JPH02483A - Recombined lymphotoxin derivative - Google Patents

Abstract

PURPOSE:To increase antitumor action, enlarge antitumor action spectrum and reduce clinical side effect by recombining amino acid sequence comprising 143 amino acid residue with specific amino acid. CONSTITUTION:An amino acid sequence expressed by primary structural formula of the formula (A1-A31 is amino acid) is distributed in a molecule and used as lymphotoxin derivative. In said case, A1 is His, etc., A2 is Ile, etc., A3 is Gly, etc., A4 is Pro, etc., A5 is Ser, etc., A6 is Lys, etc., A7 is Leu, etc., A8 is Trp, etc., A9 is Arg, etc., A10 is Ala, etc., A11 is Asp, etc., A12 is Arg, etc., A13 is Asn, etc., A14 is Gly, etc., A15 is Lys, etc., A16 is Ala, etc., A17 is Tyr, etc., A18 is Ser, etc., A19 is Pro, etc., A20 is Lys, etc., A21 is Ala, etc., A22 is Lys, etc., A23 is Gln, etc., A24 is Gly, etc., A25 is Asp, etc., A26 is Gln, etc., A27 is Ser, etc., A28 is Pro, etc., A29 is Ser, etc., A30 is Thr, etc., and A31 is Phe, etc.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention relates to a novel recombinant lymphotoxin derivative, genetic recombination technology for its production, and a pharmaceutical composition containing the derivative. Therefore, the present invention can be utilized in the field of medical drugs.

[Conventional technology]

There are various humoral factors involved in biological defense mechanisms in living organisms, and these are mainly trace amounts of physiologically active substances produced by white blood cells, lymphocytes, macrophages, etc. in response to stimuli, such as interferon (IFN). −α, β
, γ), interleukin (IL 1. 2. 3.
4) , lymphotoxin (LT), tumor necrosis factor (TN
F), colony stimulating factor (G-, G!J-C3F).

Among these, lymphotoxin and TNF have been confirmed as polypeptides that exhibit direct anti-cell activity against neoplastic cell lines.
lymphotoxin is secreted from lymphocytes and T.
NF is produced by macrophages upon stimulation with mitogens, respectively.

It has already been reported that lymphotoxin and TNF can be produced by cloning the lymphotoxin and TNF genes and culturing Escherichia coli transformed with a vector incorporating the genes (Nature, 312°721- 724.1984 (N
ature, 312.721-724.1984).

and lymphotoxin and TNF produced in E. coli.
It has been proven that 1Aeth A Sarcoma has a necrotic effect on transplanted cancers in in vivo experiments. For example, cancers caused by 1Aeth A Sarcoma transplanted into mice can be significantly cured by intravenous or local administration of lymphotoxin or TNF. It is recognized (Jjmmun
ology, M, A, PALLADIN[] et
al, 1384023 (19g?)).

However, it has become clear that these lymphotoxin and TNF do not specifically damage all cancer cells, and that there are many cancer cells that are not affected at all (Sugarman et al.

5science, 230.943 (1985), W
atanabe et al, J.

Cancer Res, (Gann) 761115
(1985)). For example, human bladder cancer T-24, human malignant melanoma G-361. Colon adenocarcinoma LS174-T, human laryngeal carcinoma Hεp2. Human fibroid tumors such as HT1080 are in v
In intro experiments, it is less susceptible to damaging effects.

By the way, it has become clear that lymphotoxin and TNF have a wide range of effects in addition to antitumor effects, and so far, riboprotein lipase inhibitory effects, fL1-inducing effects, prostaglandin-inducing effects, and blood coagulation-promoting effects have been reported. . When lymphotoxin or TNF is used clinically, it is expected that these effects will be exposed as side effects, and in fact, in phase clinical trials of TNF, fever, chills, shivering, decreased blood pressure, increased GOT/GPT, and general malaise were observed. increased ALP has been observed (cancer and chemotherapy,
13.3491.1986).

Among them, the reduction in blood pressure is dose limiting f.
It has been reported that the Immuno
biology.

175, 8.1987), which poses an obstacle to large-dose administration of TNF. It has also been reported that the blood pressure lowering effect of TNF can be alleviated by preadministration of a cyclooxygenase inhibitor such as indomethacin or ketoprofen (Proc, Natl, Acad).

Sci. USA, 84.4273.1987>, this fact suggests that the blood pressure lowering effect may be based on the prostaglandin E2 production induction effect by TNF.

Now, due to differences in molecular weight, charge, and heat resistance, lymphotoxin has α (molecular weight 70,000-90,000), β (molecular weight 25,000-50,000), and r (molecular weight 1).
It is divided into four classes: 0,000 to 20,000) and complex (molecular weight 200,000 <).

Thorens, Biological Response Modifiers 293.1985 (Paul F.
ence.

Biological Re5ponse Modif
Iers, 293.1985), and the α and β classes can be further classified into subclasses according to charge. That is, lymphotoxin is used as a general term for various heterogeneous substances.

Aggarwal et al. reported the amino acid structure of lymphotoxin. B, C, A02334 (1985
) (J, B, C, 260, 2334 (1985))
, Gray et al. also reported the gene structure of lymphotoxin, and it is thought that a portion of the cause of heterozygosity of lymphotoxin can be explained by the difference in the number of amino acid residues and association formation of the same lymphotoxin.

On the other hand, Granger et al. have reported the existence of lymphotoxin that does not show immunological cross-pollination with this lymphotoxin (J. Immunology 137, 1878.
1986 (J, Immunology 137.18
78° 1986), it is said that the spectrum of anti-cellular activity is different from that of the lymphotoxin whose structure has already been elucidated. Furthermore, human tumor necrosis factor (TNF), which has been reported to have anti-tumor cell activity, shows 28% similarity to human lymphotoxin in its amino acid structure, and it has been reported that they share a receptor on the surface of tumor cells. Despite this, the spectrum of antitumor cell activity is thought to be somewhat different.

Based on the above findings, the present inventors created various polypeptides from the lymphotoxin and developed reagents that exhibit antitumor effects.
The following problems were investigated: discovery of the amino acid sequence of Gion, enhancement of antitumor effects, and reduction of clinical side effects.

[Means for solving problems]

As a result of various studies, it was discovered that an amino acid sequence consisting of 143 amino acid residues has an antitumor effect. It was discovered that a novel polypeptide having a stronger anti-tumor effect or a damaging effect on lymphotoxin-resistant cancer cells as well as a reduced ability to induce prostaglandin E2 production can be obtained by conversion, and the present invention was made based on the present invention. I was able to complete it.

That is, the present invention provides an amino acid sequence consisting of 143 amino acid residues, with the aim of enhancing antitumor action, expanding the spectrum of antitumor action, and reducing clinical side effects. Novel lymphotoxin derivatives containing several variations of amino acids are disclosed. However, since such derivatives can be effectively achieved through the use of genetic recombination techniques, the gist of the present invention is to provide recombinant lymphotoxin derivatives containing the above amino acid sequences.

The present invention will be explained in detail below, divided into sections of configuration and method.

Structure The recombinant lymphotoxin derivative of the present invention contains in its molecule an amino acid sequence represented by the following primary structural formula (hereinafter referred to as the amino acid sequence according to the present invention).

Pro Ala Ala^+ Leu A2^3 As
p A4 As AS GlnAsn Ser L
eu Aq As As AtOAsn
Thr A eye AI2 Ala Phe Leu
Gln Asp Gly Phe Ser LeuSe
r Aha Asn Ser Leu Le
u Val Pro Thr 5erGly
lie Tyr Phe Val Tyr Ser G
in Val Valphe Ser Al<Ata
Ata Act Aha A19 AtOA2, Thr
Ser Ser Pro Leu Tyr Leu
Ala His GluVal Gin Leu
Phe Ser Ser Gin Tyr
Pro PheHis Val Pro Leu
Leu Ser Ser Gln A22 Metshie
u (In the formula, A1-A31 represents any amino acid) In particular, A is old S, Asn, Leu, A2 is l
ie,! Jet, Gly.

A3 is Leu, Gln, His, Cys,
Lie, Pro, Vat, Ser.

cry, A4 is Pro, Arg, Leu,
Gin, Val, As are Ser.

Phe, Cys, A, Lys, Asn,
Gln, Glu, ASI), A7 is L
eu, Ala, Gin, As is Trp,
Phe, Leu, A9 is Arg.

leu, A + o is Ala, Arg, G
lu, Az is eight sp, Asn, Ala.

Arg, Al2 is Arg, Asn, Gl!
/, Al3 is ^sn, Arg, Asp.

Ala, Ser, Al4 is Gly, Arg
, Lys, Pro, Ala, Ser.

Thr, 8, lys, Gly, 8la
, Thr, 8 sn, 8 and 6 are Ala.

^rg, Lys, Glu, Gln, S
er, Gly, A, 7 is Tyr, Lys.

Arg, Cys, Gly, Ata is Ser,
Arg, Lys, Phe, Thr.

