JPH025877A - Phenol oxidase gene (ii) - Google Patents

Abstract

PURPOSE:To effectively prepare a phenol oxidase by introducing into various microorganisms a phenol oxidase gene II comprising a DNA coding a peptide having a phenol oxdase activity. CONSTITUTION:A phenol oxidase gene II is synthesized. The gene II is a natural substance or is obtained by a synthetic or semi-synthetic method, is related with the sequence of a DNA having a specific amino acid sequence by the substitution of nucleotides, the insertion of nucleotides and the reversion of the sequence of nucleotides or other mutations and comprises a DNA coding a polypeptide having a phenol oxidase activity. The phenol oxidase gene II does not contain an intron and the recombination of the phenol oxidase gene II into various living things permits the preparation of a phenol oxdase utilized for biological pulping, the decororization factory waste waters, the pretreatment of wood saccharification, etc.

Description

[Detailed Description of the Invention] [Field of Industrial Application] The present invention relates to a phenol oxidase gene (n), and more specifically to a white rot fungus having the ability to produce and secrete phenol oxidase [particularly Coriolus hirsutus]. IFO49
17) Concerning the phenol oxidase gene (II) derived from the metsenger RNA (hereinafter abbreviated as mRNA) of ).

This phenol oxidase gene (II) does not contain introns and can be recombined into various organisms to be used in biological pulping, biobleaching, decolorization of industrial wastewater, pretreatment for wood saccharification, and as a reagent for clinical trials. can produce phenol oxidase.

[Prior art]

Phenol oxidase is an enzyme that oxidizes phenols in the presence of molecular oxygen to produce 0-quinone or p-quinone, and is known to contain copper as a prosthetic group. Phenol oxidase is widely distributed in the animal and plant kingdom, but phenol oxidase produced by some fungi called white rot fungi is considered to be particularly useful industrially.

White rot fungi are known to have a high ability to decompose lignin in lignocellulosic materials such as wood, and these white rot fungi are inoculated into lignocellulosic materials, cultured, and a portion of the lignin is decomposed to manufacture valves. Attempts have been made to develop biological pulping to
No. 03). However, white rot fungi not only decompose lignin (but also have the ability to decompose cellulose and hemicellulose, which are the raw materials for pulp), which poses the problem of reducing bulb yield. Another problem was that the decomposition of lignin by decaying fungi occurs late in growth due to secondary metabolism, so it takes time.

The lignin decomposition ability of white-rot fungi is thought to be largely due to the phenol oxidase produced and secreted by white-rot fungi, and attempts have been made to clone the gene, but no success has been achieved so far. Furthermore, regarding roughcase, which has similar activity to phenol oxidase of white-rot fungi, Neurospora crassa (Ne
Cloning of the laccase gene of S. urosporacrassa (U, S.

Germann, Lerch; (1988) J.
Biol, Chem, 263+ 885596), but its amino acid sequence is different from that of the phenol oxidase of the present invention, and lignin decomposition by Neurospora crassa laccase has not yet been reported. .

[Problem to be solved by the invention]

The present invention aims to solve the above-mentioned conventional problems and to make it possible to create various new organisms that only produce phenol oxidase.

It is believed that several enzymes are involved in the biodegradation of lignin in nature, and phenol oxidase produced by white-rot fungi plays a central role, and is essential for research on lignin decomposition. It is an enzyme.

Therefore, an organism endowed with the ability to produce phenol oxidase can be considered as a new organism that efficiently expresses only the ability to decompose lignin, and the present invention aims to develop the mRNA of white rot fungi necessary for imparting the ability to produce phenol oxidase.
The present invention provides the phenol oxidase gene (II) derived from the phenol oxidase gene (II).

[Means to solve the problem]

The present invention has the following formula: ValAsnAspGln PheSerl 1 eAspG lyHi 5As
pL, euThrl I el I eGl u Va
The present invention relates to a phenoloxidase gene (If) consisting of DNA encoding the amino acid sequence of 1Aspser (wherein X is Ala or Pro).

