For example, it can be cultured in a natural complete medium such as YPD or an incomplete synthetic medium such as SD medium with 1% yeast extract added. Human serum albumin secreted extracellularly after culture can be recovered by various methods. By performing concentration and partial purification by fractional precipitation with ethanol, acetone, ammonium sulfate, etc., isoelectric precipitation, ultrafiltration, etc., and then combining various chromatography and the above partial purification methods, highly secreted human serum albumin can be purified. It is expected that this will be done. [Effects of the Invention] According to the present invention, accurately processed mature human serum albumin A can be efficiently secreted out of cells. Human serum albumin A secreted extracellularly can then be recovered from the medium in its intact form and used for purification. In addition, a large amount of protein that reacts with insoluble anti-human serum albumin A antibodies can be accumulated within the cells. This is considered to be a precursor structure in the form of PH05 signal peptide human serum albumin A with the signal peptide still bound. After extraction, the precursor proteins accumulated within the cells are
Mature H
It is also possible to convert to SA. Next, the present invention will be explained in more detail with reference to Examples. The enzymatic reaction was performed under the following conditions. EcoRI (
Nippon Gene; l2 unit/d), Cla! (New England Biolabs; 5 units/J), t
lindl[I (Nippon Gene: 12 units/d
), Xhol (Takara Shuzo; l2 unit/〆), and Ba
siHI (27 Bongene: 35 units/i1l)
Digestion of DNA by INA1*, Enzyme 11, and IOX
EcoRI buffer (IH Tris-}1cI
(pH 7.5), 100mM MgClt.
Add sterile distilled water to 500aeM NaC1) 3 II1 to make 30 bar. Incubate at 37°C for 1 hour to complete cleavage. For Sail (Nippon Gene. 15 units/Ill) and Xbal (Nippon Gene; 15 units/d), use 100 mM Tris-HCI (pH 7) instead of tOX EcoR I El solution. ．．
5). 7 0a+M MgC]. ? ．． 75M NaC
t, 70mM 2-mercabutoethanol, 2■
MEDTA, 0. 1% bovine serum albumin was used, and in the case of Hpa II (Msp r ) (Nippon Gene; 122 nits/It1), 100 ai
M Tris-HCI (pH 7.5), 100lI
+MMgClg. Using 60 s+M NaCl, ssal (Nippon Gene; 15 units/m) (
7) Case: 200mM KCI, 60mM Tr
is-HCI (pH 7.9). 6 0
Use mM MgCIz in place of IOXEcoRIl buffer.

Bacterial alkaline phosphatase treatment = 1g of DNA
, restriction enzyme f! coR I or old ndln 1tll each
Add sterile distilled water to 2p of IOX RcoRl buffer to make 20p1, incubate at 37°C for 1 hour,
``Heat for 15 minutes to inactivate the enzyme. Next, add sterile distilled water 38I11, bacterial alkaline phosphatase 2
Add m (Takara Shuzo 0.5 units/l 1l) and heat to 37°C.
After incubating for 1 hour, perform phenol extraction and use the resulting aqueous layer for ethanol precipitation. T4 DNA ligase treatment: e.g. vector DNA
1 μg, an equimolar amount of DNA fragments as vector DNA, IOX ligase a street solution (660a+M Tris-
}rcl (pH 7.5), 66mM Mgc
h, 100-dithiothreitol, l MATP]
3I11 and T4 DNA ligase 1lI1 (Takara Shuzo,
Add sterilized distilled water to approximately 400 units/ha) to bring the temperature to 30 d and keep warm at 16°C overnight. 5'-phosphorylation of fragment by T4 polynucleotide kinase: 50
-M Tris-HCI (pH 7.6), 10
-Mke gc1! , 5 Tsuru Automobile Dithios Light Nore, 0.2
An aliquot of each DNA fragment (approximately 30 psoles) was mixed with 6 units of T4 polynucleotide kinase (Takara Shuzo) in a solution containing mM^TP (25I11).
The 5' end is phosphorylated by treatment at 37°C for 60 minutes. Mix the solution containing the phosphorylated fragment (100 m in total) and leave it in a 100°C water bath for 5 minutes, then let it cool at room temperature for annealing. 2III T4 DN
Add A ligase and incubate overnight at 16°C to ligate the fragments to form double-stranded fragments.

5'-phosphorylation of the two III DNA fragments is performed in the same manner as before the annealing reaction. E. coli DN
A polymerase I reaction: DNA1x, DNA polymerase I (Heno-fragment, Takara Shuzo 3.5 units/I) IJ, 1mM dXTP (dATP,
dGTP, dCTP. mixture of TTP) lj11 and IOXI buffer (70mM Tris-H
C1 (pH 7.5), 1mM EDTA,
200mM NaCl. 70mM MgC1g)
3 Add sterile distilled water to td to make the total volume 30111,
Incubate at 37°C for 30 minutes.

