JPH03112487A - Hla-bw 53 gene, dna probe and transforming cell - Google Patents

Abstract

PURPOSE:To obtain HLA-Bw53 gene to manifest an antigen useful for judging propriety of colonization of transplant in organ transportation by transducing human eukaryocyte, containing exon having a specific base sequence. CONSTITUTION:HLA-Bw53 gene containing an exon having a base sequence shown by the formula (A is adenine, C is cytosine, G is guanine and T is thymine). cDNA partially coincident with the base sequence of this gene can be made into a DNA probe which labels a marker substance and is used for DNA typing.

Description

Detailed Description of the Invention [Field of Industrial Application] The present invention relates to the HLA-Bw53 gene, DNA probe, and transformed cells, and particularly relates to HLA-Bw53 gene, DNA probe, and transformed cells.
+an Ieukocyte antigen) -B
DNA encoding the allotype of the W53 antigen, a DNA probe used to extract and identify the patient's class I gene itself in DNA typing, and the DNA of the present invention can be introduced into non-human eukaryotic cells. This invention relates to transformed cells expressing an allotype of HLA-Bw53 antigen on their surface. HLA-Bw53
Cells expressing alloantigens can be administered to animals as immunogens, so they are useful for developing monoclonal antibodies specific to the HLA-Bw53 antigen. Furthermore, by introducing the gene of the present invention into human eukaryotic cells, HLA-B
Cells expressing w53 antigen are useful as panel cells (panel cal!) used to determine the specificity of antiserum.

[Conventional technology]

During human organ transplantation, HLA antigens play an important role in transplant immunity as antigens that determine whether or not the graft will take hold. Among these, class I antigens are involved in antigen recognition by cytotoxic T cells in cell-mediated immunity, and are also involved in psoriasis vulgaris (m<cW6), chyme (AIO), and herpes herpes (A29).

Significant correlations with diseases such as Behcet's (B57) have been revealed. (Ozawa, A, , 0hk
ido.

M, +Tsuji+, J, Am, Acad, Derm
ato1+1.205.1981) HLA antigens are also called major histocompatibility antigens because they are closely related to rejection phenomena and transplant immunity, and the gene group encoding them is called the major histocompatibility gene complex (MMC).

HLA is human MMC, and HLA class I antigens are membrane proteins present on cell membranes, and are controlled by three gene loci, A, B, and C. Class I antigens have a structure in which a glycoprotein (α chain) with a molecular weight of 144 kd is associated with a protein (B2-microglobulin) with a molecular weight of 12 kd through non-covalent bonds, and the α chain is located on the N-terminal side located outside the cell, and B1. There are three domains, B2 and B3, followed by a region embedded within the cell (transmembrane).
ane Region), a region located within the cell (c
ytoplasmic domains) are lined up.

B2-microglobulin consists of one domain, α
attached to a chain.

The HLA gene region exists over a distance of 2.5 centimorgans (cM) on the short arm of human chromosome 6, and extends from the centromere side to the class II Sff region (1, OcM) and the class I [[jJtJ! 1i (DR-B = 0.7cM)
, class I eI range (0,8c M ).

(Jordan, B.R., et al., Immunol
, Rev., 84.73+1985) Methods for testing HLA class I antigens include serological methods and recombinant DNA
There is HLA-DNA typing using A technology.

As a serological method, the complement-dependent cytotoxicity test (T
erasaki, P, 1. , and McCall
and, J.D.

Nature (London), 204. pp9
98-1000.1964) is the standard method.

This method uses alloantiserum and uses rabbit serum as complement to detect lymphocyte cytotoxicity (lymphocytotoxicity).
), but the antiserum is an alloserum from a pregnant woman with multiple births, and the antiserum shows cross-reactivity.
It is difficult to obtain antibodies that react monospecifically with class I allotypes, and since antisera are obtained from humans, it is impossible to provide a stable supply of serum with reproducibility. Since it is not available, there is a desire to develop monoclonal antibodies to replace allo-serum.