In addition, the one in which X in the above formula is Ala is defined as phenol oxidase gene (II) (OJ-POM 5),
The one where X is Pro is the phenol oxidase gene (I
I) (OJ-POM 2).

Furthermore, the present invention provides a DNA that hybridizes to the above DNA.
A sequence which is obtained naturally, synthetically or semi-synthetically and is related to the DNA sequence of claim 1 by nucleotide substitutions, nucleotide insertions, nucleotide sequence inversions and other mutations. The present invention relates to a phenol oxidase gene (II) consisting of a DNA encoding a polypeptide having phenol oxidase activity.

Furthermore, the present invention provides the above-mentioned phenol oxidase gene (
II) is linked to vector DNA.

Furthermore, the present invention provides that the phenol oxidase gene (n) is expressed by the following formula % [TCGGTAACTACTGGATTCGCGCCAA
CCCCAAACTTCGGCAA or the following formula (OJ 0M TCGATGTCAAACGACCAG GCGCAGCGGTACTCCTTTGTGTTGA
A66Al to ATG to CGAC; 6TCGGTAACT
ACTGGATTCGCGCCAACCCCAACTT
The present invention relates to a phenol oxidase gene (If) having the DNA sequence CGGCAATCGATGTCAAACGACCAG.

Next, the present invention will be explained in detail.

(Synthesis of DNA probe) The DNA probe required to confirm that the mRNA derived from the phenol oxidase gene (II) is included in the mRNA of white rot fungi and to clone the phenol oxidase gene from the cDNA library is , synthesized based on the partial amino acid sequence of phenol oxidase.

The partial amino acid sequence of phenol oxidase was purified with the amino acid sequence from the N-terminus of phenol oxidase produced and purified by the method of JP-A-61-285989, JP-A-62-220189, and JP-A-62-220190. Phenol oxidase was dissolved in BrCN and M[Co
1e, R, D,: Methods Enzymol,
11, 315-317 (1967)] or tryptic digestion (Lin, L, -N, & Brandts.

J, F.: Bio-chemistry 22.553
(1983)) L/, the amino acid sequence from the N-terminus of the isolated polypeptide was analyzed using the Edman degradation method (Hdman, P
, & 1lenschen, A. Protein-5e
quence determination, 2
'nd de,, Springer-Verlag
, Berlin, pp 232-279 (1975)
[Reference]].

The DNA probe can be synthesized by any one of the phosphothiester method, phosphotriester method, phosphite method, and the modified amidite method.

(Preparation of mRNA) Any organism that can be used in the present invention can be any organism that has phenol oxidase, but especially white rot fungi that produce and secrete phenol oxidase with high enzymatic activity [e.g. (IFO49
17), C. versicolor (IFO30340), and S. scale (IFO8714)) are good.

The composition of the medium for growing and propagating the white rot fungi may be any medium as long as it is a medium in which the white rot fungi produce phenol oxidase.

Glucose is used as the main carbon source, but other carbon sources that can be assimilated by white rot fungi may also be used. Yeast extract and polypeptone are used as the main nitrogen sources, but they can be assimilated by white rot fungi. Inorganic nitrogen compounds such as ammonium salts and nitrates, and organic nitrogen-containing substances such as urea and casein can also be used. In addition, inorganic salts such as calcium salts, magnesium salts, potassium salts, phosphates, manganese salts, zinc salts, iron salts, cornstarch liquor, vitamins,
It is also possible to add nutritional substances and growth-promoting substances such as amino acids and nucleic acids.

Inoculate white rot fungi into the medium from the first stage and culture.

When the phenol oxidase activity in the culture reaches its maximum, collect the bacteria and freeze in liquid nitrogen.