Aha, ^1. is Pro, Lys, Ser
, Thr, Gln, Ato are Lys.

Asn, Gly, Thr, ^2. is Ala
, Lys, Ser, Glu, A22
S, Asn, A23 is Gin, Lys,
Arg, Gly, A24 is Gly, As
p, Set, A25 is Asp, Glu,
Gin, A21+ is Gln.

Arg, Pro, Ser, A,, is Ser
, Thr, Glu, Phe, Trp.

A28 is Pro, Thr, Trp, Tyr
, A29 is Ser, Thr, Tyr.

A3Q is Thr, Val, Phe, A*+ is Ph
Excellent antitumor effects are shown when either one of e and Tyr is represented.

In the above, A1 is His, Ax is the same amino acid sequence as that contained in the so-called lymphotoxin precursor, and shows the antitumor effect of lymphotoxin.
is cry, A is Lys, A4 is Leu.

A5 is Aha, A6 is ASII, Afu is Lys,
As is Lys, A is Lys.

Alo ′b<GIn, Al l is Asp, A12
is Gin, Al3 is Ser, A14 is pro,
A, s is Thr, Ate is Phe, Act is Phe
This is the case.

NH2 side and C00 of the above amino acid sequence according to the present invention
Other amino acid sequences linked to the II side can be selected freely and are not particularly limited. Examples of amino acids linked to the NH2 side include the following 1 to 0.

■! Jet■! , 4et Lys ■ Met Thr! Jet Ile Th
r Asn Ser AspLeu Met
Arg Arg Arg Lys■! Jet
Thr Met lle Thr Asn
Ser Pr.

Ala Gin Thr Ala Arg
Gin His Pr.

Lys Met 1 (is Leu Ala
His Ser Thrice ■ Met Leu Pro Gly Val
Gly Leu ThrPro Ser
Ala Ala Gin Thr Ala
ArgGln His Pro Lys Me
t) Iis Leu AlaHis Se
r Thr Leu Lys ■ Met
Arg ■ Met Thr ■ Met Ser ■ Met PrQ ■ ! Jet Gin ■ Met Ser Thr Leu Lys ■ None @ Ser Thr Leu Lys The final target substance of the present invention can be produced by genetic recombination technology. Therefore, the cDNA encoding the recombinant lymphotoxin derivative of the present invention, the expression plasmid containing the cDNA as a foreign gene, and continuously obtained in such a manner that it can be counted and expressed in a selected host are all considered to be the final product of the present invention. They are intermediate substances necessary for the production of a target substance, and can be integrated as an invention in the sense that they solve the same problem. A specific example of an expression plasmid is pMLT3020. p! JLT5001A
, pMLT5011. pEH3000, pEH51
18, pEH5123゜p(1(5177, pBR[]
7071. p8RD8037. pBR[15(13
7, pf3R[]7037, pBRD8071. p
Mention may be made of the plasmids identified by EH5071-24, all of which are shown in the Examples below. In addition, a host transformed with an expression plasmid can be integrated into the invention as well as cDNA and an expression plasmid, and E. coli or animal cells, especially B) IK cells, are used as the host. As an example of transformed E. coli, RRI-pEH3000
, RB791-pMLT3020. RB791-p
MLT5001A, RB791-p! , 1LT5
011. J! , 183-p8H5118, J! , 18
3-pE) 15123°JM83-pEH517? ,
RRI-pBRD8071. RRI-pBRD707
1°RRI-pBRD5037. RRI-pBRD7
037. RRI-pBRD8037゜J! J83-p
E) Escherichia coli identified by 15071-24 can be mentioned, and all of these are shown in the examples below and have been deposited with the respective designations at the Institute of Fine Technology. Each accession number corresponds to the above order.
ERMP-9558, ERMP-9559, ERMP-9560
, P-9561, P-9562, P-9563,
Same P-9564, Same P-10254, Same P-10283
, P-10251, P-10284, P-102
52, P-10160.

Although the recombinant lymphotoxin derivative of the present invention, which is the final target substance, is a mutated version of natural lymphotoxin, it has the same level of activity as natural lymphotoxin, that is, antitumor activity, as shown by the experimental examples described later, and is superior to that of natural lymphotoxin. has. Therefore, just as natural lymphotoxin becomes an essential active ingredient of a pharmaceutical composition and is provided for medical purposes utilizing its activity, the recombinant lymphotoxin derivative of the present invention is also provided as a pharmaceutical for therapeutic purposes utilizing its activity. It can be an essential active ingredient of the composition.

As shown by the experimental examples below, the activity of the recombinant lymphotoxin derivative of the present invention is more than four times greater than that of natural lymphotoxin.

In this case, the pharmaceutical composition is mainly an injection and is administered intravenously. In order to manufacture it as an injection, it may be carried out according to the conventional method for making a trace amount of physiologically active substance into an injection. Therefore, for example, the recombinant lymphotoxin derivative of the present invention may be made into an aqueous solution alone or together with a suitable excipient or solubilizer, sterile-filtered, filled, and lyophilized, and an aqueous solution for dissolution may be added to prepare an injectable preparation for dissolution at the time of use. Bye.

Method The method for producing and measuring the substance of the present invention will be explained.

First, the lymphokine cDNA^ library required for producing the substance of the present invention is obtained by extracting mRNA from appropriate cells, screening for those exhibiting lymphotoxin activity in an expression system, reverse transcription, and transforming Escherichia coli as an appropriate plasmid. (Nature, 312
．． 721-724゜1934 (Nature, 31
2.721-724. 1984)), for example, as shown in the Examples below (mRNA was fractionated from Daudi cells, injected into African frog oocytes, lymphotoxin activity was measured in the culture supernatant, and the desired mRNA was isolated. After screening, the obtained mRNA is reverse transcribed by a conventional method, a plasmid is prepared from the obtained DNA by a conventional method, and E. coli strain X1776 is transformed.

In addition, Qaudi cells are human Burkitt 1y+n
phoma and is commonly available as ATCCCCL 213 (Cancer Lisa, 28.
1300-1310゜1968 (Cance Res
, 28, 1300-1310.1968)).

Next, a plasmid containing cONA encoding lymphotoxin is selected from the cDNA library by colony hybridization. Colony hybridization was performed using the Wallace method (Nucleic A
c1ds Res,, 9.879. (1981), the following DNA corresponding to the C-terminal 8 amino acid sequence of lymphotoxin is synthesized, purified, and used as a probe.

GTCTTCTTT GGA GCCTTCGCT
Prepare plasmids for CTG positive colonies,
The nucleotide sequence may be determined and plasmids containing lymphotoxin cDNA selected.

Next, in order to obtain DNA encoding the recombinant lymphotoxin derivative of the present invention from the plasmid containing lymphotoxin cDNA, known genetic recombination operations may be carried out in an appropriate combination. In the present invention, the amino acid sequence at a specific position is removed and the amino acid at a specific position is replaced.
is) can be used.

That is, lymphotoxin cDNA is inserted into a phage vector such as M13, and the resulting double-stranded J
3 Ipponjin D from the culture solution of E. coli transformed with DNA
Mutation can be induced by preparing NA and annealing it with a predetermined synthetic oligonucleotide as a primer. After site-directed mutagenesis, E. coli is transformed with the resulting reaction solution, and the resulting plaques are screened by hybridization with radiolabeled synthetic oligonucleotides, which encode the target substance. A double-stranded M13 phage DNA containing a predetermined cDNA as a foreign gene can be obtained. If necessary, a predetermined cDNA may be excised from the phage DNA and ligated to an appropriate expression vector used depending on the host, as appropriate, according to a conventional method.

The expression vector may be a commercially available expression vector, such as pKK 233-2. p[Ic 12.91JC1
8 (Pharmacia), PIG 130. P.I.G.
131. (M13tg130.131(7) plasmid in which one polylinker site has been replaced with puc12.131) can be used, but as shown below, select the required promoter and terminator, connect them, and create a special expression vector. You can prepare one and use it.

That is, in general, in order to express a mammalian-derived gene in E. coli, yeast, or animal cells, a promoter is placed upstream of ATG (Met), which is a protein synthesis initiation signal, and a protein synthesis stop codon (TAA) is placed.

A terminator must be connected downstream of TG^, TAG). In E. coli, the promoter is I
ac, trp, tac, trc, sac, P
L, etc., but in yeast, a-factor, TPI, s
uc, GAL, PGI, etc. are commonly used, and for animal cells, metallothionein, 5v40early, LTR, etc. are commonly used. In particular, in order to express genes efficiently in E. coli, the promoter, Shine-Dalgarno sequence (S
D sequence) and ATG must be connected accurately, and the number of bases from the SO sequence to ATG must be optimally selected. Taking these points into consideration, in the Examples described later, the trc promoter, SD sequence, and ATG were linked in this order as an E. coli expression vector, and the ATG was adjusted so that it was located 11 bases downstream from the SD sequence. I have prepared a structure in which Bgl ll5ite is inserted immediately before ATG, and am using this.