Approximately 150 monoclonal antibodies were submitted at the 1984 International Histocompatibility Workshop. (
Pauchet.

R,,Bonder+J,G,,Kennedy,L,
J, et al.: HL AA, B, Cmono
clonal antibodies, Hist.

Compatibility Testing 198
4 (Albert, E. D.

Baur+ M, P,, Mayr, W, R, ed.)+
Springer-Verlag.

Berlin, Heidalberg, New York
rk, Tokyo: 211.1984) Anti-HLA monoclonal antibodies can generally be produced by fusing mouse myeloma cells with tile cells obtained by immunizing a mouse with human lymphocytes. (Of+V,T
, +Herzenberg, L.A.: Immunog.
lobulin-producing hybrid
cell 1ines.

5 selected 5 methods in Immun
However, to date, among the monoclonal antibodies suitable for HLA typing, for example, monoclonal antibodies against the allotype of HLA-B antigen, Bw4, 3w6.
゜B7. B8. B13. Currently, only monoclonal antibodies that monospecifically bind to B27 have been obtained, and the development of monoclonal antibodies that have monospecificity to many other allotypes is expected. Furthermore, there are many alloantigens for which even reactive monoclonal antibodies have not yet been obtained. For such alloantigens, monoclonal antibodies that have cross-reactivity with other alloantigens are also effective. Recently, further improvements have been made in methods for producing anti-HLA monoclonal antibodies.

In the antibody production method using peripheral lymphocytes, which are dominated by human TIJ lymphocytes, as an immunogen, there are many human-derived antigens, so this method is effective against many antigenic sites other than the target HLA allotype antigen. This is an improvement in the ability to obtain monoclonal antibodies that show reactivity, and it is possible to obtain transformed cells by introducing a human HLA antigen gene clone into eukaryotic cells derived from an immunized animal and administering the transformed cells to the immunized animal. This is a method for obtaining tile cells that efficiently produce monoclonal antibodies against human HLA antigens expressed on the human cells. (Monoclonal antibodies to
HLA-DP-transfectedmo
use L cell: Proc, Natl, A
cad, Sci, tlsA+83, pp 341
7-3421.1986) For cases where antiserum or monoclonal antibodies specific to HLA class I antigen allotypes have not been obtained, DNA typing is an effective testing method. Qianliao vulgaris is an HLA class! It is known as a disease that shows a very high correlation with the antigens 0w6 and 0w7.
recent advances in HL A
and 5kindeases, J, Am, Aca
d, Dermatol, 4+ 205+1981)
Therefore, Ozawa et al.
odoyer, R. et al., Complete
nucleotide sequence of a
gene encoding a function
alhuman class I histo com
compatibility antigen (HLA-Cw
3), EMBOJ, 3; 879.1984
) DNA typing was performed on 121 patients with common psoriasis FF and 16 healthy individuals with 0w6°0w7 using the Pvu U fragment of 0w6°0w7 as a probe. (Ozawa.

A, et at: D N A typing
in psoriasis Vulgaris, In:
Proceeding of the 3rd A
s1aOceania H3stocospatibi
lity Workshop and Conference
ce+ in press) As a result, the signal sequence,
Pvu I corresponding to part of α1 domain α2 domain
A patient-specific band was detected when the I 1.7 kb fragment was used as a probe.

[Problem to be solved by the invention]

Conventional techniques have not been able to obtain many isolated HLA genes whose nucleotide sequences have been specified, which has limited the usefulness of HLA antigen allotype analysis and DNA typing. In addition, there were few good immunogens for producing anti-HLA monoclonal antibodies.

The present invention was made in view of these circumstances, and aims to provide a novel HLA-Bw53 gene, a DNA probe, and transformed cells.

[Means and effects for solving the problem] The inventor is HLA
As a result of continuing research on the subject, we succeeded in isolating the HLA-Bw53 gene and completed the present invention.

The HLA-Bw 53 gene of the present invention has an exon represented by the following base sequence.

