JPH03130076A - Novel fibrinolytic agent having mutation in cringle-1 region and its production - Google Patents

Abstract

NEW MATERIAL:A texture plasminogen-activating factor derivative(TPA derivative) in which 115th asparagine and 119th serine in amino acid sequence are substituted by proline and methionine respectively. USE:A fibrinolytic agent useful as therapeutic agent of thrombus. Has more excellent affinity to fibrin, plasminogen-activating property and in vitro fibrinolytic property than natural type. PREPARATION:At first, DNA coding said TPA derivative is obtained by a method such as cloning of TPAcDNA, etc., and resultant DNA is inserted into manifestation vector. Next, an animal culturing cell is transformed with said manifestation vector and said animal culturing cell is cultured and thus produced.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a novel plasminogen activator, a cell that produces the factor, a DNA sequence encoding the factor, and a method for producing the factor. The novel plasminogen activator of the present invention has the effect of converting plasminogen into plasmin having fibrinolytic activity, and can be used as a therapeutic agent for various thromboses.

[Conventional technology]

Human tissue plasminogen activator (hereinafter abbreviated as TPA) is used in human melanoma cells (Bowes M
TPA secreted by S. elanoma has been well studied and is a glycoprotein consisting of 527 amino acid residues (Pennlca, D., et al. (1983)).
(Nature) Volume 301, Page 214].

TPA is an enzyme that converts plasminogen, which does not have fibrinolytic ability, into plasmin, which has fibrinolytic activity, and has thrombolytic activity. TPA is currently used to treat thrombosis [Grossbard.

E, B. (1987) Pharmaceutical Research
ch), vol. 4, p. 375]. However, the biggest drawback of TPA is its rapid release from the bloodstream. It is estimated that TPA administered into the bloodstream is mainly metabolized in the liver (Fuchs, E., et al. (1985) Bfood, Vol. 65, p. 539). Its half-life in the blood is (Collen, D., et al. (1985)).
ion) Volume 72, Page 384]. Therefore, treatment of thrombosis requires administration of large amounts of TPA. Thrombosis treatment by administering large amounts of proteins such as TPA is not only an extremely expensive treatment, but also involves the worrying problem of side effects due to antigen-antibody reactions. Therefore, chemical modification of TPA molecules (WO8410178B) (JP-A-63
-06983 ) (Berger, H, et al. (198
3rd year) Blood Volume 71, page 1641]
, Enzymatic modification (JP 62-282582) (EP
0253582 AL) or genetic engineering modification (JP-A-61-243024, JP-A-62-13069)
0, JP-A-62-272976, JP-A-62-2696
88, JP-A-62-282582, JP-A-64-633
79) et al., attempts have been made to create TPA derivatives with improved persistence in blood, ie, long half-life in blood. However, although the new TPAs developed to date have extended blood half-lives, their affinity for fibrin has decreased, and as a result,
It does not surpass conventional TPA in terms of its dissolving properties against blood clots.

[Problem to be solved by the invention]

TPA is thought to act specifically on blood clots due to its strong affinity for fibrin and the dependence of its activity on fibrin. However, since its half-life in the blood is extremely short, large doses are required for thrombosis treatment, and as a result, side effects such as bleeding tendency have become a problem. chemical modification, enzymatic modification,
Many TPA derivatives with improved blood persistence have been invented using genetic engineering techniques and the like. However, although the persistence in the blood has been greatly improved, an extreme decrease in fibrin affinity, which is a characteristic property of TPA, has been observed, and it has not yet shown an excellent therapeutic effect. There are also cases where the enzymatic activity as TPA is significantly reduced due to modification. TPA derivatives that have improved fibrin affinity, which is a characteristic property of TPA, and activation ability by fibrin, and retain as much of the original properties of TPA as possible, can be expected to treat blood clots with smaller doses, and are expected to be developed. The significance is extremely large.