Since most of the individual genetic recombination operations used in the intermediate stages of the above manufacturing process are known, they will be explained below using literature or a brief description.

Cleavage of plasmids with restriction enzymes and separation, recovery, and ligation of DNA fragments obtained by cleavage by agarose gel electrophoresis or polyacrylamide gel electrophoresis are performed by experts.

Tea, etal 1. Molecular cloning, a
Laboratory Manual, Cold Spring Harbor Laboratory 19g2 (Maniatis).

T, et al,! Jolecular Cloni
ng, A LaboratoryiJanuary,
Co1d Spring Harbor Labora
(1982).

For example, a plasmid containing a cDNA encoding a natural lymphokine and a λ113 phage vector are each cut, and the fragments are ligated to create two copies containing the cDNA61! J
13 Applied when obtaining DNA.

The transformation of plasmids into Escherichia coli is described in DNA Cloning Vol.
l, l, Chap, 5. Ed, D,! J.
Glover IRL press 1985).

For example, a double steel that incorporates cONA, which encodes a natural lymphokine! (13) DNA or an expression plasmid into which a cDNA encoding a mutant lymphokine has been integrated is applied when transforming Escherichia coli.

Synthesis of oligonucleotides for mutagenesis and screening by the phasphoamldIte method and labeling of the 5° end were carried out using Nisel Beaucage and 9.9% ethanol, respectively. : Tetrahedronlet, 1 22
1859. (1981) (S, L, Beauc
age, etal,.

Tetrahedron Lett,, 22185
9 (1981)) and Nie, Maxam and W. Gilbert, Men's in Enthymology, Vol. 65, pp. 499-550, Academic Press 19.
80 (A.

! , Iaxam and W., G11bert, M.
methods in Enzymology.

Vol, 65 p499-560 Academic
Press 1980).

Determination of DNA base sequence was performed by F., Sanger Etal 0
．． Bini F. Knee, craftsman 745463°1977
(F. Sanger et al., P.
, N.A.S. 74 5463°1977)
This may be done by the ideoxy method.

For example, mutagenized and screened single chain M13
It is applied to determine the base sequence of DNA and confirm whether or not the desired mutation has been induced.

Double-stranded and single-stranded M13 phage DNA is prepared as follows.

That is, the transformed E. coli was transformed by J. Messing,
Men's in enthymology-101, 20-781
983(J, Messing, !Jethod i
nεnzymology 101.20-781983
), followed by shaking culture and centrifugation.

Escherichia coli in the sediment contained 0. maniatis and T. coli. Molecular Cloning, Laboratory Manual, Cold Spring Harbor Laboratory 19
82 (! Janiatis, T. et al.

Molecular Cloning, A L
Laboratory Manua), ColdS
pring Harbor Laboratory 1
Nippon Steel 5n3 DNA is obtained by the method described in 9g2). From the supernatant, 260 pe of 2.5M NaC and 20% PEG 6000 mixed solution was added to the supernatant, the mixture was centrifuged in an Ebbendorff microtube, and the resulting pellet was 120 pe of 1QmM). Suspended in Liss hydrochloric acid buffer (pH 7, 9, 0, 1 m) (4εDTA), extracted with phenol, precipitated with ethanol,
Wash with 0% ethanol and 10mM of 3hff after drying.
) Lis-HCl buffer (pH 7, 9, 0, 1m!, I ED
TA) to obtain single-stranded M13 DNA.

Site-directed mutagenesis reactions are performed by Schiller and Smith, Mentz In Enzymology-100468-500,1
983 (Zoller and Sm1th, Met
hodsin Enzymology, 100
468-500.1983).

That is, 20+1 mol of synthetic oligonucleotide for mutagenesis (brimer) end-labeled with non-radioactive phosphoric acid
-Heavyweight M13 DNA 1μg1 Annealing buffer (50mM) Liss-HCl, pH 8,0,0,25
B buffer (0,2M) Lis-HCl, pH 7, 5,0,1, (!, 4gCl□, 0.
1! , l dithiothreitol)8pe, dATP,
dGTP, dCTP, dTTP each 2.5m! J of each mixture 4u1. Add 2 pe of 5mM rATP, 1 pe of distilled water, 5 units of T<ONA ligase, and 5 units of DNA polymerase I Klenow fragment, make the final total volume 20 μr, and react at 14° C. for 3 hours.

Next, to transform E. coli with the mutagenized DNA using the reaction mixture, Kramer-Ecour,...
Cell 38879-887. 1984 (Kramere
tal,, Ce1l 38879-887.198
4) and according to Grunstein and Smith.

P, f. Ni, Nis, Ni Nis Ni 723961
, 1975 (Grunstein and Hogn
ess, P, N, A, S.

E. coli transformed according to USA Yu 3961.1975) was mixed with E. coli JM 103 and spread on an agar medium.
Cultivate overnight at 37°C, and transfer the formed plaques onto a nitrocellulose filter.

Screening for plaques transferred onto nitrocellulose filters is performed as follows.

6x 5sc on nitrocellulose filter (1x SSC is 150mM NaCl, 15m!, 1 Sodium Citrate), 10x Dent+ardt's (
1x Denhardt's (0.02% polyvinylpyrrolidone, 0.02% Ficoll, 0.02% bovine serum albumin) was added to 50 μg sonicated salmon sperm DNA and treated at 65°C for 3 hours. Allow preliminary hybrids to form. The filters were then mixed with a radiolabeled synthetic oligonucleotide for mutagenesis under the same buffer conditions.
Leave to stand overnight at 5°C to form a hybrid.

After washing the filter with 6x SSC and draining the water,
Overlay an intensifying screen and expose to X-ray film to select the desired plaque.

Double-stranded cDNA encoding mutant lymphokine: o3
The expression plasmid obtained by cutting out the DNA and ligating it to an expression vector may be used for transformation depending on the host. For example, for the transformation of BHK cells, Reuter etal 9. P, N, Ni, Ninis, Ninis x -, 79422, 1982 (Loyt
er et al., P.N.A.S.

tlsA, 79422.1982>1. oy
The method described by Ter et al. may be used. That is, the obtained expression plasmid is transformed into BHK57 (l cell line (ts, tk-) together with, for example, I]5V2-dhfr. Regarding pSV2-dhfr, see Subramani;
etal dimol, cell, biomouth, l 854-8
64. (1981) (Sabramani.

et al: Mol, Ce11. Dial,
1854-864. (1981)).

Cloning is done using the limiting dilution method.
This can be done as follows using the method (method).

20On from a few days after transformation! , I Amethop
Dulbecco's modified Eagle's medium containing terin (Dulbeco's modified Eagle's medium, glucose 3.5%, sodium bicarbonate 7.5%, fetal bovine serum (Fe2) 5%, tranexamic acid 3mM, glutamini/2mM, (+) -Am
ethopterin (200 nM) every 2 to 3 days.
A producing strain is obtained by limiting dilution while changing the medium every two weeks. Next, we prepared the producing strain in a roller bottle, 20Qn! J Am
It was inoculated into Double Beco's modified Eagle's medium 300- containing ethopter in, cultured at 37°C, and
After ~4 days, replace the medium with the same amount of medium every day for 3 to 4 weeks,
All you need to do is collect the culture supernatant.

In the examples described later, large intestine mJW83. Escherichia coli RRr or RB791 was cultured with shaking, the cells were disrupted, and the supernatant fraction was collected.

Purification can be carried out by using an appropriate combination of gel filtration, dye adsorption chromatography, high performance liquid chromatography, etc., and fractionation to obtain a desired fraction based on lymphotoxin activity.

The lymphotoxin activity, that is, the antitumor activity of lymphotoxin, is determined as follows.

As an indicator cell, for example, mouse fibroblast cell line 1
LP3 cells, which are a sub-strain of C. celli and are highly sensitive to lymphotoxin, are used, a sample and actinomycin D at a final concentration of lpg/me are added thereto, and the cells are cultured at 37° C. for 12-18 hours under a CO2 stream. Here the medium is 1
RPMI 1640 containing 0% inactivated fetal serum is used. After culturing, dead cells are washed and removed, and remaining living cells are fixed and stained with 0.5% crystal violet (methanol:water = 1:4). Extract the dye from the stained cells and measure its absorbance to determine the number of living cells.The titer is LP3P2O50%1ysis.
It is expressed by the sample dilution when giving. Note that this value changes depending on the growth phase of the LP3 cells when the sample is added, so it is necessary to always use a lymphotoxin standard titer sample as a control and make corrections.

When performing the above assay using logarithmically growing LP3 cells passaged in serum-free medium (DM-153 medium),
The active concentration of l, T that causes 50% Iysis after 4 hours is defined as 1[1/-.

Tests for cytotoxicity and growth inhibition of LT against human malignant tumor cell lines are conducted as follows.

Various cell lines were grown at a density of 0.5 to 1 x l O'well.
Add to a 6-well microtiter plate, and after culturing overnight, add a medium containing the LT sample. It is then cultured in a humidified, C02 presence for about - weeks. Viable cells are determined by extraction of Crystal Violet in the same manner as described above.