ATGCGGGTCACGGCGCCCCG^8CCG
TCCTCCTGCTGCTCTGGGGGCAGT
GGCCCTGACCGAGACCTGGGCCGGC
TCCCACTCCATGAGGTATTTCTACA
CCGCCATGTCCCGGCCCGGCCGCGG
GGAGCCCCGCTTCATCGCAGTGGGC
TACGTGGACGACACCCAGTTCGTGA
GGTTCGACAGCGACGCCGCGAGTCC
GAGGACGGAGCCCCGGGCGCCATGG
ATAGAGCAGGAGGGGCCGGAGTATT
GGGACCGGAACACACAGADINGCTTCAA
GACCAACACACAGACTTACCGAGAG
AACCTGCGGATCGCGCTCCGCTACT
ACAACCAGAGCGAGGCCGGGTCTCA
CATCATCCAGAGGATGTATGGCTGC
GACCTGGGGCCCGACGGGCGCCTC
TCCGCGGGCATGACCAGTCCGCCTA
CGACGGCAAGGATTACATCGCCCTG
AACGAGGACCTGAGCTCCTGGACCG
CGGCGGACACCGCGGCTCAGATCAC
CCAGCGCAAGTGGGAGGCGGCCCGT
GTGGCGGAGCAGCTGAGGGCCTACC
T GAGGGCCTGTGCGTGGAGTGGCT
CCGCAGATAACCTGGAGAACGGGAAG
GAGACGCTGCAGGCCGCGGACCCCCC
CAAAGACACAGCTGACCCACCACC
CGTCTCTGACCATGAGGCCACCCTG
AGGTGCTGGGCCCTGGGCTTCTACC
CTGCGGAGATCACACTGACCTGGCA
GCGGGATGGCGAGGACCAAAACTCAG
GACACTGAGCTTGTGGAGACCAGAC
CAGCAGGAGATAGAACCTTCCAGAA
GTGGGCAGCTGTGGTGGTGCCTTCT
GGAGAAGAGCAGAGATACACATGCC
ATGTACAGCATGAGGGGCTGCCGAA
GCCCCTCACCCTGAGATGGGGAGCCA
TCTTCCCAGTCCCACCATCCCCATCG
TGGGCATTGTTGCTGGCCTGGCTGT
CCTAGCAGTTGTGGTCATCGGAGCT
GTGGTCGCTACTGTGATGTGTAGGA
GGAAGAGCTCAGGTGGAAAAGGAGG
GAGCTACTCTCAGGCTGCGTCCAG
GACAGTGCCCAGGGCTCTGATGTGT
CTCTCACAGCTTG^ In the above base sequence and the base sequence described in Claim 1 Detailed Description of the Invention of this specification, A is adenine,
C represents cytosine, G represents guanine, and T represents thymine.

A cDNA that matches a part of the base sequence of the HLA-Bw53 gene of the present invention can be labeled with a marker substance and applied to a DNA probe used for DNA typing. The marker substance is peroxylase. Iron porphyrin derivatives, luminescent substances such as luciferase, fluorescent substances, 2.
Phosphorescent substances such as 3-butadione and sz p , s
Radioactive materials such as S3 are commonly used. These marker substances and the method of labeling one MDNA with a marker substance are well known.
Biophys. Bioeng, pp175-195
．． (1981).

Rigby et al., J. Mo1. Biol...
113,237. (1977)) This HLA-Bw53
Since the gene encodes the HLA-Bw53 antigen, transformed cells expressing the HLA-Bw53 antigen can be obtained by introducing the gene into eukaryotic cells.

〔Example〕

The present invention will be explained based on examples.

Isolation of chromosomal DNA of HLA-Bw53 HLA-Aw68/Aw68, Bw53/Bw53. C
It has a pablo type of w4/Cw4 and is infected with EB virus (E
5×10 cells of the human B cell line AMAr transformed with pstein Barr Virus were suspended in 10 d of phosphate buffered saline (PBS) and centrifuged at 1500 rpm. The supernatant was discarded, the cells were resuspended in 1o-PBS, centrifuged at 1500 rpm+, and the supernatant was completely removed.