Total mRNA corresponding to proteins such as phenol oxidase can be extracted from white rot fungi by a conventional method. For example, white rot fungi are mixed with 2 to 5 volumes of NP-40,
A surfactant such as SO5 or Triton

After solubilization and centrifugation, add cold ethanol to the supernatant and R
There is a method of precipitating NA. In addition, the tissue was disrupted in a guanidine thiocyanate solution, and after ethanol precipitation,
There is also the GTC method, in which total mRNA is extracted by repeatedly dissolving the precipitate with guanidine hydrochloride. In addition, the method of Broda et al. (J, Microbiol, Methods, 4
．． (1985) 155-162) and a commercially available RNA extraction kit [RPN, 126 manufactured by Amajam Japan ■.
4) can also be used to extract total mRNA.

Alternatively, if necessary, a method can be carried out in which polysomes in the process of synthesizing phenol oxidase are precipitated using an antibody corresponding to phenol oxidase, and mRNA is extracted from this using a surfactant or the like.

The poly (A) m RNA of the present invention can be purified by a purification method using an adsorption column such as oligo (dT) cellulose or poly (U) cellulose, fractionation using a sig sugar density gradient centrifugation method, etc. .

In order to confirm the presence of mRNA corresponding to the target phenol oxidase in the total mRNA obtained as described above, the mRNA is translated into a protein, and the protein is identified using an antibody or the like. You can do the following method. For example, Reticulacy, a system commonly used to translate mRNA into proteins.
te-lyzate (m-shaped red blood cell lysate), Wh
It is possible to confirm that the mRNA corresponding to phenol oxidase has activity by translating it into a protein in a cell-free system such as eat germ (wheat germ).

In addition, dot hybridization using a phenol oxidase DNA probe or Northern
Confirmation can also be performed by plot hybridization.

The mRNA obtained as described above was in vitro
.

Synthesize the cDNA and insert it into an appropriate vector etc.
It can be used to construct a cDNA library for cloning the phenol oxidase gene (n).

(Synthesis of cDNA) As a cDNA synthesis method, Gubler-Hoffm
Examples include the an method, the Rand method, the Okayama-Berg method, and variations thereof. For example, it can be carried out in a test tube by the following method. Using the above mRNA as a template and oligo (dT) as a primer, dNTP (=dATP
, dGTP, dCTP, dTTP), a single-stranded cDNA complementary to the mRNA is synthesized using reverse transcriptase [2610Δ, manufactured by Zenshuzo Co., Ltd.]. Then, RNase
Make a cut in the mRNA with H (2150^ manufactured by Zenshuzo Co., Ltd.), use the mRNA as a primer, and perform D in the presence of dNTP.
Double-stranded cDNA is synthesized using NA polymerase I [214OA manufactured by Zenshuzo Co., Ltd.]. This synthesis method is available as a cDNA synthesis kit from AmaJam Japan (RPN,
1256Y), Boehringer Mannheim Yamanouchi ■(
1013882) is commercially available and can be used.

(Construction of cDNA library) The above double-stranded cDNA may be ligated with synthetic linkers at both ends, or with terminal transferase [Zen Shuzo
A cDNA library can be constructed by adding an appropriate tail (e.g., polyC) to the DNA using 2230A (manufactured by Co., Ltd.) and ligating it to a plasmid vector or lambda phage vector.

For example, double-stranded cDNA is ligated with EcoRI Linker using T4 phage-derived DNA ligase, then cut with the restriction enzyme EcoRI (1040S:l manufactured by Zenshuzo Co., Ltd.) to obtain double-stranded cDNA with EcoRI sticky ends, and the phage It was integrated into the EcoR1 site of the vector λgtll and subjected to in vitro packaging [Amajam
A cDNA library is constructed by performing the following steps: N, 334Y (manufactured by Japan ■, P3151 (manufactured by Promega Biotic)).

In addition, commercially available cDNAs of λgtll and λgtlO
A Library Kit [RPN manufactured by Amajam Japan ■, 1280. RPN, 1257. Promega Biotic P3010) can also be used.