Alternatively, it is also possible to perform As5ay in the presence of 0.1 μg/ml actinomycin D.

In that case, add the cell line at a density of 2-5 XIO'/well, add the LT sample and actinomycin D, and determine the number of viable cells in 12-15 hours.

Estimation of specific activity by enzyme im/assay (εIA) is performed as follows. Using a rabbit anti-human LT antibody obtained by immunizing LT, or a monoclonal anti-human LT antibody produced by a hybridoma obtained from the tile cells of an immunized mouse by cell fusion method, LT in the sample was determined by the sandwich method. Estimate the amount. That is, after adsorbing an anti-human LT antibody (monoclonal or polyclonal) to a plastic well, LT is added and bound. Furthermore, a monoclonal or polyclonal antibody having a different recognition site from the primary antibody is added.

This secondary antibody is used to which biotin has been bound in advance. Thereby, when avidin bound to horseradish peroxidase is subsequently added, peroxidase is immobilized on the well in proportion to the amount of secondary antibody bound to LT due to the specific reaction between avidin and biotin of the secondary antibody. If a substrate such as orthophenylenediamine is added here, color development is quantitatively observed by peroxidase, and the LT concentration in the sample can be estimated from the absorbance.

That is, it is sufficient to compare a sample containing an unknown amount of LT with a LTOεr 8-value whose content concentration is known and which has been purified in advance and determined by amino acid analysis. In addition, the antitumor activity of the former -P3
By examining the cells as an indicator as described above, the specific activity can be determined.

〔Example〕

Hereinafter, the present invention will be explained in more detail with reference to Examples.

Example 1 Preparation of mRNA 2 x 10' Daudi cells were treated with 4M guanidinium thiocyanate, 0.5% N-lauroylsarcosine sodium, 25m+, + sodium citrate pH 7,0,0
, 1M mercaptoethanol, 0°1% antiform (
Sigma) solution 10m7! and homogenized using a polytron. Transfer this homogenate to 0.1M DT
5.7 including A! The mixture was layered on an aqueous J cesium chloride solution, and centrifuged at 2600 Orpm at 20° C. for 23 hours using an ultracentrifuge (SRP28A rotor Hitachi). Precipitated RNA was dissolved in 10mM) Lis-HCl pH 7,410m
After dissolving in 1, add 2.5 times the volume of ethanol and mix at -70
It was left to stand at ℃ for 1 hour. Next, RN precipitated by centrifugation
A (10mM) was dissolved in lithium hydrochloride pf (7,414d), and 4M potassium chloride 2- was further added. This RNA solution was transferred to an oligo(T) cellulose column (φ2 x 15cm).
0.5M potassium chloride, 10m! After thorough washing with J Tris-HCl pH 1,4, 10mM) Lis-HCl 1)
The mRNA was eluted with 87.4 aqueous solution.

Purification of mRNA 500 μg of Qaudi cell-derived mRNA was added to 50 mM
TrisHCI pH 7,4, 0,2M NaCl, ld
It was superimposed on solution 15- containing EDTA containing 10% to 28% 5ucrose to form a concentration gradient, and placed in an ultracentrifuge (
2600 Orpm using SRP28A rotor (Hitachi)
The mixture was centrifuged at 20°C for 15 hours. Next, the mixture was fractionated by 500 pe, and ethanol was added to each fraction to precipitate mRNA4. Each fractionated mRNA was dissolved in sterile water, and the mRNA concentration was 1 μg/
Adjusted to μe.

Screening for mRNA: Female African frog frogs (over 1 year old) were given 2,000 doses of serum gonadotropin (Pemex: Sankyo).
Injected. - After a few hours, remove the oocytes and add modi
fied barth 5aline medium (
'JBS). Next, each fraction of the previous mRNA 5
Inject 0-1000 g/egg into eggs, l mF, l
phenyl meth-yl 5ulfonyl f
2 in 48S (including luoride (P!JSF))
The cells were cultured at 5°C for 36 hours. After removing the supernatant, the oocytes were homogenized and incubated with IJB containing 1mM PMSF.
The samples were extracted with S and used as samples for each mRNA fraction. Lymphotoxin activity was measured for each sample, and both mRNAs showing lymphotoxin activity were screened.

Creation of cDNA library 5μ of the mRNA fraction that showed lymphotoxin activity in an mRNA expression system using African frog oocytes
5m of g! J TrisHCl pH8, 3'Ifie
After incubating for 5 minutes at 65°C,
4 μg of pcDID)JA (Pharmacia) was added, and the reaction was carried out under the following conditions. 50mM TrisH
Cl pH8,3,8m! J! JgC]z, 30
rn! JKCI, 0.3m! JDTT, 2mM dN
TP, reversetranscr+pteas
e50. After reaction for 60 minutes at 37°C with a reaction volume of 20 μ2, 0.25) A ED
The reaction was stopped by adding 2 μg of TA. After phenol chloroform treatment, 4! JNR,OAc 20μe
, Et[]H8h7! was added, allowed to stand at -70°C, then centrifuged to remove the supernatant, and the same operation was repeated.

After washing the precipitate with 75% EtOH water and drying, 10mM
sodium cacodylate, 2.5mM
HEPES pH 7,6, 0,1mM dCTP.

Adjust the reaction solution to poly(A) 0.2 pg/pe, and add terminal deoxynucleotidyl
transferase (TdT) 10 [1 was added to give a final concentration of 20 μe. After reacting at 37°C for 10 minutes, 0.25! The reaction was stopped by adding 1 μl of J EDTA, and the following post-treatments were carried out according to conventional methods.

The resulting DNA precipitate was reduced to 8mM! JgC1,,6mM
10mM Tris HCI pH 7.4 solution containing mercaptoethanol, HindIIIOtl 11
It was dissolved in μβ and reacted at 37°C for 2 hours. 0.25M
After adding 1 μg of EDTA to stop the reaction, post-treatment was performed according to a conventional method, and 1 μg of EDTA was added,
10 pg of 4,1mM EDTA solution and EtOH3
It was dissolved in a mixed solution of 1Je.

Next, 77 μg of pL-1 DNA (Fa/l/?Sia) was added to 11 μl of the DNA-containing solution, and 10 d TrisHC
l pH7, 4, 1mM EDTA, 0.1M Na
The C1 solution was 120 pe. 65℃ for 5 minutes, 42℃
After standing for 30 minutes, the following ingredients were added under water cooling to make the liquid volume 1.2 ml. 20mM Trys) ICI pH
7,5,4mM MgC1z, 10+++M(NH4
)2sL, 0.1MK[:I, 0.1mM β-NA
D, 5Q pg/m1Bovine SerumAl
bumln, E. coli ligase 1p
g After overnight reaction at 12°C, 4mM dNTP 1
0μ(2゜20mM β-NAD 10pe, E, c
oli ligase 1pg, B.

coli ONA polymerase I 17
．． 51J, add RNase H12 [1, 12°C
After further performing the reaction for 1hr at 25°C, this solution was used in 13. E. coli χ1776 strain was transformed.

In other words, coli z1776 strain is z177
6 medium (Maniatis et al.
After culturing at 37°C until the absorbance (5501m) reached 0.2 during molecular cloning, the cells were collected and cultured using the method of Maniatis et al.
tcell was adjusted. This competent ce
After adding the previous DNA to ll, E. coli 117
A cONA library was created by transforming 76 strains.

Screening of cDNA In order to select plasmids containing cDNA encoding lymphotoxin from the cDNA library obtained in the previous section, DNA corresponding to the C-terminal 8 amino acids of lymphotoxin was synthesized and colony hybridization was performed using this as a probe. Ta.

The structure of the synthetic probe is GTCTTCTTT GGA G
CCTTCGCT CTG, which was synthesized using an automatic solid phase synthesizer (Abride Biosystems),
Purified by PLC. Hybridization is Wa
The method of Nucleic Ac1ds R
es, 9879, 1981). cD
Of the approximately 100,000 NA libraries, 60 were positive colonies, and when we prepared plasmids from 3 of these colonies and determined their base sequences, we found that 1 was found to be lymphotoxin c.
It was a plasmid containing DNA. The base sequence of the amino acid coding region of the obtained lymphotoxin cQNA is shown in FIG.

Construction of expression vector The plasmid containing the lymphotoxin cDNA obtained in the previous section was digested with BamHI, and the approximately 1.1 kbp fragment containing the lymphotoxin cDNA was extracted with pLIG131 (pLIG131).
The poly tinker part of Uc13 (Pharmacia) was replaced with the poly 1i of M13tg131 (Amajam).
BamHI of the plasmid that replaced the nker part)
After inserting into 5ite (plasmid number pMLT20
00), digested with old ncII and Bal■ to approximately 1.
IKbp17) DNA fragment was obtained. Then p
KK233-2 (Pharmacia) to Nc.