Next, AMA I cells were incubated with 2-LST buffer (20mM
Tris solution P H7,4,10mM NaCl1,3
+ nMMgCIg) and centrifuged at 1500 rp-, and the supernatant was removed.

5% 5ocose + 4% NP −4 cooled to 4°C
AMA I cells were suspended and left for 5 minutes. Then, centrifuge at 1500 rpm, remove the supernatant, and cool 5d ACE buffer (50mM
Sodium acetate (If)wMEDTA) was added and stirred. After adding 0.5-10% SDS solution, 5d phenol solution was added and shaken for 4 minutes. After that 2000r
Centrifuged at pm for 10 minutes and placed the upper layer into a new test tube.

Add the same amount of chloroform solution as the upper layer solution to this test tube 4
After shaking for a minute, it was centrifuged at 2000 rpm for 10 minutes, and the upper layer was placed in a new test tube. Slowly add twice the amount of 99% ethanol to the test tube with the upper layer removed and mix.
30μ of human chromosomal DNA separated from A into threads
g was incubated with restriction enzyme EcoRI 90 units (U) at 37°C for 3 hours. Human chromosomal DNA cut with EcoRl was added to the end of a 0.8% agarose gel and electrophoresed to detect DNA in the range of 6.0 kb to 8.5 kb.
The fragments were separated using the DE paper separation method to obtain HLA class II genomic DNA.

Creation of genomic DNA library Add 2 gg of λ phage arm (λZAP treated with EcoRI) to 0.4 gg of isolated human DNA.
T4 ligase was added and incubated for 18 hours at 4°C to allow binding. This sample was prepared using a puff caging kit (Gigapack-gold: Stratagene).
It was packaged using in vltro using the following technology: To confirm whether puff caging was successful, the titer of the packaged phage samples was examined using the following procedure.

(Measurement of sample titer) Take a small amount of L E 392E coli and add 40 d of L
B medium (15 g of NaC, 5 g of yeast extract.

10 g of tryptone dissolved in 1 fLO) was placed in a 50111 centrifuge tube and cultured with shaking at 37°C overnight. 1 d of cultured bacterial medium was added to the centrifuge tube, followed by 3 i of LB medium and 80 M1 of IMMgSOa. A dilution series of 2 uffi (stock solution, 10-fold diluted solution, 100-fold diluted solution, ioo.

The diluted solution was added to a 6-fold test tube and incubated at 37°C for 15 minutes. 0.7 of 2.511dl kept at 45℃
After adding % soft agar to each test tube and mixing,
layer on a 1.5% agar plate. After culturing at 37°C for 8 hours, the number of plaques was counted.

Cloning of HLA class I genomic DNA 9 (1 mm
The stock solution of the library was mixed in 3M medium (NaC115.8g, Mg5O
a 7H*0 2g, 50d IMTrisCl
pH7,5,5m 2% gelatin 12H80
diluted with diluted solution, ). - The next screening was carried out using the same procedure as for determining the titer of the samples described above.
Phage plaques were formed on the 1a dish. A nitrocellulose membrane (manufactured by Ge1s+anScience) was placed on the soft agar layer and left for 5 minutes.Next, the nitrocellulose membrane was soaked in denaturet I solution (0.1 M NaOH, 1.5
Next, a nitrocellulose membrane was placed on a chromatography paper containing 2x SSC solution and left for 5 minutes. The nitrocellulose membrane was dried at room temperature.

Finally, the plotting was completed by leaving it in a vacuum dryer at 80° C. for 120 minutes.

HLA-B7 cDNA used in hybridization
A probe was prepared as follows.