The present invention improves the fibrin affinity and activation ability by fibrin, which are the characteristic properties of TPA.
Novel glycosylated T with strong fibrinolytic ability
Based on the discovery of PA derivatives.

The present invention provides the TPA derivative, the ability to produce cultured animal cells that produce the TPA derivative, and a method for producing the TPA derivative using the cultured animal cell.

[Means to solve the problem]

TPA extends from the N-terminus to the finger region, growth factor region, kringle 1. Consists of five regions: kringle 2 and a region with serine protease activity (Penn le
a, D et al. (1983) Nature
) Volume 301, page 214). The kringle 2 region of TPA is said to be involved in TPA's fibrin affinity and activation by fibrin, but the function of the kringle 1 region is unclear, even from studies of deletion derivatives, and its Analysis was awaited. The present inventors have demonstrated that by imparting the fibrin affinity and activation by fibrin, which are the characteristic properties of TPA, to the kringle 1 region, the functions of the kringle 2 region, such as fibrin affinity and activation by fibrin, can be improved. A new TPA derivative with excellent fibrinolytic ability was further strengthened.

The present invention will be explained in detail below. The present invention relates to the production of TPA derivatives, and is achieved using genetic engineering techniques. Therefore, a DNA sequence encoding the amino acid sequence of TPA is essential for the production of improved TPA. Obtaining such a NA sequence can be accomplished using TPA
This can be achieved by cloning cDNA or chromosomal DNA, or by chemically synthesizing DNA into TPA cDNA, chromosomal DNA, or TPA amino acid sequence. TPA cDNA was prepared by Penn tea, et al.
D., et al. (1983) Nature.
Vol. 301, p. 214] has been isolated.

The amino acid sequence of TPA and the numbering for the cDNA followed what they proposed. TPA chromosome D
NA is Ny et al. (1984) Proceedings of the National Academy of Sciences.
of' the Nathlonal Academy
orScience USA) Volume 81, Page 5355]
and Brovn, M. J. et al. (1985) Gene vol. 33, p. 279 J. and Degen et al. (1986) The
Journal of Biological Chemistry (Th
e Journalor Biolod Real Chc
vistry) volume 261, page 6972] have been isolated. Numbering for exons of the TPA chromosomal gene follows Ei et al. The inventors
Cll transformed with the chromosomal DNA-based expression vector psVePA-1 (Japanese Patent Application Laid-Open No. 14783/1983)
mRNA was extracted from 0-Kl cells, and cDNA was synthesized and cloned. As described in Example 1, the expression vector psVecP^-1, which is the basis for producing TPA derivatives, was constructed using the newly obtained TPA cDNA and the chromosomal DNA contained in psVePA-1. The expression vector pSVeCP^-L has the SV40 viral early promoter upstream of the TPA gene in a form that allows the TPA gene to be expressed, and when introduced into animal cells, TPA or TPA derivatives are produced. Designed. Of course, as a promoter, SV
Anything other than 40 that can express the TPA gene may be used. The method for creating the above TPA derivative expression vector using the expression vector PSVeCPA-1 was described in detail in Example 2.

(Introduction of expression vector into cultured animal cells and creation of TPA derivative-producing cells) As a method for introducing DNA into animal cells, although there are differences in transfection efficiency, the calcium phosphate method “Wlgl
er, M. et al. (1977) Cell vol. 11, p. 233 J. Microinjection method (Ande.
Rson, L/F, et al. (1989) Proceedings of the National Academy of Sciences Nynisny (1'4 top) vol. 77, p. 5399]
Ribosome method, DEAE-dextran method or cell fusion method (5chorrner, W, et al. (1980) Proceedings of the National Academy of Sciences Ninnisny (ibid.) Vol. 77, 216
3 p.], the electric introduction method [Masaaki Tatsuie et al. (1987) Cell Engineering, Vol. 6, p. 494], etc. can be used. After introducing the TPA derivative expression vector into cells, a transformed strain can be obtained based on the traits acquired by an appropriate selection marker gene. As a selectable marker gene in animal cells, E
cogpt (Mullgaan, R.C., et al. (19
1980) Science, vol. 209, p. 1422), neo (Southern,
P, J, et al. (1982) Journal of Molecular and Applied Genetics
alor Molecular and Apphed
Genetics) Volume 1, Page 327], dhf
'r (Wigler, M., et al. (1980) Proceedings of the National Academy of Sciences Ninisny (ibid.) Vol. 77, p. 327) and the like are used. The TPA derivative expression vector is
Transformants can be obtained even if the selection marker genes are contained in the same plasmid or in separate plasmids. Whether or not the obtained transformed strain produces a TPA derivative can be determined by measuring the plasminogen activation activity contained in the culture solution of each transformed cell.