Probe label: II4 DNA, 50 μCi of γ-1” P-ATP aqueous solution (3000 Ci/vusol), (50 μCi)
mM Tris-HCI (pH 7.5). 1 0
sM MgCIz, 5mM DTT, 10 units containing T4 polynucleotide kinase (Takara Shuzo)
Il! After reacting the solution at 37°C for I hour, unreacted nucleotides were removed using a Nick-column (Pharmacia) according to the manufacturer's protocol.
Obtain Pry-recognized DNA (l XIO”cpm/
IRDNA/400〆). Hybridization: The membrane with immobilized DNA is mixed with hybridization solution (6
XSSC (I XSSC is 0.15M NaCl, 0
．． 015M sodium citrate, p}17.0), 5X
Denhardt's solution (0.1% bovine serum albumin, 0.1%
Ficoll, 0.1% polyvinylpyrrolidone), 0.5
%SDS, 100ug denatured salmon sperm DNA. )10d
Incubate at 42℃ for 3 hours. Discard the solution, add 10d of hybridization solution containing probe IXIO'cps+/d, and incubate at 80"C for 3 minutes. Next,
Keep warm at 2°C overnight. Discard the solution, wash the membrane with 2X SSC at room temperature for 5 minutes, and then wash with 2X SSC at 60''C for 30 minutes.
Using the enzyme reaction mixture, E. coli If B I Q
1 is transformed according to a conventional method, a transformant is selected according to an appropriate conventional method depending on the E. coli marker gene, and a clone containing the desired plasmid is isolated from the transformant by, for example, the Nibre Raysin method. A method in which the extracted DNA is cut with various restriction enzymes and analyzed by electrophoresis (for example, Manlatis, T. Frirsch, E.
+ F, & Sa@brook, J. Molecu
larcloning A Laboratory M
annual Cold Spring HarborL
laboratory 19B2). Then, the selected clones were cultured, and plasmid DNA was extracted from the bacterial cells according to a conventional method, thereby amplifying and recovering the desired recombinant BRA. This method was performed as necessary for each step of the recombinant operation. Two types of oligonucleotides with the following sequences: AAT
AAAACAACA[iATTTAAAl;A'r1,i
and Matteucci, M. D. and Caruth
ers, M. H. Tetrahedron Lett
ers 21, 719 (1980) using an automatic DNA synthesizer (App
lted Biosystems+Model 380B)
I succeeded using . These two oligonucleotides were annealed to obtain a single double-stranded DNA encoding acid phosphatase signal conjugate. This double stranded DNA
has the following structure. Met Phe Lys Ser Val Val T
yr SerAA TTC ATG TTT AAA
TCT GTT GTT TAT TCAG TAC
AAA TTT AGA CAA CAA ATA A
GT[! coR Ilie Leu Ala Ala Ser Le
u Ala Asn Ala Gly^1'T
TTA GCC GCT TCT TTG
GCC AAT GCC GGCTAA AA
T CGG CGA AG^ ^AC CGG
TTA CGG CCGHpa II A sticky end sequence of EcoR I is placed at the 5′ end,
The 3' end is blunt. ^la-Gly's 3'
DNA for terminal sequences is Nae I and Hpa
The third nucleotide of each codon was replaced to provide a II site (GCA-+GCC
．． GGT→GGC), the signal peptide of acid phosphatase is the sequence up to the 17th alanine. 2, which was obtained by phosphorylating the 5' end of the DNA encoding the synthesized acid phosphatase signal peptide using T4 polynucleotide kinase, and then double digesting the EcoR I and Smallmlm sequences present in the multiple cloning site of pUc18. The .6kb fragment was ligated using T4 DNA ligase to create pUc-PH0.
I got 5 brass. From now on, EcoR I and Hpa
A DNA portion encoding a 55 bp acid phosphaphatase signal bebutide was excised by double digestion of (2). This was converted into a ptlc18-based recombinant plus ξdp (IC-HSA-CI (
D that can code for a fusion protein in which acid phosphatase signal conjugate and mature human serum albumin A are directly linked by ligating Reference Example 2) with a 4.4 kb fragment obtained by double digestion with EcoR l and Cla I.
Recombinant plasmid pUc-PH05-U containing NA sequence
I committed SA conduct. A hybrid linker (Eco-Xho- Eco linker) and H located downstream of the structural gene.
Human serum albumin A cDNA at the indlII site
The 3′ untranslated region of the sequence (boliA addition signal and boj
The old ndm fragment (approximately 200
bp) m-replaced plasmid pUc-}ISA-1'
(Reference Example 4) was cut out and inserted to obtain a replacement plastic notepad pUc-X-PH05-ISA-A. The 2.0 kb fragment obtained by double digestion of the conoplasmid with
Expression vector for yeast containing Noator 1) 186-10
-Neo-ATE (Reference Example 8) Xt+o l -Ba
Expression recombinant plasmid pJDB-ADII-LY5-ISA-A for ligation with the m}l I fragment (8.Ncb) to produce a fusion protein of acid phosphatase signal conjugate and mature human serum albumin A. was created. Escherichia coli containing this brass
Kundan[8101/pJ[)B-ADH-LY5-ISA
-A was internationally deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology as PI!RM BP-2456 on June 8, 1989 under the Budapest Treaty. Expression plasmid pJDB-ADi{-LY5-[13^
-^ The transformation of yeast AH22 by Hideaki Hashimoto and Hikaru Kimura [Fermentation and Industry, 4,! ．． 630-637
(1985) ) 17) A slightly improved method was used according to the KUR method. First, YPD medium (2%
Polybebutone (Dirco), 1% yeast extract (Dir
co), 2% glucose) strain AH22 (MAT
a. 1eu2-3. leu2-112. his4
-519. Canl's YPD medium overnight culture 0. 1 d and heated at 30℃ for about 4 hours (turbidity is 0.6
00 at 0. 5) was cultured with shaking. 2 at 4°C. Centrifuge at 00 rpm for 5 minutes to collect bacteria.
5. 01 of 0. 1? suspended in ILiSCH, of which 1. 5 d was fractionated, 2.00 Orpm,
Bacteria were collected by centrifugation for 5 minutes or 1 minute at 10,000 rpm.

The obtained bacterial cells were 2 MLiSCN 1 0 j11, 5
0%P已G400046Il! resuspended therein
of DNA solution (containing 5-10n of DNA) and
It was kept at 0°C overnight. Sterilized distilled water was added to the suspension and gently shaken using a vortexer.

Next 2. 00Orpm, 5 minutes or 10.000r
ps+, centrifugation for 1 minute, and the resulting bacterial cells were
Resuspend in sterile distilled water of 04 and transfer to selective agar medium (SD
Medium = 2014/- adenine sulfate, 20 n/d arginine hydrochloride, 20 tnr/d methionine, 20 g/- histidine hydrochloride, 20 n/d tryptophan, 2
0 female/-uracil, 30la/d isoleucine, 30n
/yd lysine hydrochloride, 30s/at tyrosine, 50n/
-Phenylalanine, 150/-valine, 0,15
% aa-free yeast nitrogen base (Off
co), 0. 5% ammonium sulfate, 2% dextrose, and 1.5% agar]. The resulting colony (Leu") was suspended in SD medium 5 resistant and cultured with shaking at 30°C for 2 days. 2. Collect the bacteria by centrifugation at 4°C for OOOrpgIs, and collect 0.5 microorganisms of bacterial cells. I
After resuspending in M sorbitol and centrifuging, the bacterial cells were 0. 5
d of LM sorbitol, 0.1% 2-mercabutoethanol, 400 N/d of Zysolya
se-1007 Seikagaku Kogyo).