■After digestion, transfer to the vector treated with Klenow enzyme in the previous step 1. IKbp fragment was inserted (plasmid number put, T2100), pKK233-2 was t
It has an rc promoter (an improved version of the tac promoter) and can be inducibly expressed using rPTG. Next, pMLT2100 was digested with εcoR1 and old ndIII, and approximately 1.5 kbp containing lymphotoxin cDNA was extracted.
The fragment was inserted into M13mpto Nipponjin DNA (Pharmacia).

Next, E. coli J! transf to J103
After the reaction, the wood-like DNA was prepared according to a conventional method and injected using the synthetic oligonucleotides shown below.
vitr.

Mutagenesis was performed.

Synthetic NA: GCT TGCTGG GAT C'
CA TGA GAT CTGTTT CCT Site-specific mutagenesis reactions are basically performed using methods such as 2o11er (Method in Enzymology t
oo 468.1983). That is,
20 pmol of the synthetic oligonucleotide end-labeled with non-radioactive phosphoric acid was mixed with 1 μg of template [ISA (-wood-like 0NA), 2pe of 5xannealing b
buffer (50mM TristlC), pH 8
,0.

25m! J! JgCI2), 8pe's B buff
er (0,2M Tris)ICIp)17.5.0
．． 1! J MgCh, 0.1M DTT), 4
pecJ)2.5m! J dNTP, 5 m of 2 μe
M ATP, I DI distilled water, 5 U T4 D
NA ligase, 50 DNA poly
The merase IKlenow fragment was added to bring the total volume to 20 μi.

After a 3-hr reaction at 14°C, ε, coli JM
103 (Kramer et al.,
Ce1l 38879, 1984).

The transformed bacteria were mixed with Grunstei JM103 and spread on an agar medium and cultured overnight at 37°C, and the formed plaques were transferred onto nitrocellulose (Grunstei JM103).
net at PNAS 723961.1975)
. Next, a hybridization test was performed with a synthetic oligonucleotide labeled with 32p to select phage plaques in which mutations had been induced. Double-stranded DNA was prepared from the phage plaques selected as described above, and EC0R
The DNA fragment obtained by digestion with I and old nd■ was digested with EcoRl and HindllI of pKK233-2.
Plasmid number pMLT3Q20) is inserted into the plasmid prepared by digestion.

p! , 1LT3020 is the 5h of the trc promoter
Protein synthesis starts from ATG 11 nucleotides downstream from the ine-Dargaro sequence, and BgI
This is an expression vector that allows any gene to be inserted downstream of the promoter by n digestion, and a gene can be inserted downstream of the start codon, ATG, by Bam)IIn digestion. p', IL T 3020 encodes a polypeptide in which 7 amino acid residues are deleted from the NH2 terminus of the polypeptide of the present invention, and the DNA sequence around the NH2 terminus is as follows.

Incidentally, a construction process diagram of p +, I L T 3020 is shown in FIG. 2.

Example 2 pMLT3020 with BamHI and )lindII
The DNA fragment of about 500 bp was recovered by agarose gel electrophoresis. In addition, the oligonucleotides shown below were synthesized and polynucleotide kinase (
NEB), after phosphorylating the 5° end with ATP, ptlG1 along with the previous 500 bp DNA fragment.
30 was digested with EcoRl and old ndII [plasmid number pLIG5]
001).

5' ^ATTCAGATCTCCATGAAA
3' NLT-53° GTCTAGAGTAC
TTTGGGCGC5'NLT-65' CC
CGCGGCTCCATCTGAT(:GGG
3' NLT 13° C
GAGTAGACTAGCCCCCT8G 5'N
After stopping the LT-2 reaction, use E. coli JM8 according to the usual method.
3 was transformed, and white colonies were selected on an agar plate containing X-GaJ. Next, after digesting plasmid pUG5001 with Bgl■ and old ndlJ, approximately 500 bp
Seven DNA fragments were recovered by agarose electrophoresis, and pMLT3020 was divided into Elgl ff and 1in.
About 4.0% was obtained by digestion with dlII. , kbp DNA and enzymatically ligated (plasmid number pMLT500
1A). The construction process diagram is shown in Figure 3.

Example 3 p! BamHI and old ndllll tag T3020
The following synthetic oligonucleotide obtained by phosphorylating the 5' end of the approximately 500 bp [)NA fragment obtained by digestion with ptlG130 and EcoRI and old ndII
Plasmid number ptlG5004) was used for enzymatic ligation with the vector obtained by digestion. The construction process diagram is shown in Figure 4.

5 “AATTCAGATCTCCATGCGTCGTC
GTAAA 3'LT-5 3'' GTCT 8GA to TACGC AGC
To AGC 8TT GGGCGC5゜~LT-4 5'CCCGCGGCTCATCTGATCGGGG
3'NLT-13° CGAGTAGA['
TAGCCCCTAG 5' NLT 2 Example 4 Plasmid p[IG 5004 Sac ■ and I
(About 540 bp [lNA obtained by digestion with indll
Fragment, the following synthetic oligonucleotide phosphorylated at the 5′ end, and plasmid pUG 130 were added to EC0RI.
and the approximately 2.8 kbp D obtained by digestion with old nd [[
The NA fragment was enzymatically ligated (plasmid number pUG5011).

Next, 7' 5 Sumi) 'ptlG5011 to BglI
Approximately 570 bp DNA obtained by digestion with I and old nd ■
Fragments and plasmids p! J LT 3020 was digested with Bgl II and old nd[[.
A 6 kbp DNA fragment was enzymatically linked (
Plasmid number pMLT5011).

The construction process diagram is shown in Figure 5.

5° ^ATT['AGATCTCATGCCCGC3
″NLT-153° GTCTAGAGTACGG
G 5'NLT-16 Example 5 Plasmidle: Tag T2O00 Hinc ■ and Ba
The approximately 800 bp DNA fragment obtained by digestion with tI was enzymatically ligated with the approximately 2.8 kbp DNA fragment obtained by digesting plasmid p[lG131 with HincII.

At this time, two types of plasmids are generated, Ban1 (1
When digested with
The plasmid producing the fragment is ρMLT201
The plasmid producing a DNA fragment of approximately 3.5 kbp was named pMLT2011. Next, plasmid 1] MLT2010 was transformed into Pvu [and old ndII
[About 600 bp of DNA fragment obtained from the digested site and plasmid pUG130 were combined with 3 ml and old ndl.
Plasmid number p[IcLT
3011). The construction process diagram is shown in Figure 6.

Example 6 Plasmid pMLT2010 was transformed into Pvu II and old n
DNA fragment of approximately 600 bl obtained by digestion with dIII Te, the following synthetic oligonucleotide whose 5' end was phosphorylated, and approximately 2.8 kbp DNA obtained by digesting plasmid pUG131 with Bgl II and old ndIII.
The fragments were enzymatically ligated (plasmid number ptlG3000).

Next, pUG3000 was combined with Bgl II and old ndI
Digestion with II yielded a DNA fragment of approximately 600 bp. This DNA fragment and plasmid p) tag T30
Plasmid ptl, an approximately 300 bp DNA fragment obtained by digesting 20 with coR1 and Bgl IT
The approximately 2.3 kbp [lNA fragment obtained by digesting G130 with EcoRl and )find■ was enzymatically ligated (plasmid number pEF13000).

The construction process diagram is shown in Figure 7.

5' GATCTGCATGCTCCCTGGTGTA
GGCCTCACACCTTCAG 3″3° A
CGTACGAGGGACCACATCCGGAGTG
TGGAAGTC5゜Example 7 Plasmid p! JLT2010 Pvu ■ and old n
A DNA fragment of approximately 600 bp obtained by digestion with dIII, the following synthetic oligonucleotide phosphorylated at the 5' end, and an approximately 7. Three 3 kbp DNA fragments were enzymatically linked.

Synthetic oligonucleotide 5' AATTCAGAT[:T[:ATGCTGCC
GGGTGTAGGCCTGACTCCGTCAG3゜3' GTCTAGAGTACGACGGCCC
ACATCCGGACTGAGGCAGTCobtained 2
E, coli J with double-stranded DNA! Upon transformation of J103) 413 phage plaques were generated. One 631 DNA was prepared from this phage plaque, and inoculated using the following synthetic oligonucleotide as a primer.
VItrOautagenesis was performed.

Synthetic oligonucleotide 5' GATACACCATGGccTGGGAGcT
After preparing double-stranded DNA from the obtained mutant M13 phage, Accl and old ndll
Digestion with I yielded 7 fragments of DNA of approximately 300 bp. In addition, plasmid pMLT 5001A was
Approximately 430 bp DNA obtained by digestion with I and Acc I
A fragment, plasmid pLIG130 with EcoR
The approximately 2.8 kbp N^ fragment obtained by digestion with I and Hindl I and the previous approximately 300 bp DNA fragment were enzymatically ligated (plasmid number Kano H5153).

The construction process diagram is shown in Figure 8.

Example 8 Plasmid pMLT5001A was transformed into Bgl II and S
Approximately 5 kbp DNA obtained by digestion with ac II
I would like to enzymatically ligate the approximately 2kbρ DNA obtained by digesting the DNA of I with BgllI and Sac ■ to pFG and plasmid number R! , +2000').