(Purification of TPA derivative) The TPA derivative producing strain can be cultured by a culture method depending on the animal cell line used as the host.

Recovery and purification of TPA derivatives from culture supernatants is carried out using CPG1 chelating Sepharose, Con-A Sepharose, ion exchangers, octyl Sepharose, chromatography on Sephadex gels, antibody column chromatography, electrophoresis, etc. can be done. Plasminogen activation ability was determined by a method using a plasminogen-containing fibrin plate (Hackle, M., et al. (1999).
1981) British Journal of Hematology (Brltlsh Journal or Hema)
47, p. 77) and a method for measuring the degradation of plasmin's synthetic substrate S-2251 (Allen,
R.A., and Pepper, D.S.

(1981) Thrombosis and hemostasis (
Throa+bos1s and l1aeIIlos
tasls) Volume 45, Page 43) CLT method (Gaff'n
ey, P.T., and CurtIs, A.D.

(1985) Thrombosis and hemostasis (
Same as above) Volume 53, p. 134) ELISA method (tlolvo
est, T. et al. (1985) Thrombosis and Hemostasis (ibid.) Vol. 54, p. 684].

(Evaluation of Thrombolytic Ability) The TPA derivative proposed by the present invention has properties related to thrombus dissolution, namely, fibrin affinity, fibrin dependence of enzyme activity, persistence in blood, plasminogen activation ability,
It has improved properties in some of the properties of in vitro clot resolution. Fibrin affinity can be measured according to a method using incorporation into a fibrin clot as an indicator.

(Collen, D. et al. (1988) Blood (
Bfood) volume 71, page 216]. In vitro thrombolytic ability can be measured by a method that uses as an indicator the release of radioactivity from 125I-buipurine. [Lar
-sen+G, R, et al. (1988) The Journal
Obbiological Chemistry (ibid.) vol. 263,
1023 pages]. Fibrin-dependent enzyme activity or plasminogen activation activity is caused by plasmin's synthetic substrate S.
Collen, D., et al. (1982) The Journal of Biological
Chemistry (ibid.) Vol. 257, p. 2912]. Regarding persistence in blood, see Beebe et al. [Beebe, D, P, et al. (1986) Thrombosis Research (ibid.) Vol. 43, p. 663] or Mattson et al. [Mattson, Ch, et al. (1983)].
Thrombosis Research (ibid.) Vol. 30, p. 91], and the blood half-life can be measured by the method described therein.

〔Effect of the invention〕

There are various factors that affect thrombolytic ability in vivo, such as buiprine affinity, activation by fibrin, plasminogen activation ability, protease resistance, inhibitor sensitivity, and persistence in blood. The novel TPA derivative provided by the present invention has improved fibrin affinity and plasminogen activation ability compared to natural TPA, and retains in vitro thrombolytic ability superior to natural TPA. It can be used to treat thrombosis such as infarction, and can improve currently attempted treatment methods.

〔Example〕

Examples are shown below, and experiments related to the present invention were conducted in accordance with the "1 Recombinant DNA Experimental Guidelines" established by the Prime Minister. In addition, phage plasmids, DNA,
For detailed operations involving various enzymes, Escherichia coli, etc., I referred to the magazines and books listed below.