After incubating at 30°C for 30 minutes, the generated spheroblasts were collected by centrifugation (2, OOOrps+, 5 minutes) and incubated for 10 minutes.
Solution I of 0β (50s + M glucose, l Od ED
TA, 25mM Trls-HCI (pH 8
．． 0)) and then a solution of 2004 (O.

After adding 2N NaOH, 1% SOS and mixing well,
It was left on ice for 5 minutes. Add 150II1 of 5M potassium acetate, mix well and leave on ice for 10 minutes.
Centrifugation was performed at 15.00 rpm for 5 minutes at 4°C, and the resulting supernatant was transferred to a new tube. Add an equal amount of phenol/chloroform (1:1 mixture), stir vigorously, centrifuge (12.00 Orpm+, 5 minutes), transfer the resulting aqueous layer to a new tube, and mix well with 7504 ethanol using a vortex mixer. Mixed. Mixed liquid 1
5. Centrifuge for 5 minutes at OOOrpm and add 0 to the resulting precipitate.
．． After adding 70% ethanol for 5 days and shaking using a vortex mixer, the precipitate was collected by centrifugation at 15.00 rpm for 5 minutes. This DNA precipitate was dried in vacuo and then diluted with 30 m TE buffer (10 m
W Tris-HCI (pH 8.0). 1 s
Dissolved in MEDTA). plus pJDB-AD
A DNA preparation obtained from a transformed strain of AH22 containing H-LY5-ISA-^ was injected with various enzymes (for example, old ndll
l, Xho I, E! coR I + 8a
The structure of the plasmid was confirmed by digesting with restriction enzymes (wH1 + Sa, etc.) alone or in combination, and analyzing the resulting fragments by agarose gel electrophoresis and polyacrylamide ξ gel electrophoresis. 1 Hyoukan Meng 50 (
-Leu) medium was suspended in 5.0 l of fresh SD (-Leu) medium and cultured in a shaking bottle at 30''C for 2 days, with 0 l... to approx. When the o.i.
Cultured until O. Culture solution at 5.00 rpm, 1
Centrifugation was performed at 4°C for 0 minutes, and the supernatant fraction was collected. An equal volume of 99% ethanol was added to the supernatant fraction, mixed, and then left at 4°C for 30 minutes. Next, 12.00Orpm, 1
Centrifugation was performed at 4°C for 0 minutes to obtain a precipitate. This precipitate was added to 100 ml of 1× Loading buffer (5% 2-mercabutoethanol, 0.0025% promophenol blue, 2% SOS. 0.025 M T
rls-HCI, 8% glycerol), and 10I11 of it was placed on an electrophoresis gel (SDS-polyacrylamide gel: 4-20% concentration gradient gel 84 (width) x 90
(Height) x 1.0 (thickness (unit: kaku)) for analysis.

The electrophoresis was performed using a running buffer (0.025M Tris-HCI (
pH8. 4), 0.192M glycine, 0. 1%
SOS) was used for 60 minutes under a constant current of 60-A. The marker that was electrophoresed at the same time was egg white lysozyme (molecular weight 1
4.400), tribucin inhibitor (molecular weight 21,
500), carbonic anhydrase (molecular weight 31,000),
They were ovalbumin (molecular weight 45.000), calf serum albumin (molecular weight 66,200), and phosphorylase B (molecular weight 92.500) (all manufactured by BIO-RAD). After the electrophoresis was completed, staining was performed with Coomassie brilliant blue according to a conventional method, or Western blotting I immunodetection was performed as shown below. After electrophoresis, the separated proteins were transferred to a nitrocellulose filter (BI) using a Sartorius semi-dry blotter.
Transferred to O-RAD Co., Ltd. The filters were soaked in methanol for 1 hour followed by 25 sM Tris-HC for 5 minutes.
I (pH 10.4)/20% methanol and brought into close contact with the electrophoresis gel. Add this to the above buffer and 20%
0.3 M Trls-HCI (p
H10.0) and 25wM Tris-1tc1 (p
H9. 4) / 40s+MS-A constant voltage of 6V was applied to the blotter using filter paper soaked in a buffer solution such as amino-n-cabroic acid. After 5 hours, the filter was washed with 20 wM Tr containing 3% gelatin.
is-HCI (p}17.5)/5001M
After shaking in NaCl (TBS) solution at 37°C for 1 hour, the filter was washed by shaking in ↑BS/0.05% Tween-20 for 5 minutes. Next, the filter was shaken overnight at room temperature in a solution 40 in which anti-human serum albumin rabbit antibody (Kappel) was diluted 2.000 times with TBS containing 1% gelatin. filter 0.05
% Tween-20 (pH 7.
5 (T-TBS)) for 5 minutes with shaking.
After repeating this operation once more, the second antibody (goat anti-rabbit IgG antibody labeled with horseradish peroxidase, manufactured by BIO-RAD) was diluted 3.000 times with TBS containing 1% gelatin in a solution of 40 II. The filter was shaken for 1 hour at room temperature. They were then washed twice with T-TBS for 5 minutes each and once with TBS for 5 minutes as described above.
Detection of the band (ISA) was carried out by immersing it in a solution containing 30 μl of 4-chloronaphtholene dissolved in 10 Jd of methanol, 50 μl of TB5, and 30 μl of 30% hydrogen peroxide. It was stopped by diluting with distilled water. The results are shown in Figure 4. For screening of clones containing normal human serum albumin A cDNA by Brake hybridization, a human liver cDNA library created using λgtll from CLONTEC, USA, as a vector was used. The λgt11&Il recombinant phage was transferred to E. coli Y109.
0 as a host, and transformed Braak total 5.5×
10S pieces were plated on LB agar medium, and the recombinant DNA was passed through a membrane filter (As+ersham Hybo
-nd-N), then 3! Three kinds of oligonucleotides labeled with P radioisotope (specific activity ≧lO1
cp@/n) as a probe (Benton and Davis Science 180-182 (1977)). These three types of probes are each described by Lawn et al. (Nucleic Ackds
Res i. 6103-6114 (19B!)) of the human serum albumin cDNA sequence, the 5' untranslated region (12 from the translation initiation ATG codon)
(ISA-1) containing the nucleotide upstream to the nucleotide before the ATG codon) and the translated region (the ξ-terminal methionine codon, i.e. the part that encodes the 9th amino acid leucine from ATG) (ISA-1), and the 248th glycine One that encodes leucine at position 260 (HS^-2), and one that contains a certain 3'-untranslated region from the valine at position 576 to the carboxyl terminal @ leucine at position 585 and the following 6 nucleotides. It has the same sequence as (ISA-3). The base sequences of these probes are shown in Figure 6. Labeling is carried out using this probe or an automatic DNA synthesizer.
r-”P) performed using ATP and polynucleotide kinase, giving a positive signal in ISA-220
D from 4 clones out of 0 λgtll clones
Prepare NA (Blattner et al. Science 20
2+1279-1284 (1978) ) L, this was digested with EcoR I, and the Southern plot of the digested product was
Hybridized with SA-2 probe (South
Ern, J. Mo1, Bfol, 503-517 (1
975)). The number of hybridized fragments is 3
obtained from two clones, each with 1. 8 kb, 1.4
The length was 1.3kb. Among these, 1. 8
kb and 1. 3 kb long fragment plJc
19 vector. This subclone was subjected to colony hybridization using ISA-1 and HSA-3 as probes (Grunstetri and Hogness Proc. Nat1, Acad.
Sci. USA ll, + 3961-3965 (1
975)). As a result, HSA
Clone λgtll(} that hybridizes only to −3
! SA1-A) was obtained. Various DNAs of this clone
・The fragment was transferred onto the base sequencing vectors M13■plB and -pl9RP-DNA, and subjected to the dideoxynucleotide termination method (Sanger, P., N.
Lcklen, S. and Coulson. ^． R.
Proc. Nat1, Acad. Sci. USA 1
4+5463-5467 (1977)). On the other hand, 20 of the clones that gave positive signals in the Braak hybridization of λgtll clones using ISA-2 as a probe were subjected to Braak hybridization again using HSA-1 as a probe, and one positive signal was detected. A clone λgtll (ISA-II) was obtained.