Next, p L R! , 12,000 with Bgl II and 5ac fl was enzymatically ligated with the following synthetic DNA, and then transformed into E. coli RRI strain to obtain a plasmid library. This library is pMLT5001
Contains LT in which all types of amino acids are substituted at the second amino acid Lys from the NHa terminus of A.

5″GATCTCATGNNNCCGC3° N=A
, G, C, T3° AGTACNNNGGG
5' This library was used in mice and plasmids with strong activity were selected using the strength of the damaging effect on P3 cells as an index. The selected plasmids were EcoRI and Hi
After digesting with ndIII and recovering approximately 800 bp DNA,
M13mp10 double-stranded DNA was purified with EcoRI and Hi.
JM10 was enzymatically ligated with the DNA digested with ndII
3 transfected. After that, according to the usual method, DN
The A base sequence was determined. The plasmid created by this method and its amino acid structure are shown below.

pLRM2003 MTP'-shi+4320
11 MPP-L”” 2019 MQP // 2042 MRP 〃 2044 MSP 〃 The plasmid construction process diagram is shown in FIG. 9).

Example 9 pMLT5001A with EcoRI and 5acIIi,
: Approximately 300 bp DNA fragment obtained by T digestion and ρ)
Tag T5001 at 13amHI.

Approximately 600 bp DNA obtained by digestion with HindI[I
A fragment, pFGKl was digested with Bam old and Soc II, and a 5 kb DNA fragment was added to pUc12 with E.
pLRM300 was obtained by enzymatically ligating the digested product with coRl and HindlII.

The approximately 3.5 kb DNA obtained by digesting pLRM300 with Bam Hl and 5ac I was purified, and a synthetic oligonucleotide mixture 5'GGCTNNNCTGATC3°3'CGCC
A plasmid library was obtained by enzymatically ligating with GANNNGACTAGNNNNCTAG 5° (N represents A, G, C, T) and transforming into E. coli RRI strain.

By screening this library using the strength of the damaging effect on LP3 as an indicator, plasmids in which the lymphotoxin amino acids old s', lie', and Gly' were converted as shown below were isolated.

pLRM3oo2MKP'AA)ILILD-L"33
003 MKPAAHLI. b a r D -L
” '3004!, IKPAANLMHD-L14
33005 MKPAA) ILIcD-L14330
07 MKPAAHLl[D-L143300g
! , IKPAALLIFD-L"'3010 MKP
AAHLIVD-L"'3013 MKPAAHLI
PD-L mouth 33027 'JKP, AAHLISD-
The L”3 construction process diagram is shown in Figure 10.

Example 10 pMLT5001A was treated with restriction enzymes EC0RI and Hin
After digestion with dIII, a fragment of approximately 800 bp was recovered by agarose gel electrophoresis, and M13mp 10
The RF DNA was enzymatically ligated with approximately 7.2 bp DNA obtained by digestion with EcoRI and old ndIII. One DNA 61 DNA was prepared from a white plaque produced by transforming coli J M 103 with this DNA. Next, in vitro using synthetic NA as a brimer
Mutagenesis was performed.

3° GGGTCGTTAGTCTTAAGTGACG
5'As a result, 2 wood-like D from the obtained phage
After adjusting the NA, EcoRI and old ndIII
A DNA fragment of approximately 800 bp was obtained, and pU
G130 was enzymatically ligated with an approximately 2.8 kbp fragment obtained by digestion with [EC0R1 and old ndIII (plasmid pE85073).

The construction process diagram is shown in Figure 11.

Example 11 Using the same single-stranded DNA as in Example 10, the following synthetic DNA
in vitro mutagen using as a primer
I did esis.

3゛AAGGTCGACTGCTTACCTCTGGT
Double-stranded DNA was prepared from the phage obtained by 5” Mutagenesis, and EcoR1 and I (ind
After digestion with II, an 800 bp DNA fragment was obtained. Next, pUG130 was added to ECORl and old ndll
It was enzymatically ligated with an approximately 2.8 kbp fragment obtained by digestion with J (plasmid pEh5177).

Example 12 Plasmid p[Ic12 with BamHl and PStI
A DNA fragment of about 2.8 kbp was obtained by
Plasmid pU[Nia692 was obtained by enzymatically ligating a synthetic NA with a phosphorylated ' end.

BamHI Acc f
f15' GATCCGTCTACTCCCAGGTG
GTTTTCT 3゜3' GCAG
ATGAGGGTCCACCAAAAGAGGGCC5゜Acc m xhaI
5°CCGGAAAAGCTTTACTCTCCGAAC
GCTACC3゜3' TTTTCGAATGAG
AGGCTTGCGATGGAGCT 5'xho
l Pst I5'
TCGAGCCCGCTGTACCTGGCTCAC
GAGGTCCTGCA 3゜3” CGGGC
GACATGGACCGAGTGCTCCAGG
5' plasmid pHc7692 with ACCI and Av
After digestion with a fJ, approximately 100 bp ONA fragment was recovered by 7% polyacrylamide gel electrophoresis, and plasmid! Tag T5001' to BCORI and ACCI
About 450 bp and about 300 bp DNA fragments obtained from Ava fl and old ndlII digestion, respectively, and plasmid pUG130 were digested with EcoRI and Hind.
The fragment was enzymatically ligated with an approximately 2.8 kbp fragment obtained by llI digestion (plasmid pEH5123).

The construction process diagram is shown in FIG. 12.

Example I3 Plasmid pEH5123 was transformed into ^ccllJ and Xho
After digestion with Ite, the 5' end was dephosphorylated by bacterial alkaline phosphorylase treatment. An approximately 3.5 kbp fragment was recovered by agarose electrophoresis and enzymatically ligated with synthetic DNA (Plasmid Rumi 85118).

5°CCGGAGGTGCTTACTCTCCGAAC
GCTACC3'3' TCCACGAATGA
A diagram of the construction process of GAGGCTTGCGATGGAGCT 5° is shown in FIG.

Example 14 Plasmid pBH5073 as εcoR] and Sal
Approximately 500 bp DNA obtained by digestion with B
Approximately 3.1k obtained by digestion with amHI and Sal I
After enzymatically ligating the bp DNA and the following synthetic DNA, it was transformed into Escherichia coli JM83 strain to prepare a plasmid library.

5°GATCNGTNCAAGCAA
3'3° CANGTTCGTTTTTA
5. A plasmid with antitumor activity was selected from this library, and the structure of the plasmid was determined to obtain a plasmid with the following structure.

pEl(50711MKAAHLIG[l RF QN
=L"3-2 PF =7 LF 13 RC -19 QF 24 R3" The construction process diagram is shown in FIG. 14.

Example 15 p! aT5001A with restriction enzymes EcoR1 and 1in
After digestion with dI[I, an approximately 800 bp lymphotoxin-containing fragment was recovered. This fragment! J
BcoR of 13mp l0RF DNA] and Hi
After insertion into ndII[5ite, one IN DNA was isolated. Next, r
n vitro mutagenesis was performed.

ba I 5'GGAGAGAATTTCTAGACAAGGAG
After preparing double-stranded DNA from plaques selected by 3° plaque hybridization, εc
Digested with oRI and old ndI[r to approximately goobp of D
The NA fragment was obtained and enzymatically ligated with an approximately 2.8 kbp fragment obtained by digesting pUGI30 with EcoRl and )lindIII (plasmid number pE
H5096).

The construction process diagram is shown in FIG. 15.

Example 16 Plasmid pBR322 was cut with Bal r and Pvu ■ to obtain 3741 bp DNA. Next, enzymatically linked plasmid pEl132 consisting of 3741 bp
2 d-rop was obtained. Plasmid p obtained in this way
BR322d-rop is a plasmid that lacks the function of the repressorof primer gene that controls the replication of plasmid DNA, and is expected to have a higher plasmid copy number than pBR322.

Next, plasmids pMLT5011 and pBR322d
-rop was cut with εC0RI and Pvu I to obtain approximately 1800 bp and 3100 bp DNA fragments, respectively.
Both were enzymatically linked (plasmid number pBRD5
011). A construction process diagram is shown in FIG.

Additionally, pBRD5011 was digested with EcoRl and Sac I
A DNA fragment of approximately 400 bp was obtained by cutting with p
Approximately 450 bp DNA obtained by cutting E85071-24 with Sac fl and old ndIII was enzymatically inserted into the EcoRl and 1indIII sites of plasmid pUG130 (plasmid number pEH8071).

A construction process diagram is shown in FIG. 17.

Plasmid pE88071 is a natural lymphotoxin cD
Since it contains the NA-derived stop codon TAG and an untranslated region of about 100 bp, the plasmid was modified to improve the stability of mRNA in E. coli and to prevent the amber mutant E. coli from skipping the stop codon. Ta.