1. Proteins, Nucleic Acids, Enzymes, Vol. 26, No. 4, (1981) Extra Edition Genetic Manipulation (Publication Edition 2, Genetic Manipulation Experimental Methods, edited by Yasutaka Takagi (1980) Kodansha 3, Genetic Manipulation Manual, edited by Yasutaka Takagi ( 198
2nd year) Kodansha 4, Mo1ecular Clonlng a 1
laboratory manual, T, manlat
Edited by ls et al. (1982) Cold Springl
labor Laboratory5, Metho
ds 1n Enzyo+ology, Volume 65, L, G
Edited by Rossmaa+ et al. (1980) Acadell I
lic Press6, Methods In En
Zymology, Volume 68, edited by R. Wu (1979)
^cadea+Ic Press Example 1 Creation of TPA expression vector psVecPA-L TPA expression vector psVecPA-1 was created through the steps described below.

(1) Creation of TPA cDNA clone pCH79 First, TPA expression vector psVec using chromosomal DNA
Cll introducing PA-1 (Japanese Unexamined Patent Publication No. 62-14783)
Total RNA was extracted from 0-Kl cells according to the known guanidine-hot phenol method.

Next, polyA mRNA was prepared by oligo-dT cellulose chromatography and subjected to molecular weight fractionation by sucrose gradient centrifugation to obtain a fraction containing TPA mRNA. This fraction was subjected to commercially available cDNA synthesis or KIBUTO (manufactured by Amajam) to synthesize cDNA, and commercially available λgtlO
A cDNA library was created using a cDNA cloning kit (manufactured by Amashaku). For this library, pSVeCP^-1 was digested with the restriction enzyme Xbal.
Using the approximately 2.5 kb fragment containing exons 10, 11 and 12, which had been cut and isolated as a probe, plaque hybridization was performed in a conventional manner to select positive phages. The resulting positive phage DNA was prepared, digested with the restriction enzyme HindIII (manufactured by Takara Shuzo Co., Ltd.), subjected to agarose gel electrophoresis, and subjected to Southern hybridization using the same Xball, 2, and 5 kb fragment used for cloning as a probe. Analysis was performed using the lysis method. As a result, the clones named 7 Cl contained H
It was found that it contained a probe-positive fragment that was cleaved with indIII to approximately 2.2 kb. This Hindl
After isolation of the lI approximately 2.2 kb fragment by agarose gel electrophoresis, ligation with pUc19 (manufactured by Takara Shuzo Co., Ltd.), which had been digested with the same <Hindm, using T4 DNA ligase,
E, coll DIrL was introduced to create pCH79. The base sequence of this cDNA part of pCH79 was converted to M13.
It was determined using a commercially available kit [manufactured by Takara Shuzo Co., Ltd.] using the method. Hind derived from the expression vector present at the 5' end
There is a recognition site for Bgl■ approximately 150 bp downstream from the m recognition site, and the base sequence is as follows: C at bp 584 is T and bpl 725 up to the stop codon TGA 1500 bp downstream.
Pennica et al. (Penn1ca,
D et al. (1983) Nature
301, p. 214], and furthermore, there was a Hindm site derived from the expression vector approximately 410 bases downstream from the TGA codon.