<Cloning of phenol oxidase gene (II)> Using a phenol oxidase DNA probe labeled with a radioactive isotope from a cDNA library, phenol oxidase mRNA-derived c-derived A is cloned by plaque hybridization or colony hybridization.

<Subcloning> Subcloning of the obtained phenol oxidase gene (II) is performed as follows. DNA and vector DNA containing the phenol oxidase gene (If)
is cut with restriction enzymes to obtain cDNA fragments and vector DNA.
Prepare fragments. Next, the mixture of both is treated with 74 DNA ligase (2011A, manufactured by Zenshuzo Co., Ltd.). Vector DNAs used include pBR322 and pUclB.
, pUc19, pUc118 (3050.
3218.3219.3318), etc. In addition, restriction enzymes include old ndII [, EcoRI, Pst
I, Bam1l I, etc. [1060S manufactured by Zenshuzo ■,
1040S.

10735, l0IOS).

Determination of the base sequence of the phenol oxidase gene (II)> The cloned cDNA was transferred to the plasmid vector pU.
c118 or pUc119, or pUclB, p
Subcloning into Uc19 or M13 phage.

In principle, the subcloned DNA fragment is Hen1
koff's method and Yanisch-Perron's method [■enikoff, S. (1984) Gene,
28,351-359 Yanisch-Perro
n+C,, Vieira, J, and Messing.
, J. (1985) Gene.

33.103-119) to create a deletion mutant, but a commercially available Delision Kit (6030 manufactured by Zenshuzo Co., Ltd.) may also be used.

Deletion mutants are produced using the dideoxy method (Sang
er, P. (1981) 5science, 214.1
205-1210) to determine the base sequence. Commercially available sea fencing kit [6010A manufactured by Zenshuzo Co., Ltd.
6015A, 317-011 manufactured by Nirapon Gene ■
21) can also be used.

The cDNA derived from the mRNA of C. versicolor containing the phenol oxidase gene (n) is the plasmid pUc1.
9 or E. coli J in the form subcloned into the EcoRI site within the multiple cloning site of pUc118.
Conventional method for M109 or MV1184 [e.g.
rberg, E. M., & Cohen, S. N. Jou.
RNA of Bacteri-ology, Vol. 1, 1072-1074 (1974)) and deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology.

This transformed E. coli OJ-POM-5, OJ-POM-
2 have been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, and their respective deposit numbers are FER
M P-10055) and Microtechnical Research Institute No. 10061 (
FERM P-10061).

(Recombinant DNA) The phenol oxidase gene (II) obtained in this way is used by incorporating it into the vector DNA of microorganisms (especially prokaryotes), plants, and animals, and introducing it into microorganisms, plants, and animals. The aim is to make it possible to create new organisms that produce significant amounts of oxidase or this improved protein. The method for integrating the phenol oxidase gene (n) into a vector is to cleave the vector with an appropriate restriction enzyme, and if necessary, polymerize an appropriate linker or a plurality of bases in an annealing possible combination. The thus processed double-stranded DNA and vector DNA are mixed and ligated using ligase.

The obtained recombinant DNA is introduced into a vector host microorganism. Suitable host microorganisms include microorganisms of the genus Escherichia such as Escherichia coli, microorganisms of the genus Bacillus such as Bacillus subtilis, and microorganisms of the genus Satucharomyces such as Satucharomyces cerevisiae. Vectors used for these microorganisms are illustrated below. (See Protein Nucleic Acid Enzyme, Vol. 28, No. 4 (1981)).

EK-based plasmid vector (stringent type) p
scroll, pRK353. pRK646. pR
K248. pDF41, etc., EK-based plasmid vectors (relaxed type) Ca1E1゜pVH51, pAc
105. R5F2124. pcRl, pMB9.
BR313, pBR322, pBR324, pBR3
25, pBR327, pBR328, pKY2289゜pKY2700. pKN80. pKC? , pKB
158. pMX2004. pAcYcl.

pAcYc184. λdu1, etc., λgt system 7 fuge vectors λgt・λC, λgt・λB, λWES・
λB, λZJvir・λB, λALO・λB, λ-BS
-Ts622. λDam, λgtl1, etc., Sharon vector Sharon 4A, Sharon 3A, Sharon 16A
, Sharon 13A, Sharon 14A, Sharon 15A
, Sharon 8, Sharon 10. Sharon 17. Sharon 20 etc., Tiolais group vector L512. λZEQS.