Phage DNA was prepared from this and Southern hybridization was performed on the EcoRI digest using ISA-1 as a probe, and it was confirmed that a 1.25 kb fragment (IISA-n) hybridized with the probe. The base sequence of this fragment was determined using the dideoxynucleotide termination method.
ISA-II did not hybridize with the ISA-3 probe. As a result, ISA-I1 lacks the part encoding the carboxyl terminal side, HSA I-A lacks the part encoding the amino terminal side of human serum rubumin, and 30
It was found that the codon encoding the fourth serine (TCA) was changed to the opal codon TGA, which is a translation stop codon. The restriction enzyme maps of these two DNA fragments are shown in Figure 5. The exact location of the enzyme recognition site was obtained from the final base sequence. As can be seen from Figure 5, HSA I-A and }IsA I
Place the two DNAs of I at appropriate positions (for example, Xbal or Ps
By cleaving them at the tl site) and recombining them with each other, it is possible to construct a cDNA that can encode the full length of the human serum albumin precursor protein with a signal conjugate and a prosequence attached. Toyoshuban mousse paper” UC-ISA-CI
7 Brass ξ-do pUc containing DNA encoding a protein fusion of E. coli alkaline phosphatase (phoA) signal conjugate and normal human serum albumin A.
-phoA-HSA-A was constructed as follows. f! from clone λgtll (HSA-II) containing HSA cDNA obtained from a human liver cDNA library.
The fragment generated by coR I and Xba 1 digestion was prepared and was inserted into the EcoR
The larger fragment of the double digest of I and Xba I was ligated using T4 DNA ligase to construct recombinant brass ξ-do pUC-ISA-EX. The smaller fragment resulting from the double digestion of Aha[1 and Sail was purified from this plasmid. This fragment encodes the 12th L+9 to 356th Thr of the mature normal human serum albumin A protein. To construct a gene encoding mature normal human serum albumen A protein from the amino terminus,
A DNA sequence corresponding to the ' end was created by combining two chemically combined fragments. This combination D
The NA sequence is linked to Hpa for fusion with a DNA sequence encoding the alkaline phosphatase signal peptide.
II and Claal enzyme cleavage produces a sticky end sequence CG on the 5' end side, and the mature normal human serum albumin A protein has the 1st amino acid Asp to the 11th amino acid ξ.
It has a sequence encoding the amino acid Phe. This annealed DNA sequence was treated with T4 polynucleotide kinase to phosphorylate the 5' end, and pue-u
Aham /Sal generated from s^-EX! pAT 15, one of the typical E. coli multi-copy cloning vectors, is mixed with the double digest and
3 (manufactured by Asersha, Twigg, A-'. and Sherratt, D. Nature 283 2
16-218. 1980) with the larger fragment of the Cla I/Sail double digest.
were ligated using T4 DNA ligase to obtain recombinant brass ξ-d pAT-HSA-CX. On this plasmid, pAT-HSA-CX, in which the DNA sequence encoding the amino acid Asp at position 1 of normal human serum albumin A to the amino acid Phe at position 11 was linked, was transformed into BcoR f /
Double digested with Xba I, normal human serum albumin A
A smaller fragment containing the DNA sequence encoding ^sp I NPhe356 was obtained. On the other hand, HSA-A
The cDNA encoding the carboxyl terminal #A@ is a clone λgtll obtained from a human liver cDNA library.
An EcoR 1 fragment with a foreign cDNA sequence inserted was prepared from (ISA I-A) and cloned into the recombinant branumid ptlC-ISA-1 by inserting it into the EcoR I site of the pUc18 plasmid. From now on, ISA-. A double digest of Xba I/Hind m was prepared which encodes Leu from amino acid position 358 of A to amino acid position 585 at the carboxyl terminus and further contains 62 nucleotides of the untranslated region of the 3' stool. This is p^↑-}EcoR obtained from ISA-CX
I/Xba I double digest and Bic of pUc1B
The mixture was mixed with a large fragment of the oR 1 /old ndlll double digest and ligated with T4 DNA ligase to obtain a recombinant plasmid pUc-ISA-CI containing the entire cDNA of mature normal human serum albumin A. The base sequences of cDNAs encoding the entire amino acid sequences of mature normal and human serum albumin A and the corresponding amino acid sequences are shown in Figures 8-1 to 8-3. Four types of oligonucleotides with the following sequences: 1. AATTCATGAA
GTGGGTTACTTTCATCTCTTTGTTG
TT2. ^GAACAAGAAACAACAAAAGAGA
TGAAAGTAACCCACTTCATG3. C
TTGTTCTCTTCTGCTTACTCTAGAG
GTGT Ding↑TCAGACG4. CGCGTCTGA
AAACACCTCTAGAGTAAGCAGAAG by Matteuccl, M. D. and Carutbsr
s+M. H. +Tetrahe-dron Lette
RS, 1.719 (1980), an automatic DNA analyzer (Appli
ed BtosysLess model 380B) was used. The oligonucleotide fragments were 5'-phosphorylated with T4 polynucleotide kinase, annealed, and then ligated with 74 DNA ligase.
A single double-stranded DNA encoding the Brepro sequence was obtained. Brass ξ-d pUc-1ISA-CH (Reference Example 2) containing cDNA of normal human serum albumin A was treated with restriction enzyme l!
Double digestion with coR I and ClaI yielded the larger fragment, which was combined with the above DNA and T4 DNA.
Brass a-do pUc-HSA-O linked by ligase
I created H. pUc-ISA-EH plasmid into Ec
After ring opening by treatment with oRI and removal of the 5'-phosphate group with bacterial alkaline phosphatase, a certain Xho I L! ! Xho including the recognition site
1 linker and 74 DNA ligase to create a circular brass tube, pLlc-X-}ISA. λ containing the 3' region of human serum albumin A cDNA
gtll (ISA-1^) (Reference Example 1, Figure 5)
Human serum albumin A cDNA was digested with oR I.
A DNA fragment containing A was obtained, and this was converted into EcoR.
The plasmid pLIC-HSA-1' was obtained by ligating it to the positive ptlc1B cut with pLIC-HSA-1'. This plasmid puc-ISA-r' was cut with old ndl[I to obtain a smaller fragment containing the HSA boliA sequence and the AATAAA signal, which was opened with old ndl treatment and treated with alkaline phosphatase to remove the ends. 5
'pUc-X-HSA with phosphate group removed! :Integrated pljc-X-}15A-A plasmid was created. Kouma Sadaaki Boothmi JDB-NeO's 1
A commercially available plus ξ-d pJDB207 (Amersham) was used as a basic Escherichia coli-yeast shuttle vector. In addition, Brass ξ de pNEo (Pharmacia), which is commercially available as a Neo (aminoglucoside phosphotransferase 3' (1)) gene source, is also available.
It was used. Plasmid pNEo was double digested with }IindIIl and BcoRl to obtain the larger fragment. Then the array below: j! ! JLLLL! ! iIIL 5'-AATTGAAGCTTATCTCGAG
GCCCGGGCTTCGAATAGAGCTCCG
A double-stranded oligonucleotide having GCCCTCGA-5' was ligated and circularized to the larger fragment of pNEo using T4 DNA ligase to obtain plasmid pNeo-PL. The double-stranded oligonucleotide has an EcoR I sticky end sequence at its 5′ end;
In addition to having the old ndlm end at the 3′ end, there is also the old n
dII[, has Xhol and Slla 1 site. Therefore, the above-mentioned brass a-do pNeo-PL has multiple restriction enzyme cleavage sites upstream of the Neo gene. Next, this plus ξ do pNeo-PL is
A 1.4 kb fragment was obtained. Brass pJDB207 is old ndII [and Ba+mH
A vector fragment containing the 2n yeast replication origin and the marker gene LE[I2, etc.] was obtained. Next, these fragments were ligated using T4 DNA ligase to create plasmid pJDB-Neo.
I got it. 100n of chromosomal DNA of yeast strain ^822 was reacted with 1 unit of Sau3AI at 37°C for 15 minutes (20
0I11 of 50mM Tris-}ICI (pH 7.
5), 7s+M MgCh, 50mM NaCl
Medium 3.10tII 0.5Ml! DT^ (pH 8.0)
was added and reacted at 65°C for 10 minutes to inactivate the enzyme. 5
%shi! III 1 TE (TE: 1 0m
M Tris-ICI (pH 7.5) lmM
EDTA) and 20% Shi! ! A density gradient was created using I1-TE with a total amount of 12 d. The above reaction solution was layered on top of this gradient, and centrifuged at 22Krp- for 15 hours at 16°C using a Beckman SW41 rotor. After centrifugation, each fraction was subjected to electrophoresis, and 15 kb to 20 kb