HLA-B7cDNA1340bp (
Orr H, T, etal HBiochea+1st
ry, 1B, 5711.1979) is Pstlsit
Plasmid pI) poo contained in PBR32B in e
(Dr. Jelsman, Yale University
site) was cut with Pstl, electrophoresed on agarose gel, and extracted with 1340bp HL using the DE paper method.
A-B7 cDNA isolated 0 isolated HLA-B7c
200 ng of DNA was labeled with LicoIP-dCTP by the unidirectional translation method. Sephadex 0 was used to separate labeled cDNA and unbound P-dCTP.
50 column and collected the first peak with radioactivity.

The HLA class I gene was cloned using the following procedure.

The nitrocellulose membrane on which the phage library was blotted was placed in a hybridization bag. Prehybridization solution (50x Denhar
dt's 5solution 0.8m+101dPo
r101dPor, 0.2yd 10% S D S
, 0.5d of 411g/ll11 salmon sperm DNA,
6. fl+d 20x SSC, 1,91d! )(go)
The HLA-B7 cDNA probe of @2Xl0I'cps and 0.5 m of 4/- salmon sperm DNA were placed in a glass test tube and heated for 1° in a 100°C water bath. After that, it was rapidly cooled in ice. Add 0.8d of 50x Denhardt'5 solution to this glass test tube.

10d formamide, 0.2d io%SD
S, 6.6d 20x SSC solution, 50% D of 2d
A mixture of extran 5ulfate was added to prepare a hybridization solution. Discard the prehybridization solution from the hybridization bag, add hybridization solution, and seal the bag.
Incubated at °C for 18 hours. Take out the nitrocellulose membrane from the bag and add 2x SSC, 0.1% SDS.
Wash at 37°C for 30 minutes x 2 times with a washing solution consisting of
After washing twice for 30 minutes at 2°C, the nitrocellulose membrane was dried. Dry nitrocellulose membrane -hatIl
After fixing on an 3 MM filter paper and placing in an X-ray film cassette and exposing to X-ray film for 3-1111 hours, the film was exposed. 61 positive plaques that appeared as black dots! After confirmation, the positive plaque was removed from the 90 m dish with a pipette, placed in a 1,5-centrifuge tube containing ldSMll solution, and incubated at 37°C for 1 hour.
After centrifugation for several seconds at m, the supernatant was used as phages for secondary screening.

The supernatant was diluted with 3M medium to yield 100-500 plaques on a 90M dish, and then plotted on a nitrocellulose membrane in the same manner as the primary screening.
Hybridization was performed using the LA-B7 cDNA probe and positive plaques were taken.

Pipette the positive plaques obtained in the secondary screening and use 1afsM medium! After placing the tube in a 5i centrifuge tube and incubating it at room temperature for 1 hour, add a few drops of chloroform and centrifuge at 1500 rpm for a few seconds. The supernatant after centrifugation was used as a phage for the tertiary screening, and the screening was performed in the same manner as the secondary screening. It was confirmed by hybridization that all the plaques were positive plaques, and the cloning was completed.

Purification of DNA The genomic gene incorporated into the λ phage obtained in the tertiary screening was converted into a plasmid using a helper phage by the following procedure. A λ phage clone was taken from the tertiary screening plate and mixed with 500 p7 of 3M medium and 20
It was mixed with pl of chloroform to prepare a λZAP solution. Add 200uZ(7)λZAP solution to a centrifuge tube and Loaf (
7) I X 10" pfu/d concentration no R408 helper 77-di and 200#j (7) 8 X 10 pieces/
I11 X L I Blue E and coli were mixed and incubated at 37° C. for 15 minutes. Next, add 5I to this centrifuge tube! YT medium (5 g Na
CI, 5g Yeast Extract, 8g
Bact.

-Trypton dissolved in water from Step 11) is added,
It was shaken at 37°C for 4 hours.

Next, after heating at 70°C for 20 minutes, the centrifuge tube was heated at 100°C.
Centrifugation was performed at 0 g for 5 minutes. Transfer the supernatant to a new tube,
In this test tube, 200,111 8X10” pieces/d
L1-Blue E and coli were added and incubated at 37°C for 15 minutes. 100 p7 of solution in this test tube
was poured onto an ampicillin plate and left at 37°C overnight. The next day, a colony was taken and placed in LB medium containing ampicillin and shaken overnight at 37°C.Next, this culture solution 5Id was added to 400 m of LB medium containing ampicillin and incubated at 37°C.
So OD A. . The culture was carried out with shaking until the temperature reached -0.8. 2d
Add 34■/d chloramphenicol and add 37
The cells were cultured at ℃ for 12 hours.