That is, first, approximately 2400 bp DNA obtained by cutting p[JG130 with pvu]l and pEH300 were cleaved with BcoR1.
About 900 bp DNA obtained by cutting with BamHl and BamHl were ligated enzymatically, and we wanted to select a plasmid in which the lymphotoxin gene was inserted in the same direction as the ampicillin gene (plasmid number pTRc3000). Figure 18 shows the construction process diagram.
Shown below.

Next, a 1549bp DNA fragment obtained by cutting pTRc3000 with ECOR1 and SCa■ and pKK233-
2 (Pharmacia) was digested with BcoR1 and Sca I, and an 823 bp DNA fragment obtained was enzymatically ligated. About 2000 bp DNA fragment obtained by cutting this plasmid with PCOR1 and Hindll and pMLT5001
Approximately 800 obtained by cutting A with EcoRl and 3cal
Figure 19 shows a construction process diagram for enzymatically ligating the bp DNA fragment and the following synthetic DNA (plasmid number pTT5001).

Next, an approximately 600 bp DNA fragment obtained by cutting pEH8071 with EcoRl and Pst I, pTT5001
about 1700 obtained by cutting with Pst I and pvu I
EcoR bp DNA fragment, p8R322d-rop
Approximately 3100 bp DN obtained by cutting with l and pvu l
A fragment was enzymatically ligated (plasmid number pBRD8
071). A construction process diagram is shown in FIG. 20.

Example 17 Approximately 3000 bp DNA fragment obtained by cutting plasmid pEH5073 with Bam old and 3alI and pE)150
Approximately 500 obtained by cutting 73 with BcoR1 and 5ail
bp DNA and the following synthetic DNA were enzymatically linked.

5' G to TGCCAGCAAGCAA
3'37A-15AGGTCGTTCGTT
TTAA 5' 37^-158 A plasmid was recovered from E. coli transformed with the plasmid prepared as described above, and its DNA structure was examined.
It was found that the 5th C from the 5' end of 37A-15A was mutated to T. Plasmid number pE85037
).

Next, an approximately 600 bp DNA fragment obtained by cutting pEH5037 with BcoR1 and Pst I and pTT5001
obtained by cutting with Pat I and Pvu I], 70
0bp DNA fragment and pBR322d-rop
Approximately 3100 bp obtained by cutting with oRl and pvu ■
The DNA fragments were enzymatically ligated (plasmid number pBR
D5037).

The construction process diagram is shown in FIG. 21.

Example 18 Plasmid pε85037 was transformed into Sac ■ and old ndI [
Approximately 450 bp DNA fragment obtained by cutting with I and pBRD
An approximately 400 bp DNA fragment obtained by cutting 5011 with BcoR1 and Sac n was enzymatically inserted into the EcoRl and old ndIII sites of pUG130 (plasmid number pEH8037).

Subsequently, an approximately 600 bp DNA fragment obtained by cutting pEH8037 with BCORI and Pat I and pTT500
About 170 obtained by cutting 1 with Pst I and pvu I
0bp DNA fragment, 1]BR322d-rop to Bc
Approximately 3100 bp obtained by cutting with oR1 and pvu i
The DNA fragments were enzymatically ligated (plasmid number pBR
D8037).

A construction process diagram is shown in FIG. 22.

Example 19 Plasmid pEH7084 was transformed into EcoRl and SacI
Approximately 350 bp DNA obtained by cutting with I, pBRD50
1.37 obtained by cleaving with Sac I and Pvu I.
EcoR 3kbp DNA, pBR322d-rap
Approximately 3.1 kbp DN obtained by cutting with I and pvu I
The three DNA fragments of A were enzymatically ligated (plasmid number pBRO7037).

A construction process diagram is shown in FIG. 23.

Example 20 Plasmid pEH70fl14 was incubated with EcoRI and Sac
About 350bp ONA, pBR obtained by cutting with ■
[About 1.3 kbp 0NASpBR322d-r obtained by cutting 1ll1071 with Sac II and Pvu T
Approximately 3.0% was obtained by cutting ap with EcoRI and pvu I.
Three DNA fragments of 1 kbp DNA were enzymatically ligated (plasmid number pBRO7071).

A construction process diagram is shown in FIG. 24.

Example 21 Escherichia coli was transformed with the plasmids of each of the above Examples by a conventional method, cultured, and the target substance was purified.

The case of p[IcLT 3011 is shown below as an example.

Recombinant E. coli J! 483/pUcLT 3011 with ampicillin 100μg/+nj! LB medium 21 (1
% bactodributon, 0.5% yeast extract, 0.5% N
acl) at 37°C for 14 hours with shaking. next,
After centrifugation, add 10mM PB to approximately 10 times the amount of bacterial cells.
S<pH 7,4) and cooled to 5 onicato
After crushing the bacterial cells using R, 20.000 rpm, 3
Centrifugation was performed for 0 minutes to obtain 28 ml of supernatant fraction (crude extract). The LT activity of this crude extract is 7.4XIO' units/mg
Fuel with protein. Next, this crude extract was heated to 200 d Ph in advance.
osphate 8uffer (5ephacryl S, which is a gel a supercarrier sufficiently equilibrated at pH 6,8>)
I multiplied it by -200. Next, 5ephacryl S-2
100 ml of fraction with LT activity obtained through 00
200m! J Phosphate Buffer
(ProcIon redagarose, a dye adsorption affinity carrier fully equilibrated at pH 6,8)
After washing thoroughly with equilibration buffer, 100m!
0+n for J Tris Buffer (1789, 4)
A solution containing arginine with a linear concentration gradient from M to 4 Q Qtn 7.1 was run. As a result, a fraction with LT activity was eluted at an arginine concentration of 180 mM to 220 mM. Next, fraction 12. which showed LT activity.
5d to 100mλITris Buffer(p) f9
．． 4) / 2! J%a,SO,,0,2! J.A.
It was diluted with rg to give a total volume of 25d.

Next, TSK gelεther-5Pl+1 (7,5
High performance liquid chromatography was performed using a φX 75 mm).

Fraction 2 showing LT activity equilibrated in l M Na2SO4. Oml 100m in advance! J Tris 5uffe
r(pH9,4)/1! Apply to TSK gel Ether 5PW sufficiently equilibrated with J Na2SO4,
00mM Trys Buffer (pH9,4)
/ LM Na25O<kara too m! J Tris
Buffer (pH 9,4) 10.2M A linear concentration gradient of Arg was applied for elution. As a result, the fraction showing LT activity was Na, SO,] 220mM to 180mM!
It was eluted at J. This was designated as the LT Saibayashi standard.

The specific activity of LT of this preparation is 2.7 XIO” unit 7mg
It is a protein and could be purified approximately 36 times from the crude extract.

Example 22 Recombinant E. coli JyJ83/pMLT5001A was cultured under the same conditions as in Example 21 for 21 hours to obtain 21 ml of crude extract.

Purification was then carried out in the same manner as in Example 21 to obtain a single product with a purity of 95% or higher (purity assay by HPLC). pML
Table 1 shows the NH, terminal sequence, and amino acid composition analysis of T5001A. Further, the specific activity calculated from the amino acid composition analysis value was 3.4 x 108 U/mg.

Note that p) the amount of T5001A that kills 50% of P3 cells in mice was defined as IU.

Table l ρ! JLT5001A NL terminal sequence], 1etLy
sProAlaAla)IisLeulleGlyAs
p-p! , ILT5001A Amino Acid Composition Analysis Zero Ohr Example 23 E. coli recombinant (RRI/pBRD5037) was grown in LB medium (Bacto) in the presence of ampicillin (10 hg/mj).
tryptone 10g/β, NaCI 5g/l
, Yeast extract lQg/jri 400
- and cultured at 37°C for 15 hours. Next, M9CA
Medium (1% casamino acids, 1% lactose.

NaJP046g/ Il, K)+2PO43g/
j! , NaC1O, 5g/i'.

NH,CI Ig#! , FeSO4・7H200,
5mg/j7. 2mM Mg5L.

The cells were transferred to IQβ and cultured with shaking at 37°C. After 15 hours, 20% casamino acids
After adding 00rd and further culturing for 25 hours, the bacterial cells were collected by centrifugation and suspended in PBS (Dulbetsuko) 100rd. Next, this suspension was crushed by ultrasonication under water cooling, and then
000Orpm, centrifugation for 30 minutes, 132mj! The supernatant was obtained. Using this crude extract, purification was performed by the method described below.

First, 132 mI of crude extract! (2,8XIO”U/iI
5ephaclex S-200 (φ133
mm). Next, the fractions in which shiT activity was observed were collected, and anti-LT monoclonal antibody-conjugated 5epharose was added.
Column (φ55 x 210 mm), and after thoroughly washing the column with 0.2 MIJ acid 81z itr solution pH 6.8, add 0.2 M'J acid buffer p containing 3M KSCN.
It was eluted with H5.8. The obtained LT fraction 232- is 82 mI! After concentrating to
Desalting was performed using xG-25 (φ55×210 mm). The LT derivative obtained in this way is 5O3-PAG
[The purity was 98% or more according to analysis by E.