504 parts of 3M sodium acetate solution (pH 5.2) was added to the fraction containing the fragment, and then 1 part of ethanol was added, mixed well, and left at -20°C overnight to precipitate the DNA. The DNA precipitate was collected by centrifugation (15 krps, 5 minutes, 4°C). This precipitate was washed with 70% ethanol and then dried under reduced pressure. Through the above operations, 5R DNA was obtained. This DNA 1sr is 2n EMBL 3
arm (Strategene) and 350 units of 74 DNA ligase (Takara Shuzo),
Reacted overnight at ℃ [Reaction solution: 50mM of 10III
Trls-HCI (pH 7.5). 1 0
mM MgClx. 10mM DTT, 1mM
ATP). Using the above reaction solution lI11, GIGA-P
ACK Plus kit (Strategene, I
GP6-P) was used for in vitro packaging reaction. As a result, 3 X 10' pfu of E. coli P 2392 strain (hsdR 514 (rk-. s+
k") + supE44. supF58, 1acY
I. galK2, galT22. setB1. t
rpR55, (P2)) was obtained, 1000 pfu of phage was infected with 50 d of P2392.
After adding to the cells and incubating at 37°C for 20 minutes, 2. 5
d L-Top-Agarose (LB medium (
1% tryptone, 0.5% yeast extract, 1% NaCl)
medium (0.7% agarose) on L-plates (LB medium + 1.5% agar) with a diameter of 90 m. Five such plates were prepared and cultured overnight at 37°C to allow the Braak to develop. 1 plate with blaak formed
It was stored at 4°C for an hour. A Hybond-N membrane (Amersham) was brought into close contact with the agarose surface and left at room temperature for 2 minutes. Peel the membrane from the agarose and place it with the adhesive side up at 0. 5N
NaO}! , 1M NaCl, and placed on a 3MM filter (What@an) for 5 minutes. 0 membrane
．． 5M Tris-HCI (p}17.2)
．． 1. The membrane was transferred onto a 3MM filter soaked in 5M NaCl and allowed to stand for 5 minutes, washed with zxssc solution, and air-dried. The air-dried membrane was wrapped in Saran wrap and UV irradiated to fix the DNA to the membrane. This membrane was coated with a chemically synthesized probe ADH (5'ATGTCT
ATC CCA GAA ACT CAA AAA G
GT GTT). After washing, the membrane was wrapped in Saran wrap, tightly attached to XRA-5 film (Kodak), and exposed for 5 hours at -70"C using an Inten-sify screen. After development, a blank film that gave a hybridization signal was exposed. Scrape off with the tip of a Barstool pipette and
TM solution (IOIIM↑ris-HCI (pH 7.
5) Suspend in 1g of 10mM MgCl and leave at room temperature for 2
It was left standing for 0 minutes. 0.5 d of the suspension was diluted with IIRi TM solution, and 54 d of the suspension was purified with E. coli P23 using the method described above.
92 and spread it on a plate with a diameter of 90 cm to form a plaque. Plaque hybridization was performed again on the established Braak as described above, and a positive clone consisting of a single Braak was obtained. Scrape off the positive blur with the tip of a Pasteur pipette and add 50II1
The solution was added to P 2392 cells and allowed to stand at 37°C for 20 minutes, then added to 2111 LB medium and 10mM MgSO4, and cultured with shaking at 37°C for 6 hours. 100ml of chloroform was added, the cells were completely lysed using a vortex mixer, and the mixture was centrifuged at 2.500 rpm for 5 minutes to obtain a supernatant. This supernatant contained phages on the order of 1010. To this supernatant 800I1f, 100p of 5M NaC1
Next, 540 Il1 of isoprobanol was added, mixed well, and allowed to stand at -20'C for 20 minutes. Centrifuge, wash the resulting precipitate with 70% ethanol for 500 d, and incubate for 2
00 J11 TE. 1m (60 euros)
DNase I (Takara Shuzo) and 2I11
of I M MgClg was added and reacted at 37°C for 30 minutes. Add 11 iooI of TE saturated phenol and mix on a vortex main mixer. After centrifuging for 5 minutes at 12κrp, the resulting aqueous layer was diluted with phenol/chloroform (1:
Extracted once in step 1). To the resulting aqueous layer was added 20 p of 3M sodium acetate (pl45.2), and further 500 I
Ethanol II was added and centrifuged to precipitate the DNA. The resulting precipitate was washed with 70% ethanol, dried under reduced pressure, and dissolved in 50μ of TE. With this operation
Phage DNA corresponding to jrg was obtained. To 20 d of the obtained solution, add 2.2 10 times concentrated EcoR I buffer (
0. 5M NaCl. 0. 5MTria-i1
cf (pH7.5), 70+wM Mg
C! z) and E of II11 (5 units/j11)
CORI (-'-7 Bonjean) and 1ba's 10■/
RNase A (Sigma) of d was added and reacted at 37°C for 1 hour. After the reaction, 0.7% agarose electrophoresis was performed and the DNA bands were analyzed using Hybond NI.
Hybo bound to DNA plotted on ll
The nd-N film was subjected to hybridization under the same conditions as Braak hybridization. Among the several clones thus obtained, it was found that the λ-MDI probe bound to the 8.4 kb EcoRI fragment. 20J1 of the remaining DNAtI solution! was cleaved with EcoR 1 under the conditions described above and 0. Fragments were separated by 7% agarose gel electrophoresis, 8. The agarose fragment containing the 4 kb EcoRI fragment was cut out and subjected to the glass powder method (Gene Clean" + Bio-101).
DNA was separated from agarose and purified by. Io
The DNA eluted in TE of n was ligated with pUc19 cut with BcoR I (30 ng pt
Jc19.5 0+lI Tris-HCI (pH
7.5). 1 0+sM MgClg.
10mM OTT, 1sM ATP.
350 units T4 DNA ligase/16 out of 30
℃, 2 hours), E. coli JM1 using reaction solution 5Il1
07 was transformed. 50 transformed E. coli
n/at X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) 5mrP
L-7” rate (χ
1G plate) to form colonies. The non-colored clones were inoculated into 5II1 LB medium containing 5 on/d ampicillin and cultured overnight at 37°C.
Bacteria grew. DNA is extracted by the mini-preparation method.
tm, and the finally obtained ethanol precipitate was mixed with 5 (J
It was dissolved in TE of d. ! 5i of the DNA I made!
1 was cleaved with EcoR I (50aM Tr!s-}
! Cl(p}17.5), 7*M MgCIg,
50sMNaC1. LM/dRNase^, 5
Unit EcoR1/15ml 0.7% agarose gel electrophoresis was performed to confirm that the 8.4 kb BcoR I fragment had been inserted into pUC. Furthermore, using the Southern method, we confirmed that this fragment binds to the probe. The DNA of the clone pBcO8.4 thus obtained was purified, and the DNA of the clone pBcO8.4 was purified. 5 n to S
Completely degraded with au3AI (50lI?tTrls-
HCI (pH 7.5), 50mNNac1
, 7 ml MgC1g, 4 units Sau3A
DNA fragments were separated by 0.7% agarose gel electrophoresis in I/15 J at 37°C for 2 hours). From the agarose fragment containing the 1.6kb fragment, the DNA was extracted with 10mTE using CeneClean.
It was collected inside. This was subjected to a ligation reaction with pllc119 cut with Ba*H I, and the reaction solution 54 was used to transform Escherichia coli MV1184. The transformed E. coli was spread on X-G plates and colonies were formed. DN of colonies that do not develop color
A was prepared by minipreparation and analyzed, 5
dDNA cut with EcoR l and Hind m (5 units EcoRt, 5 units old ndII [),
and 6 units cleaved with sph I were analyzed by gel electrophoresis, and the former was a 1.6 kb fragment, while the latter was a 1.6 kb fragment. Clones producing Okb fragments were selected. The clone thus obtained, pSau 1. DNA of 6 was prepared and used in the following experiment. DNA 5 was cleaved with Sa I and Sac I [101 Trls-HCI (pH 7.5). 2 0
-κCt, 7+m)i MgClg, 20 units Sgeal, 20 units Sacl/50 bar. 37℃,
2 hours]. After the reaction was completed, the DNA was extracted with phenol-chloroform and recovered by ethanol precipitation.
The precipitate was diluted with 50111 Exo m buffer (50mM T
ris-HCI (pH 8.0), 100s
M NaCl ,5d MgCIx . 10mM
2-Menoreka 7"}Etha/-7L/). In another tube, add 50 liters of MBll street solution [40L
IIM sodium acetate {p}f4. 5>, 10Qm
MNaCt. 2mM ZnClg. 1 0
% glycerinol] and placed in water, add 1% to the DNA solution.
1 of 80 units! xom nuclease (Takara Shuzo) was added and kept at 37°C. 5 every 30 seconds after enzyme addition
j11 was sampled and transferred to a tube containing MBIl solution.