Next, transfer this culture solution to a centrifuge tube and spin it at 5000rps+ for 1 hour.
The mixture was centrifuged for 0 minutes and the supernatant was discarded. Add 40% of 0.0% to this centrifuge tube.
1M -N a C1, 10o+M Tris-HCI
(pH7,8), 1 a+M1! After adding DTA to suspend the precipitate, it was centrifuged at 5000 rpm for 10 minutes and the supernatant was discarded. A 7m glucose-lysozyme solution was added to the centrifuge tube to resuspend the precipitate, and the tube was left at room temperature for 10 minutes. Furthermore, add 14ml alkaline solution to the centrifuge tube,
It was left for 10 minutes while cooling with water. Next, a 10.5 d potassium acetate solution was added, stirred, and then left in water for 10 minutes. This centrifuge tube was centrifuged at 150 rpm for 20 minutes at 4°C, and the supernatant was transferred to a new 50-centrifuge tube. Add 0.6 volume of isopropyl alcohol to this, mix, and then
Leave it for a minute. This centrifuge tube was centrifuged at 3000 rpm for 10 minutes and the supernatant was discarded. After adding 100% ethanol to this centrifuge tube and drying the precipitate, 3.5 d of TE buffer (10mM Tris C1, 1mM EDTA pH
8, o) was added to dissolve the precipitate. This DNA solution 3.
For 5i, 3.7g CsC1,0,2d 11
An aqueous solution of 0ff1/-ethidium bromide was added to completely dissolve the cesium chloride. The resulting solution was transferred to a sealed tube, the tube was filled with 50% (w/w) cesium chloride solution, and the opening was sealed. Seal tube 1
Plasmid DNA was separated by centrifugation at 5'C55000 rpm for 15 hours. This plasmid DNA layer was collected with a syringe, and an equal amount of n-butanol saturated with water was added and mixed. It was centrifuged at 3000 rps for 1 minute and the upper layer was discarded. This operation was repeated three times to remove ethidium bromide. Next, the plasmid DNA was dialyzed against TE buffer overnight to purify the DNA.

The HLA class ■ Genomic DNA cloned by tk-
The gene was introduced into mouse L cells, and its expression on the cell surface was examined using an anti-HLA class I antibody.

Introduction of HLA class I gene into mouse L cells On the day before gene transfer, 5×10′ mouse L cells were placed in a culture flask and cultured in MEM medium containing 10% FC3.

A precipitate was prepared by the Ca-phosphate precipitation method using the following procedure.

(a) 20ug/100μi of HLA class I genomic DNA, 1ug/100111 of the Chimidji 7 kinase gene, and 100! jj! CaC1,・2H
*0 solution pH 7.0 and 700 μl of Ht 2 O were concentrated and the total amount was 1-.

(b) Hepes/NaCl solution and 100x NaH
PO, solution was mixed at 49:l and the solution was placed in a 61n1 test tube.

(c) Pour the solution prepared in (a) one drop at a time into the test tube in (b), mix and incubate for 20 minutes)LCa-D
A NA precipitate was created.

Mouse L cells cultured on the previous day were washed once with Ca-free PBS, and Ca-DNA precipitate was added to the cells for 1 hour in a flask.
Incubated for 5 minutes.

Furthermore, MEM medium containing 10% fetal bovine serum (Fe2) was added and incubated at 37°C for 6 hours in a CO incubator.Next, a 34% PEG-5% DMSO solution was prepared using a FC3-free medium. After removing the medium in the flask, add 2yd of 34% PEG-5% DMS.
O solution was added and incubated for 3 minutes. After washing three times with a FC3-free medium and twice with a medium containing 10% FC3, 10 d of a medium containing 10% FC3 was added and cultured overnight. The next day, the medium was changed to HAT medium and cultured. 2～
HAT medium was replaced every 3 days.