λZYV5φ, λZUV φ2. λZUV φ3. λ
YEQS φ1. J YEQS φ.

λYEQSφ3. λBaa+, λS51, etc., Bacillus subtilis plasmid vector pTA1015. pLs15. p
TA1020. pLS28. pLs13゜pTA1
050. pTA1060. pTTi030. pT
Staphylococcus-derived plasmid vector pT127, such as A1031. pc194, pc221. p
C223, pUB112. pUBllo, psAO
501, psA0501, psA2100. pE1
94. pTP4. Yeast vector pJDB such as pTP5
219. YEp13. YRp7. Ylpl, p
YC, pTC2゜microbial vector, e.g. pBR32
In-frame promoter regions derived from E. coli, such as lac, trp, and tac, are inserted into PstI or EcoRI 5ite, etc., according to the purpose.
The phenol oxidase can be expressed in a suitable host by connecting it to E and transforming it into a suitable host.

In addition, in plants, T-DN derived from Ti-plasmid
The gene is introduced into plants using a similar method such as the pAL1050 vector containing the tmr region of A.

When inserting recombinant DNA, it is connected in-frame to the tn+r leader sequence, and the stop codon of tmr is also used.

In the present invention, amino acids and polypeptides are IUPAC
- Shall be abbreviated according to the method adopted by the IUB Committee on Biochemistry (CBN), for example using the following abbreviations.

Ala L-alanine Arg L-arginine Asn L-asparagine Asp L-aspartic acid Cys L-cysteine Gin L-glutamine Glu L-glutamic acid cty Glycine His L-histidine 11e L-isoleucine Leu L-leucine Lys L-lysine Met L- Methionine Phe L-Phenylalanine Pro L-Proline Ser L-Serine Thr L-Threonine Trp L-)Lyptophan Tyr I, -Tyrosine Val L-Valine Also, the sequence of DNA is determined by the number of bases contained in each deoxyribonucleotide that makes up the DNA. It shall be abbreviated by type,
The following abbreviations are used.

A Adenine (represents deoxyadenylic acid) C Cytosine (represents deoxycytidylic acid) G Guanine (represents deoxyguanylic acid) T Thymine (represents deoxythymidylic acid) [Example] The following examples are as follows: The cloning and nucleotide sequence determination of the phenol oxidase gene (11) derived from the mRNA of white rot fungi will be described in detail.

Example 1 (Synthesis of DNA probe) DNA probe was synthesized using the amidite method.
This was carried out using a synthesizer (Nippon Zeon, GenetA-m).

Three types of white rot fungi [Arage kawaratake (IFO4917)
).

Kawaratake (IFO30340), Kagaratake (IF
The results of analyzing the amino acid sequence from the N-terminus of phenol oxidase purified from O8714) by the Edman degradation method up to the 25th stage are shown below.

N-terminal 1st stage C. versicolor Ala-Arg-Gin-1a
-To Val scale mushroom! a-to rg-Gln
-Ala-Val-2 from Pro in the 17th row of the above arrangement
The following DNA probe was synthesized to correspond to Val in the 5th row.

However, I is deoxyinosine.

26+wer-C (16+m1x) 3'-CCI-G
AC-GGI-TTC-GCI-^GA-CAA-GC
I-TGG GT-5゜In addition, the phenol oxidase of three types of white rot fungi is
Decomposition with rCN and reverse phase high performance liquid chromatography (
Elution conditions, column: Phenyl-5Pi4 RP (
(manufactured by Toyo Soda Co., Ltd.), eluent 20% acetonitrile 10
．． 1% TFA to 75% Acetritrile 10.1% TF
The amino acid sequence of the polypeptide separated by concentration gradient elution to A at room temperature was analyzed by Edman degradation, and the results are shown below.