After sampling, the tube was kept on ice at 65°C for 15 minutes, then cooled to 37°C, 50 units of mung bean nuclease was added, and the tube was kept at 37°C for 30 minutes.
After the reaction, this solution was extracted with phenol saturated with TE, and the DNA was recovered by ethanol precipitation. Recovered DNA
was dissolved in 30111 TE. Take 1d and 2l
11 IOX ligation solution (500a+M Tri
s-HCI (pH 7.5). 100mM
gC1z. 100■M DTT, 10-M
ATP), 16pa TE, 1d T4 DNA
Ligase (350 units/I11) was added and kept at 16°C overnight. Next, after incubating at 70°C for 10 minutes to inactivate the ligase, 0.2MKCI was added to 2111, S
Add lm (10 units/Il) of ea I and heat at 37°C.
, kept warm for 1 hour. Next, it was kept warm at 70°C for 5 minutes and transferred to water. This was used to transform MV1184, and the transformants were cultured overnight at 37°C to form colonies. DNA was prepared from the colonies, and clones with deletion mutations were detected. Next, single-stranded phage DNA of a clone in which the deletion had occurred was prepared. What about phage DNA? −
Sequencing was performed using DEAZA-Dideoxy Sequencing Kit (Takara Shuzo) according to the manufacturer's manual to obtain clone pDE6-10, which was deleted up to 10 bp upstream from ATG. The DNA of pDE6-10 was prepared, and the 1ar DNA was extracted. Completely digested with ECOR I, 10
It was dissolved in 0II1 TE.