After about 14 to 21 days, it was confirmed that the cells proliferated and formed colonies after the tk gene was introduced. After each colony was picked using a cloning ring, each clone was cultured.

Confirmation of HLA class I antigen expressed on transformed cells Wash each cloned colony IXIO' twice with PBS and suspend it in 100 μl of PBS,
Pour each into two test tubes. 50p1 anti-HLA class in two test tubes! Monoclonal antibody W 6/32
(Parham P et al, J, rmmuno
l.

(1979), 123. pp342-349)
and 50 μl of anti-HLA-DR monoclonal antibody L
243 (Lampson LAet al, J, Im
Munol, (1980), 125. PI) 293-2
99) were added separately and incubated at 4°C for 30 minutes. Add 0.5-PBS to each test tube and
Centrifuge for 1 minute and remove the supernatant. This was repeated three times. 50 times diluted FITC anti-mouse Ig antibody (5llen
(manufactured by US) was added to each test tube and incubated at 4°C for 30 minutes. Add 0.5d PBS to each test tube and add 1
The procedure of centrifuging at 500 rpm for 5 minutes and removing the supernatant was repeated three times. Finally, 1 dPBS was added to each test tube and the fluorescence intensity was measured using Spectrum ■ (manufactured by Ortho).

HLA class on L cells! Cells expressing antigens are
The fluorescence intensity of the W6/32 antibody is stronger than that of the L243 antibody, and expression can be confirmed.

By the above method, transformed cells into which HLA class ■ genome gene clone 34.1 obtained from AMA I cells were introduced were transformed into HLA class ■ genome gene clone 34.1 obtained from AMA I cells. It was confirmed that the antigen was expressed.

The restriction enzyme genetic map of clone 34.1 was compared with the genetic maps of other HLA-85 cross-reactive groups. BcoRI of clone 34.1.

The Xbal, BamHr, 5teaI fragments are HLA-B51, Bw52. It was the same as B35.

On the other hand, the Puv U fragment of clone 34.1 is H
Same as LA-B 35 but different from other HLA-B5 cross-reactive groups. Therefore clone 34.
1 is strongly (suggested) to be the HLA-Bw53 gene.

Allo clone 34.1 of loan 3 was used together with the hygromycin resistance gene to form a B lymphoblastoid cell line Hmy2cIR (J, Exp, Med) that does not express HLA-A, B antigens.

166, pp283-288. (1897)), and transformed cells were obtained using hygromycin B medium.

These transformed cells were further cultured, and flow cytometry using the W6/32 monoclonal antibody revealed that clone 34.1 transformed Hm expressed a high level of HLA class I antigen, the gene product of clone 34.1.
The y2CIR cell line was obtained.

By the same method, the HLA-835 gene was transformed into Hmy2C
A B35-transformed y2CIR cell line expressing HLA-835 antigen was obtained by introducing into IR.

The alloantigenicity of this clone 34.1 transformed cell line Hmy2CIR was examined by a complement-dependent cytotoxicity test.

Antiserum AO with specificity for HLA-B35, Bw53
H223 and other various antisera listed in Table 1 were previously dispensed in 1 pl into each well of the Micro Roblate.Next, 1 pl of 3×10'/1 target cells was dispensed into each well. Incubated for 30 minutes at room temperature.

Next, 5 pI/well of rabbit complement was dispensed into each well and allowed to react at room temperature for 60 minutes.Next, 2 pl/well of a 5% eosin aqueous solution was dispensed into each well and allowed to stand at room temperature for 5 minutes. F3pl/well of 37% formaldehyde was added to each well to stop the reaction and fix the cells. 30 at room temperature
After standing for a minute, the cells were observed under a microscope and the percentage of positive cells to total cells was determined. The results are shown in Table 1. The target cells were a cell line transformed by introducing clone 34.1 into Hmy2CIH, a cell line transformed by introducing HLA-B35 gene into Hmy2CIR, and a non-transformed cell line. The Hs+y2 CI B111 cell line was used as a negative control.