(2) Creation of TPA expression vector psVecPA-1
sVecP^-1 was created according to the procedure shown in FIG. psVesall (JP-A-62-1.4783
After cutting > with restriction enzyme Ncol (manufactured by Takara Shuzo Co., Ltd.),
An approximately 4.7 kb fragment that confers an origin of replication in E. coli and ampicillin resistance was isolated, and after circularization using T4 DNA ligase (manufactured by Takara Shuzo Co., Ltd.), E.
DIntroduced to old PSVeSall-Hi nd
m was created. Therefore, this vector contains an early promoter region containing the SV40 replication origin and a sequence containing the SV40 polyadenylation signal, sandwiching the Hindm recognition site. Next, pSVeSall
- Hin d I [After cutting I with Hindm, ps
TPA chromosomal DNA obtained by cutting and isolating VecPA-1 with HindIII and BglII (manufactured by Takara Shuzo Co., Ltd.)
Approximately 1.9 including all the second exon and part of the third exon of
kb fragment and pCH79) iindm and BglII
The approximately 2kb fragment containing TPA cDNA cut with T4
After ligation using DNA ligase, psVecPA-1 was created by introducing into E. coliD. This TPA expression vector psVecP^-t is derived from chromosomal DNA from the second exon to the third exon BglI [up to the recognition site, and the rest consists of cDNA, which encodes a gene that expresses natural TPA. .

Example 2 TPA derivative expression vector pscKM-2 and pSCK
Preparation of M-4 (1) Preparation of mutation introduction vector M13-NS As the first step for introducing amino acid substitution into the kringle 1 region, a mutation introduction vector was first prepared. Expression vector pSVeCPA-1 was added to the restriction enzyme Narl by New England Biolab Co., Ltd. and Smal (Takara Shuzo Co., Ltd.).
Co., Ltd.), and by agarose electrophoresis, approximately t
, tkb fragments were isolated. Additionally, M13mpH (Takara Shuzo Co., Ltd.) was cleaved with restriction enzymes Narl and Sma1. These approximately 1.1 kb fragments and M13mpH were combined with T4
After ligation with DNA ligase, it was introduced into E. col 1DH1 to produce M13-NS. This mutation introduction vector M13-NS encodes a cDNA corresponding to amino acid 110th glycine in the kringle 1 region of TPA to amino acid 508th proline in the protease region.

(2) Site-specific amino acid substitution reaction In order to introduce an amino acid substitution into the kringle 1 region, a single-stranded DNA was first prepared from the mutation introduction vector M1B-NS. Next, as a synthetic DNA probe used for site-specific amino acid substitution reaction, (a) 5'-TTCTGGGCCAACGCC
ATGCTGTTCCAGGGGGGTGCACTCGG
C-3' and (,b)5'-TGCTGCAGAACTCC
CAGCTGTACCTCCTCGCCTT^AAGA
By using this synthetic DNA probe prepared with the sequence CG-3', (a) asparagine at amino acid position 115 and serine at position 119 were converted to proline and methionine, respectively, and (b) amino acid position 161 was converted to proline and methionine, respectively. glycine at position, lysine at position 162, and serine at position 165,
Each can be substituted with arginine, arginine, and tryptophan. The N of this synthetic NA probe
The ends were phosphorylated using T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.).

Using the prepared Ml 3-NS single-stranded DNA and a synthetic NA probe for mutation, a site-specific mutation reaction was performed using a commercially available in vitro mutation system kit (manufactured by Amajam), and the resultant was introduced into E. coli TGI. Ml 3-N
5M2 and Ml3-N3M4 were produced. This Ml3
- Single stranded DNA from N8M2 and Ml 3-N5M4
was prepared and the mutations were confirmed using a commercially available kit using MIB (same as above). (a) Amino acid 11
The DNA sequence corresponding to asparagine at position 5 and serine at position 119 - AACTGGAACAGCAGC - corresponds to proline and methionine, respectively.
to GAACAGCATG-, and (b) amino acid 16
DNA sequence corresponding to glycine at position 1, lysine at position 162, and serine at position 165 - GGG^^GTAC
AGCTCA- is arginine, arginine,
and tryptophan -AGGAGGTACA
It was confirmed that it had mutated to GCTGG-.

(3) Preparation of TPA derivative expression vector pSCKM-2 and pscKM-4 TPA derivative expression vector pscKM-2 and pSC
KM-4 was produced according to the following procedure. First, Ml B-N8M2 and Ml3-N3M4 were digested with restriction enzymes Narl and Sma 1, and subjected to agarose electrophoresis. The lkb fragment was isolated.