Add 100 ng of Xho linker (AATT) to 2 d of this solution.
GCTCGAGC) was added and mixed with II11 IOX ligation solution, 1p T4 DNA ligase (350 units) and 6p1 sterile distilled water, and ligation reaction was carried out in a total of 10ul of reaction solution (16°C, 2 hours) ．． 70
The enzyme was inactivated by incubating for 10 minutes at 1111°C.
After adding 5 M NaCi and 5 units of EcoR I and incubating at 37°C for 30 minutes, E. coli MV1184 was transformed using the mixture. DNA was prepared from the resulting colonies, and DNA that was not cleaved with EcoR I and
Clones that were cut with I were selected. In this way, pDB6-10 (Xho) (promoter-cassette vector) was obtained. This vector pD[! Escherichia coli MV1184/ containing 6-10 (Xho)
pDH6-10 (Xho) was submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology, as part of the Microbiological Research Institute No. 10311 (FORN P-1).
0311). pEcO8. 4
1 pg was cut with a 4 u-'-71 Ball ('
10IIM Trts-HCI (pH 7.5)
, 7 Rin M MgC1g/20d. 31℃, 1 hour). Next, add 3 liters of IMNaC1 and add 4 units of Sp.
h I was added and kept at 37°C for 1 hour. 0 after reaction.
7% agarose gel electrophoresis was performed to separate the lkb fragment, and the DNA was extracted with GeneClean. The recovered DNA was ligated with pUc118 cut with sph I and Sma I, and MV1184 was transformed. DNA was prepared from transformed clones, and clones in which the fragment had been inserted were searched. This DNA was prepared and the 1,q DNA was combined with Sph I and Hindlfl
(lXf!coR I buffer, 4 u-'-
7 units Sphl, 12 units old ndIII), 1.2%
Agate gel electrophoresis was performed, a 0.33 kb fragment was isolated, and the DN was purified by Gene Clean.
A was extracted. Add this to Plus Izumi de pMMTV-PLI
was ligated with 50 ng of HindI [5,7 kb fragment obtained by double digestion with I and Sph I] (total reaction solution volume: 20 parts). After the reaction, Escherichia coli JM107 was transformed, and colonies were grown on L-Plate containing Ambicillin (L-asp plate). Prepare DNA from colonies,
The inserted DNA was examined by restriction enzyme analysis, and a clone in which the desired fragment was inserted was obtained. DNA was prepared from the clone, and 0.5n of it was cut with old ndlll. Incubate at 70℃ for 5 minutes, transfer to ice, and add 1sM of IR.
dXTP (dATP, dGTP, dCTP, dT
TP (each containing 1 sM) and 2 units of DNA polymerase I (Kleno-fragment) [Takara Shuzo] were added, and the mixture was incubated at 37°C for 30 minutes. After deproteinizing with phenol/chloroform, the DNA was precipitated with ethanol. The DNA was dissolved in 1× ligation solution of lOI11, added with 350 units of T4 DNA ligase, and incubated at 16°C.
I kept it warm overnight. After inactivating the ligase by treating at 70°C for 10 minutes, 0. 5 W NaCl 1. 2
4. Added 12 units of old ndI and treated at 37°C for 30 minutes. Using this, Escherichia coli JM107 was transformed. A part of the colony formed on the L-amp plate was cultured in L-am+p liquid medium (L-amp plate without agar). D from the bacterial body
NA was prepared, and one in which the old ndlfl site was lost was obtained. Then 0. 5n DNA to 4 units of BasH
f. Cleaved with 12 units of Sph I (10 mM
Tris-HCi (pH 7.5), t50mM
NaCl. 7mM MgC1z). ! ．． 4
A 0.34 kb DNA fragment was separated by % agarose gel electrophoresis, and the DNA was recovered in 104 TE using Gene Clean. Add this to 30 ng of pAT1
53, BaagH I and Sph! A ligation reaction was performed with the 3.5kb fragment obtained by cutting the . E. coli JM107 was transformed with the reaction solution, and L-amp
Colonies were grown on the plate. Part of the colony L
-DNA obtained from bacterial cells cultured in liquid medium
and the size of 0.42 kb BamH I-S
We searched for a clone that gave an al I double digest (DNA fragment). DNA obtained from clone 0.5
The tails were cut with Bawl I and Sa, and subjected to 1.4% agarose gel electrophoresis. The 42kb fragment was isolated and recovered in 5L TE by Gene Clean. This is Bat}I I - Sal I
A ligation reaction was performed with 10 ng of pUc-119 that had been cleaved with. Escherichia coli MV1184 was transformed using the reaction solution lm, plated on an XG plate, and colonies were allowed to form. DNA was prepared from the white colonies, and a fragment with the inserted fragment was obtained (pUc-ATE; terminator cassette vector). E. coli Esc containing this vector ptlc-ATE
her ich lacoli MV1184 (ρυC
-ATE) has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology as FERM P-10310. Promoter cassette vector pDB6-10 (X
ho) 0.5 cans were cut with old ndII and Xho I, and 1. 6k
The fragment of b was isolated. On the other hand, pJDB-Neo
0. 5 Cut the tail with old ndn [and Xho I,
An 8kb fragment was isolated. The two were ligated and introduced into E. II bacterium JM107 to obtain an ambicillin-resistant colony. DNA was obtained from the colony and the inserted fragment was confirmed (pAH6-10-Neo). pJDB-Neo
0. 5n was digested with Bas+}I and Sall, and a fragment of approximately 8 kb was isolated. On the other hand, p of lI4
UC-ATF! Bami}l I and Sai! A 0.42kb fragment was isolated. E. coli JM107 was transformed with the transformed plasmid, and ambicillin-resistant colonies were obtained. DNA was prepared from these colonies and the desired plasmid p
I confirmed that I have JDB-Neo-ATE,
pJDB-Neo-ATE 0. 5 m to old ndn
A fragment of about 8 kb was obtained by cutting with l and χ hol. On the other hand, from pDE-6-10 (Xho), 1.6
The old ndnl-Xhol fragment of kb was recovered.
By connecting both, E. coli JM
107 was transformed. The DNA of the ambicillin-resistant colonies was examined and the target plasmid (pA}16-10-
We found a clone that has the following: Neo-ATE). Escherichia coli containing this vector
cotiJM107/pAH6-10-Neo-AT
[The Institute of Microbiological Technology, Agency of Industrial Science and Technology, Microbiological Research Institute
It has been deposited as No. 0309 (F'BRM P-10309).