Clone 34.1 B35 *: Non-transformed Hmy2CIR Table 1 From the above results, clone 34.1 has HLA-Bw53
It was confirmed that it was a gene.

The entire nucleotide sequence of the genomic DNA of clone 34.1 was determined by the dideoxy method. The results are shown in Figure 1.HL in Figure 0
In addition to the A-Bw53 gene, for reference, HLA-Bw5
In the diagram showing the base sequence of 3, A represents adenine, C represents cytosine, G represents guanine, and T represents thymine.

Figure 2 shows the amino acid sequence of the peptide encoded by each exon region of the HLA-Bw53 gene shown in Figure 1. Amino acids are indicated by single letter abbreviations, A is alanine, R is arginine, and N is asparagine. , D is aspartic acid, C is cysteine, Q is glutamine, E is glutamic acid, G is glycine, and H is cystidine.

■ is isoleucine, L is leucine, and lysine.

M is methionine, F is phenylalanine, P is proline, S is serine, T is threonine, W is tryptophan,
Y represents tyrosine, and ■ represents valine.

In the figure, for reference, HLA-B35. B51゜Bw52,
The amino acid sequence of Bw58 is listed.

HLA-B51, Bw52 are J, In+munol+
142+pp306-311.1989. H.L.A.
-B w 5 B is J, Biol.

Chess, 260. pp11924-11933
．． 1985.

In FIGS. 1 and 2, dashes indicate the same nucleic acid or amino acid as the sequence of HLA-Bw53.

Since the nucleotide sequence of the HLA-Bw53 gene has been clarified by the above-mentioned example, it is strongly expected that the allotype of 1 (LA-Bw53) will be determined by DNA typing.

HLA-Bw 53 and B35 have six amino acid substitutions in the α1 domain region. - On the other hand, the amino acid residues in other domains are exactly the same. therefore,
The following nucleotide sequence (1
) is considered to be a base sequence specific to the HLA-Bw53 alloantigen.

(1”) ACCrGCGGATCGCGCTCCDN
The DNA used for the A probe has the above base sequence (
Any eff range including I) is sufficient.

The DNA whose base sequence has been determined is synthesized using a DNA synthesizer or a phosphotriester synthesis method.

Alkaline phosphatase (3,1,
3,1), Polynucleotide Kinase [2゜7.1
．． 78. ) and α-''PdATP to label stp at the 5' end of single-stranded DNA, a DNA probe can be obtained.

〔Effect of the invention〕

The present invention is useful for research, testing, and diagnosis of HLA-Bw53 alloantigen.

[Brief explanation of drawings]

Figures 1 (1) and (II) are diagrams showing the base sequence of the HLA-Bw53 gene, and Figure 2 is a diagram showing the amino acid sequence encoded by the HLA-Bw53 gene.

Claims (1)

[Claims] 1. HL having an exon represented by the following base sequence
A-Bw53 gene [Gene sequence available] [Gene sequence available] In the above formula, A represents adenine, C represents cytosine, G represents guanine, and T represents thymine. 2. HLA-Bw53 encoding the following amino acid sequence
Gene [Gene sequence available] [Gene sequence available] In the above formula, A is alanine, R is arginine, N is asparagine, D is aspartic acid, C is cysteine, Q is glutamine, E is glutamic acid, G is glycine, H is histicine, I is isoleucine, L is leucine, K is lysine, M is methionine, F is phenylalanine, P is proline, S is serine, T is threonine, W is tryptophan, Y is tyrosine, and V is valine. 3. A part of the HLA-Bw53 gene according to claim 1;
DNA consisting of a marker substance bound to a part of DNA
probe. 4. A transformed cell characterized by expressing the HLA-Bw53 antigen obtained by introducing the HLA-Bw53 gene according to claim 1 into a eukaryotic cell.