Aragekafuratake Met-Ala-Phe-A
sn-Phe Versicolor Met-Ala
-Phe-Asn-Phe scale mushroom M
et-Ala-Phe-Asn-Phe The following DNA probe was synthesized to correspond to the above amino acid sequence.

15mer-8 (16mix) 3'-TAC-CG
A-AAA-TTA-AAA-5'GGG 15n+er-B (16mix) 3'-TAC-C
GC-8AA-TTA-AAA-5'GGGG From the above results, the homology of the amino acid sequences of phenol oxidase produced and secreted by white rot fungi is very high, and by using the DNA probe used in the present invention, any Phenoloxidase gene of white rot fungi (I
I) can also be cloned. Therefore, in the following example, a method for cloning the phenol oxidase gene (II) of C. versicolor will be described.

Example 2 (Preparation of mRNA) 1ffi of YP
D medium (yeast extract Log/l, polypeptone 20
g/l, glucose 20g/l)
The cells were inoculated into an Erlenmeyer flask and cultured with shaking at 27°C for 6 days. After confirming that phenol oxidase was produced and secreted in the culture solution, the bacteria were collected and frozen in liquid nitrogen, resulting in approximately 20 g of frozen bacterial cells.

11 μm of total mRNA was extracted from 5 g of frozen bacterial cells by the method of Broda et al. 5 g of frozen bacterial cells were crushed in a 100rd Waring blender with liquid nitrogen added, and 3 times the amount of TNS buffer [1χtri-1so-Propyln
aphthalene 5ulphonic acid
, 200mM Tris-HCI.

25mM EGTA (pH 7,8), 250mM N
Dissolve in aC1). Remove pellets by centrifugation, add 0.5 g of phenol per 1 liter of supernatant, and
Keep at ℃ to dissolve. When all the phenol has dissolved, add A amount of chloroform, centrifuge, collect the supernatant, extract twice with chloroform, and ethanol precipitate to remove the total m
11 mg of RNA was recovered.

In addition, when using a commercially available RNA extraction kit (manufactured by Amajam Japan), 6.7 μg was obtained from 3 g of frozen bacterial cells.
It was possible to extract the total mRNA of .

Total mRNA recovered by the above two methods was analyzed by Northern blot analysis using a phenoloxidase DNA probe.
Hybridization method (Thomas, P.S.
, Proc, Natl, 8cad, sci, UsA
77, 5201 (1980)], it was confirmed that it contained mRNA derived from the phenol oxidase gene (■).

Total mRNA 5■ was extracted using the method of Maniatis et al. using an oligo(dT) cellulose column (Maniatis et al.
Boratory Manual, 197-199.19
Poly (A) m RNA was isolated and purified using 82), and approximately 100 μg of poly (A) m RN
A was purified.

Example 3 (Synthesis of cDNA) Poly(A) m R derived from the white rot fungus Aragega kawaratake
Synthesis of cDNA from NA is performed by Gubler and Iloff.
man's method (U, Guvier & B, J, Hof
ftaan: Gene, 25,263-269 (1
cDNA manufactured by AmaJam Japan according to [Reference 983)]
A synthesis kit was used.

5 μg of 011go(dT) 12-1B (Pharmacia 27-7858-01) was added to 5 μg of poly(A) mRNA in the presence of 50 units of human fetal RNase inhibitor enzyme (HPRI) for 100 units of reversal. Approximately 30% of the enzyme was reacted at 42°C for 1.5 hours.
First-strand cDNA was synthesized with a yield of . To this reaction solution, 4 units of E. coli ribonuclease H and 115 units of E. coli DNA polymerase I were added and incubated at 12"C for 1 hour.
After reacting at 22'C for 1 hour, the enzyme was inactivated by standing at 70°C for 10 minutes. Then 10 units of 74DN
Add A polymerase and react at 37°C for 10 minutes.
Two-end strand cDNA was obtained with a yield of about 95%.