[Brief explanation of drawings]

Figure 1 shows the process of preparing the positive pUc-PH05-}ISA. Figure 2 shows brass ξ-do pUc-X-PHO-. HSA-A
The process of making is shown below. Figure 3 shows the expression plasmid pJDB-ADH-LYF, -
The process of producing HSA-^ is shown. FIG. 4 shows the expression plasmid pJDB-ADHL of the present invention.
of yeast cultures transformed with Y5-HSA-A,
Figure 2: Western plot of HSA from cell extract (lane 1), supernatant fraction (lane 2), and human serum as a control. Figure 5 shows the cDNA (HSA cDNA) encoding the entire normal human serum albumin A of this invention, as well as the cDNA (ISA-1^) encoding the 3' end and the 5' end used for the production of this cDNA. The restriction enzyme map of the cDNA (Is^1■) encoding this side is shown. FIG. 6 shows the base sequences of three types of probes used for screening human serum albumin A cDNA. FIG. 7 shows the process of preparing brass ξ-do puc-HSA-Cll. Figures 8-1 to 8-3 show the base sequence of cDN^ encoding the entire human serum albumin A. Figure 9 shows
The process of producing brass kettle ptlc-X-HSA-8 is shown. FIG. 10 shows the process of producing brass ξ-do pJDB-Neo. Figures 11-1 and 11-2 show the ADD I promoter cassette vector pDE6-10 (Xho
) is shown below. Figures 12-1 and 12-2 show the process of constructing the ADH Iterinator cassette vector p[lc-ATH. FIG. 13 shows the process of constructing the yeast expression vector (MDI{I sand german vector) pAH6-10-Neo-ATE.

Claims (1)

[Scope of Claims] 1. A DNA having a DNA sequence encoding a yeast acid phosphatase PH05 signal sequence and a cDNA encoding human serum albumin A present downstream of the DNA sequence. 2. DNA having a DNA sequence encoding a yeast acid phosphatase PH05 signal sequence, a cDNA encoding human serum albumin A, and a poly(A) sequence in this order. 3. The signal sequence has the following formula: Met Phe Lys Ser Val Val T
yr Ser Ser Ile LeuAla Ala Ser
The DNA according to claim 1 or 2, which is represented by Leu Ala Asn Ala. 4. An expression plasmid in which the DNA according to claim 2 is inserted between a promoter and a terminator that can function in yeast in an expression direction. 5. Yeast transformed with the expression plasmid according to claim 4. 6. A method for producing mature human serum albumin A, which comprises culturing the yeast according to claim 5 to produce and secrete mature human serum albumin A, and collecting the same.