Next, psVecPA-1 was combined with restriction enzymes Narl and Sma
1, and by agarose electrophoresis, approximately 7kb
fragments were isolated. Then, both of these fragments were transformed into T4DN
After ligation with A ligase, 1, E, and coll were introduced to produce pscKM-2 and pscKM-4.

Example 3 Creation of marker vector psV2neo-dhfr ps
V2neo-dhf'r was created using the following procedure. ps
V2dhrr (American Type Culture Collection rDNA Vectors 8714B) was cut with restriction enzyme PvuII (manufactured by Takara Shuzo Co., Ltd.), and Ba
mtll linker-d (pCGGATCCG) (
Takara Shuzo Co., Ltd.) after ligation with T4 DNA ligase E, c
psV2-dhrr was created by introducing psV2-dhrr into psV2neo (American Type Culture Collection rDNA Vec
tors 37149) to BamHL (Takara Shuzo Co., Ltd.)
After circularizing the cDNA cut using T4 DNA ligase, it was introduced into E.coliDtll to generate psV2ne in which the neo and dhfr genes were inserted in the same expression direction.
o-dhf'r was created.

Example 4 Introduction of TPA expression vector into cultured animal cells and production of TPA TPA expression vectors pscKM-2 and pSCKM-4
using CHO-Kl (ATCC, CCL-61) as a host, Cheno et al.
a, H, et al. (1987) Molecular and Cellular Biology.
e1lular Biology) Volume 7, Page 2745]
Transformation was performed according to the method of . That is, plasmid [TPA expression vector pscKM-2 or pSCKM
-4: pSV2neo-dhfr-10:1 (weight ratio)] - MD medium (MCDB3 (12: Dulbecco's modified MEM-1:1, Sigma ) (2×10 cells/10 ml medium/10(2) diameter culture dishes) and the medium was washed and refreshed after 15 hours.

For an additional 48 hours, the medium was supplemented with 800 μg/m 10418 sulfate (Gibco), 7ff1M ε-aminocaproic acid, 5
The medium was changed to MD medium containing 0 μM Foiban (Ono Pharmaceutical Co., Ltd.), and culture was continued for about 2 weeks to isolate a G418-resistant strain. The 6418-resistant strain was grown on the entire bottom of a 24-well multi-dish (Corning Inc.) and cultured in the above medium for 24 hours. Activity was measured using fibrin plates containing plasminogen (H
Ackle, M. et al. (1981) British Journal of Hematology.
volume 47, page 77].

Example 5 Selection and cultivation of the transformed strain with methotrexate (Mtx) The transformed strain of pscKM-2 or pscKM-4 obtained in Example 4 was placed in a culture dish with a diameter of 10 clI+ at 1×10 3 to 1×10 5 m (7) cells. Planted from 1100n to 1ooo
Culture was continued for about 2 weeks in MD medium containing nM Mtx, and a strain showing resistance to Mtx was isolated. Example 4 shows the amount of KM-2 produced by these resistant strains per 24 hours.
Measurements were made using the V-Prinn plate method as shown in . Table 1 shows the production strain cores of KM-2 or KM-4 obtained in Examples 4 and 5 and their titers. A strain exhibiting higher TPA productivity than the parent strain was obtained from the cells selected with M t x. These cells also produced TPA in MD serum-free medium (MD medium, 7mM ε-aminocaproic acid, 50μM Foiban 1mg/if bovine serum albumin 5μg/ml insulin).