Example 4 (Construction of cDNA library) Commercially available λgtll cloning system [Amajam
A cDNA library was constructed using the following product (manufactured by Japan ■).

100 ug of double-stranded cDNA was added to 20 y of Ec
After reacting oRI methylase at 37°C for 1 hour, E
16 units of 1EcoRI were added to this and reacted at 37°C for 2 hours.
It was purified by passing through an epharose CL-4B column. After ligation reaction with 1 μg of λgtll arm, in vitro
tro packaging (A.

Becker & M, Gold; Proc, Natl.
, Acad, Sci, USA, 72+581 (19
75)], and 106 recombinant λ phages were obtained, which was used as a cDNA library derived from the mRNA of C. versicolor.

Example 5 Cloning of phenol oxidase gene (I[)> E. coli strain Y1090 was infected with the cDNA library derived from the mRNA of C. versicolor obtained in Example 4, and plaques were formed.

The clone containing the phenol oxidase gene (If) was labeled using a radioactive isotope [γ-””PIATP [PB10168 manufactured by Amajam Japan Ltd.] and T4 polynucleotide kinase [2021A manufactured by Takara Shuzo Ltd.] (Richardson, C.C. (1965)
, Proc.

Natl, Acad, Sci, U, S, A,, 54.
Benton and Davis plaque hybridization method [W. 158-161] using the synthetic NA probe of Example 1.

Mouth, Benton & R.W., Davis;
5science, 196 180 (1977
)], two types of clones were selected.

λg tl containing the phenol oxidase gene (n)
Purification of DNA from l phages was performed by Thomas and Da
vis method (M, Thomas & R, W, Dav
is; Journal of Molecular
Biology, 91, 315 (1974)].

Example 6 Determination of base sequence of phenol oxidase gene (II)
The 2 clone λgtll DNA containing I) was cut with the restriction enzyme EcoRI, the inserted phenol oxidase gene was excised, and the plasmid vector pUc
19 and was subcloned into the EcoR1 site of pUc118.

1) The clone subcloned into UCl3 is OJ-
A clone subcloned into pUc118 as POM5 was designated as OJ-POM2.

A restriction enzyme cleavage map of the subcloned cDNA was prepared by a conventional method and is shown in FIG.

The restriction enzyme maps of OJ-POM5 and OJ-POM2 were the same.

From the subcloned cDNA, a deletion mutant was created using a commercially available Precision Kit [manufactured by Takara Shuzo], and a commercially available M13 Sequencing Kit [manufactured by Takara Shuzo Co., Ltd.] was used.
The nucleotide sequence of the phenol oxidase gene (II) was determined by the dideoxy method using Takara Shuzo Co., Ltd.). At the same time, the entire amino acid sequence of phenol oxidase was determined. The base sequence and complete amino acid sequence of phenol oxidase are shown in Figure 2 (OJ-POM 5) and Figure 3 (OJ-P
Shown in OM 2).

OJ-POM5 and OJ-POM2 differed in 17 bases, but only differed in one amino acid.

〔Effect of the invention〕

The present invention has the following effects.

■ By providing the entire amino acid sequence of phenol oxidase, the role of phenol oxidase in lignin decomposition has been elucidated, which can be applied to biological pulping.

■ The DNA encoding phenol oxidase can be transferred to other organisms in various ways (for example, by ligating it to a vector such as a plasmid, cosmid, phage, or virus, and creating a recombinant by transformation or transduction; ,D
Recombination can be performed using a method in which a recombinant is created by directly introducing an NA fragment by electroporation, etc., and a new organism that produces a significant amount of phenol oxidase can be created.

■ Phenol oxidase produced in large quantities using a new organism that has recombined the DNA encoding phenol oxidase is free from contamination with cellulase and hemicellulase.
Can be used for biological pulping and does not reduce pulp yield.