Table 1 KM 2 and KM 4 producing strains Strain name TPA titer [μg/ml] M t x concentration (nM) (KM-2 producing strain) KM-2004 KM-2005 KM-2006 KM-2009 KM-2010 KM- 2012 KM-2013 KM-2014 KM-2015 KM-2100 KM-2101 KM-2102 KM-2800 KM-2601 KM -2ff03 0.22 0.18 0.16 0.16 0.24 0.18 0.10 0 , (6 0, (9 1,00 0,40 0,44 (,60 0,95 0,38 00 00 00 00 00 00 (KM-4 production strain) KM-4003 KM-4004 KM-4005 KM-4006 KM-4007 KM-4012 KM-4013 KM-4014 KM-4015 KM-4101 KM-4102 KM-4to 3 KM-4104 KM-4105 KM-4106 KM-4109 KM-4801 KM-4805 KM-4808 0,55 0 ,30 0,80 0,22 0,17 0,I4 0.18 0.25 0.18 0.32 0.25 0.29 0.85 1.20 1.30 0.53 0.80 0゜90 0.90 00 to 0 00 00 00 00 00 00 00 00 Example 6 Recovery and purification of KM-2 and KM-4 The steps for recovery and purification of TPA derivatives KM-2 and KM-4 are shown below. During the process For the detection of TPA antigen, a commercially available ELISA kit (IMUBINDTPA ELIS
A KIT (manufactured by American Daigutsu Stayka) was used. KM-2601 strain or KM-4801 in Example 5
KM-2 or K
A culture solution containing M-4 was charged onto a CPG-10 (manufactured by Electronucleonics) column equilibrated with a 20+M phosphate buffer (pH 7,5) containing INNact and 50 μM Foipane, and used for equilibration. Washed with the same buffer.

Almost no KM-2 or KM-4 was detected in the culture solution and washing solution that passed through the CPG-10 column. C
KM-2 and KM-4 were LM N from a PG-10 column.
aCI, 0.5M KSCN, 20mM containing IMε-aminocaproic acid and 50μM Foipan
Elution was performed with phosphate buffer (pH 7.5).

The eluate was directly mixed with IM NaCl, 0.01% Tve.
ConA-8e equilibrated with 201M phosphate buffer (pH 7,5) containing en80 and 50uM Foiban
A pharose (manufactured by Pharmacia) column was charged. After washing with the same buffer used for equilibration, 2MK
SCN, 0.4M α-methylmannoside, 0
．． Elution was performed with 20 mM phosphate buffer (pH 7.5) containing 01% Tveen 80 and 50 μM Foipan.

When the TPA antigen contained in the passage culture solution, washing solution, and eluate of ConA 5epharose was detected using ELISA, it was found that most of KM-2 and KM-4 were adsorbed to ConA 56plHrose and were eluted and recovered. Ta.

When the TPA protein contained in the same eluate was measured by ELISA method, KM-2 and KM-4 were compared to KM-26.
Culture of 01 strain and KM-4801 strain: approx. 5, OL, approx. 6
．． From OL, 12.3B and 4. It was found that lff1g was recovered and purified.

EXAMPLES In vitro Fibrin Affinity The in vitro fibrin affinities of KM-2 and KM-4 were determined by the method of Koren et al. (ibid.). 50
o+M Trls HCI (pH 7,4), 0.03
8M NaCl, 0.1% Tween 80. 1o
+g/ml BSA, 0.1 μg/ml TPA
and human fibrinogen is 0, OLmg/at
-4 lag/if, human thrombin was added to give 20 NIHunlts/if, and the mixture was incubated at room temperature for 10 minutes. And 15. ooOrpa
The supernatant was separated by centrifugation for +3 minutes. Its activity is S
-2251, and the results are summarized in FIG. Although KM-4 showed a fibrin affinity comparable to that of natural TPA, KM-2 was found to have a much stronger in vitro fibrin affinity than natural TPA.

Example 8 In vitro plasminogen activation ability measurement KM-2
The in vitro plasminogen activation ability of KM-4 was measured by the method of Koren et al. (ibid.) using a synthetic substrate of plasmin, S-2251. 0.1M Tr
ls HCI (pH 7,5), 0.1% Tvee
n80. 0.3 iM S-2251, O, 1 mg human fibrinogen (digested with bromo cyanide).

1 ng/III TPA and 0.04 u g/II+I of glutamic acid type plasminogen.
~25 ug/rAI at 25°C,
After 3 o'clock incubation, the absorbance at 405 nm was measured. The results are summarized in Figure 3. It was found that KM-2 and KM-4 have a stronger ability to activate plasminogen in vitro than natural TPA.

Example 9 In vitro thrombolytic ability measurement The in vitro thrombolytic ability of KM-2 and KM-4 was measured by partially modifying the method of Larsen et al. (ibid.). 50
μg/ml human glutamate type plasminogen, 0. IMNaCl, 5% in 10IIIM phosphate buffer (pH 17,2) containing 0.01% Tween 80
After dissolving human fibrinogen to a concentration of B/ml, remove human thrombin and add it to a concentration of 0NLHunit/ml, and add 100 μl to a 96-well multi-dish.
The fibrin clot thus prepared was overlaid with a 100 μm enzyme solution and allowed to react at 37°C for 3 hours.

After the reaction, the absorbance at 405na+ of each well was measured,
The results are summarized in Figure 4. KM-2 and KM-4 were found to have stronger in vitro thrombolytic ability than native TPA.

Example 10 Measurement of half-life in blood of KM-2 and KM-4 Concerning persistence in blood, Behbe et al. (ibid.) or Mattsson et al.
The half-life in blood was measured by the method described above). purified K
300 μg of M-2 or KM-4 was administered to rabbits once through the auricular vein, blood was collected over time, and the TPA concentration in the blood was measured by ELISA. As a result, the blood half-life in rabbits was determined to be approximately 4 minutes for KM-2 and approximately 2.5 minutes for KM-4. (Figure 5)

[Brief explanation of the drawing]

Figure 1 is a diagram showing the construction of TPA expression vector pSVeCPA-1, Figure 2 is a graph showing the fibrin affinity of native TPA and KM-2 and KM-4, and Figure 3 is a graph showing the fibrin affinity of native TPA and KM-2 and KM-4.
A and a graph showing a comparison of the plasminogen activation ability of KM-2 and KM-4. FIG. 4 is a graph showing the in vitro fibrin clot dissolving ability of natural TPA and KM-2 and KM-4. FIG. 5 is a graph showing the persistence of natural TPA and KM-2 and KM-4 in the blood in rabbits.

Claims (11)

[Claims] (1) A tissue plasminogen activator derivative in which asparagine at amino acid position 115 and serine at position 119 are replaced with proline and methionine, respectively. (2) A tissue plasminogen activator derivative in which glycine at amino acid position 161, lysine at position 162, and serine at position 165 are replaced with arginine, arginine, and tryptophan, respectively. (3) The plasminogen activator derivative according to claim 1 or 2, which is produced in a transformed cultured animal cell. (4) The plasminogen activator derivative according to claim 3, wherein the cultured animal cells are CHO-K1. (5) A DNA sequence encoding the plasminogen activator derivative according to claim 1 or 2. (6) The DNA sequence is a part of cDNA and chromosomal DNA
6. The DNA sequence according to claim 5, consisting of a portion of. (7) The DNA sequence according to claim 6, wherein the region from the second exon to the BglII recognition site of the third exon is chromosomal DNA, and the region downstream from the BglII recognition site is cDNA. (8) D according to any one of claims 5 to 7, which encodes the plasminogen activator derivative of claim 1 or 2.
Cultured animal cells transformed with an expression vector containing an NA sequence. (9) The cultured animal cell according to claim 8, wherein the cultured animal cell is CHO-K1. (10) Cultivating cultured animal cells transformed with the expression vector containing the DNA sequence according to any one of claims 5 to 7 to produce a plasminogen activator derivative, and collecting the plasminogen. Method for producing activator derivative. (11) Claim 10 wherein the cultured animal cell is CHO-K1.
A method for producing the described plasminogen activator derivative.