■ Phenol oxidase produced by a new organism that has recombined the DNA encoding phenol oxidase is of high purity and is of excellent quality as a reagent for clinical trials, such as reagents for enzyme activity measurement, substrates, and reagents for quantifying bilirubin. Can be used as an enzyme.

[Brief explanation of the drawing]

FIG. 1 shows a restriction enzyme cleavage map of the phenol oxidase gene (n) derived from mRNA of C. versicolor. Phenol oxidase is encoded in the shaded area. Figure 2 shows the phenol oxidase gene (II) (O
The nucleotide sequence and entire amino acid sequence of J-POM 5) are shown,
Figure 3 shows the phenol oxidase gene (If')
The base sequence and entire amino acid sequence of (OJ-POM 2) are shown. Figure (ProG1nA1aTrpserAspLeu(;ys
Pro11e+TyrAspA1aLeuAspVaI
AsnAspG1n (1eSerAsnA1aG1uVaISerProAs
pG1yPheaIThrProG1yProLeuV
aIA1aG1yAsnLysspAsnLeuThr
AsnHisThrMetLeuLysSer1nLy
sG1yThrAsnTrpA1aAspG1yPro
A1aThrA1aA1aAspLeuAlaVaI
I1eAsnVaIThrLysG1yLysArgT
yrArgPheArgLeuFigure 3 (Part 2) VaISerLeuSerCysAspProAsnH
isThrPheSerlleAspGlyHisAs
pLeuThrlleI 1eG 1 uVa I A
spSerI 1 eAsnserGlnProLeu
Va IVa I AspSerI 1eG in I
1ePheA laA 1 aG 1 nArgTy
rSerPheVa I LeuAs nA 1 aA
s pG 1 nAs pVa I G 1 yAs
nTyrTrp I 1 eArgAl aAsnPr
oAsnPheGlyAsnVaIGlyPheAla
GlyGlylleAsnSerAllalleLeuA
rgTyrAs pG 1 yA 1 aAs pPr
oVa I G 1 uProThrTh rTh r
G 1 nThrThrProThrLys ProL
euAs nG 1 uVa I As pLeuHi
sProLeuA l aThrMe tA 1 a
Va I ProG 1 yserProVa I A
1 aG 1 yGlyVaIAspThrAlal
leAsnMetAlaPheAsnPheAsnGl
yThrAsnPhePhelleAsnG 1 y
A 1 aSerPheVa I ProProThr
Va I ProVa I LeuLeuG 1 n
I 1 e I 1 eSerG 1 yA 1 aG
1 n to 5nA1aG1nAspLeuLeuPro
SerG1ySerVaITyrSerLeuProS
erAsnA1aAsp11eGlu Engineering 1 eserP
heProA 1 aThrA 1 aA 1 aPr
oProG 1 yA 1 aProHis Pro
PheHis LeuHis Diagram (Part 3)

Claims (5)

[Claims] (1) Phenoloxidase gene (III) consisting of DNA encoding the following amino acid sequence. [There is a gene sequence] [There is a gene sequence] [X in the formula is Ala or Pro] (2) DNA that hybridizes to the DNA according to claim 1
A sequence obtained naturally, synthetically, or semi-synthetically, which is related to the DNA sequence of claim 1 by nucleotide substitutions, nucleotide insertions, nucleotide sequence inversions, and other mutations. A phenol oxidase gene (II) consisting of DNA encoding a polypeptide having phenol oxidase activity. (3) A recombinant DNA in which the phenol oxidase gene (II) according to any one of claims 1 to 2 is linked to vector DNA. (4) The phenol oxidase gene (III) is expressed by the following formula (
Claim 1 having the DNA of OJ-POM5)
Described phenol oxidase gene (II). [There is a gene sequence] (5) The phenol oxidase gene (II) is expressed by the following formula (O
The phenol oxidase gene (II) according to claim 1, which has the DNA of J-POM2). [There is a gene sequence] [There is a gene sequence]