Example 24 E. coli recombinant (RR1/pBRD7037) was treated in the same manner as in Example 23 to produce 10! After culturing, collecting bacteria, and crushing 1
50-crude extract (1, l x 10'' [1/rd
I got it. This crude extract was prepared at 5 eph as in Example 23.
adex S-200, anti-LT monoclonal antibody conjugated 5epharose.

5 ephadex G-25 columns in sequence, 5O
Analysis by 3-PAGE yielded a purified protein with a purity of 98% or higher.

Example 25 E. coli recombinant (RRI/pBRD8037) was cultured at 20β in the same manner as in Example 23, and after harvesting and disrupting, 1
60mj! Crude extract (4.8X 10” U/mj
2) was obtained. This crude extract was prepared for 5ep as in Example 23.
hadex S-200, anti-T monoclonal antibody conjugated to 5epharose.

5 ephadex G-25 columns in sequence, 5O
Analysis by 3-PAGE yielded a purified protein with a purity of 98% or higher.

〔Effect of the invention〕

The present invention will be explained in detail using experimental examples.

Experimental Example 1 Each plasmid obtained in the above example was expressed and purified as described in Example 21 to obtain the final target substance,
These were used as samples to measure antitumor activity. Table 2 shows the results.
Shown below. In the table, the plasmid column indicates the plasmid used to obtain each final target substance, and the antitumor active species indicates the antitumor activity of each final target substance<specific activity against pMLT5001A).

From Table 2, it is known that the 143 amino acid sequences shown in the present invention have antitumor activity of lymphotoxin.

Table 2 Continued Experimental Example 2 Samples> Plasmids pEH5123, pEH5118, pMLT
5001A.

pBRD7037 was expressed and purified to obtain final target substances A, B, C, and D, which were used as test samples. Natural lymphotoxin was separately prepared as a control sample.

<Method> Human lung cancer cells (PC-10) were used as indicator cells;
Human colon adenocarcinoma cells (WiDr) were used.

Each cell line was incubated in 96We at a density of 2-5 x 104/we11.
medium containing each sample and actinomycin D (0 for PC ~ 10).
．． 1μg/ml', 0.5μg/ml for WiOr
ml was added. The cells were cultured in the presence of humid CO2 for 20 hours, and the surviving cells were fixed and stained with crystal violet, and the dye was extracted from the stained cells and its absorbance value was measured. The survival rate by sample addition was determined by setting the survival value before sample addition as 100%.

<Results> Figure 25 shows Kano H5118, pEH5123, pMLT50.
01A and natural lymphotoxin human lung cancer-derived PC-
Anticancer activity against 10 cells (0,1/jg/mj! A
The results of the evaluation of ctinomycin D) are shown.

As is clear from Figure 25, pE) 15118 and pE
H5123 is notable for its effectiveness against cancer cells.

These suggest that substitutions or deletions at amino acid positions 56 to 61 provide more useful compounds.

pBRD703 in Figure 26? , p! Anticancer activity of aT5001A and natural lymphotoxin against human colon adenocarcinoma cells (WiDr) (0,5 μg #+j! Actinom
ycin D) evaluation results are shown.

As is clear from FIG. 26, p8RO7037 is notable for its effectiveness against cancer cells.

Experimental Example 3 (PGB2 production inducing ability test) Samples> Plasmid pMLT5001A, pBRD7037
．． pBRD5037 was expressed and purified to obtain the final target substances C9D and E, which were used as test samples. Separately, natural lymphotoxin and recombinant TNF were prepared as control samples.

Method: Rat synovial membrane cells (2nd to 3rd generation cultured after collection) were placed in a 96-well microculture plate at a density of IXloF cells/well.
After culturing for 4 to 5 hours to allow attachment, the medium was removed by suction, and a new medium (10% FCS-RP!J
l-1640 medium) (50μ6/well)
.

Furthermore, 50p of each sample previously diluted to various concentrations was added.
Add e/well at 37°C, 5% Ca1. 1 below
After culturing for 2 hours, the supernatant was collected.

The amount of prostaglandin E2 (PGE2) in the supernatant was measured using RIA KIT (Dupont/NEN res
It was carried out by the following product.

<Results> The results are shown in Figure 27. From Figure 27, prostaglandin E
The ability to induce 2 production is strongest in recombinant TNF, followed by natural lymphotoxin and recombinant lymphotoxin (substance C). However, the material of the present invention
E is further attenuated, and therefore, the recombinant lymphotoxin derivative of the present invention is expected to have reduced clinical side effects.

[Brief explanation of the drawing]

FIG. 1 is a diagram of the base sequence of the amino acid coding region of lymphotoxin cDNA. FIG. 2 is a diagram of the construction process of pMLT3020. Figure 3 shows pUG5001 and pMLT5001A (
7) Each construction process diagram. FIG. 4 is a diagram of the construction process of pU65004. FIG. 5 is a diagram of the construction process of pMLT50111. FIG. 6 is a diagram of the construction process of pUcLT3011. FIG. 7 is a diagram showing the construction process of pE)13000. FIG. 8 is a diagram of the construction process of pE85153. FIG. 9 is a diagram of the plasmid construction process. FIG. 10 is a diagram of the plasmid construction process. FIG. 11 is a diagram of the construction process of pE85073. FIG. 12 is a diagram of the construction process of pE85123. FIG. 13 is a construction process diagram of PE85118. Figure 14 shows pE)! 5071 construction process diagram. FIG. 15 is a diagram of the construction process of pE85096. FIG. 16 is a diagram of the construction process of pBRD5011. FIG. 17 is a diagram of the construction process of pEH8071. FIG. 18 is a construction process diagram of FT RC3000. FIG. 19 is a diagram of the construction process of pTT5001. FIG. 20 is a diagram of the construction process of pBRD8071. FIG. 21 is a diagram of the construction process of pBRD5037. FIG. 22 is a diagram of the construction process of pBRD8037. FIG. 23 is a diagram of the construction process of pBRD7037. FIG. 24 is a diagram of the construction process of pBRD7071. Figure 25 is a graph showing the evaluation results of anticancer activity against human lung cancer-derived PC-10 cells, Figure 26 is a graph showing the evaluation results of anticancer activity against WiDr, and Figure 27 is the ability to induce PG82 production in Rat synovial membrane cells. It is a graph showing the evaluation results. Figure Applicant's Agent Kaoru Furuya Figure Figure Figure Bgl [[-Hlnd[1 18gI fl"I (indlll Figure Heeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee possible Sac■-[1asH1 Ji-111'' Figure Figure εcoR1/'□Hudffl 5uti (enes+s Figure\00bp 3, lkbρ Figure\\--ノ/ Figure Figure Figure Figure Figure Figure 50bp 1, 3kbp 3, lkbρ coR1 Diagram: Lymphotoxin derivative titer log, (ng/if)

Claims (1)

[Scope of Claims] A recombinant lymphotoxin derivative containing an amino acid sequence represented by the following primary structural formula in one molecule. [There is a gene sequence] (In the formula, A_1 to A_3_1 represent any amino acid.) 2 A_1 is His, Asn, Leu, A_2 is He, Met, Gly, A_3 is Leu, Gln, His, Cys, Ile, P
ro, Val, Ser, Gly, A_4 is Pro, Ar
g, Leu, Gln, Val, A_5 is Ser, Phe, Cys, A_6 is Lys, Asn, Gln, Glu, Asp, A_7 is Leu, Ala, Gln, A_8 is Trp, Phe, Leu, A_9 is Arg, Leu, A_1_0 is Ala, Arg, Glu, A_1_1 is Asp, Asn, Ala, Arg, A_1_2 is Arg, Asn, Gly, A_1_3 is Asn, Arg, Asp, Ala, Ser.
, A_1_4 is Gly, Arg, Lys, Pro, Ala
, Ser, Thr, A_1_5 is Lys, Gly, Ala, Thr, Asn
, A_1_6 is Ala, Arg, Lys, Glu, Gln
, Ser, Gly, A_1_7 is Tyr, Lys, Arg, Cys, Gly
, A_1_8 is Ser, Arg, Lys, Phe, Thr
, Ala, A_1_9 is Pro, Lys, Ser, Thr, Gln
, A_2_0 is Lys, Asn, Gly, Thr, A_2_1 is Ala, Lys, Ser, Glu, A_2_2 is Lys, Asn, A_2_3 is Gln, Lys, Arg, Gly, A_2_4 is Gly, Asp, Ser, A_2_5 is Asp, Glu , Gln, A_2_6 is Gln, Arg, Pro, Ser, A_2_7 is Ser, Thr, Glu, Phe, Trp
, A_2_8 is Pro, Thr, Trp, Tyr; A_2_9 is Ser, Thr, Tyr; A_3_0 is Thr, Val, Phe; and A_3_1 is Phe, Tyr. derivative. 3 A_1 is His, A_2 is Ile, A_3 is Gly
, A_4 is Pro or Val, A_5 is Ser, A_6
is Lys, A_7 is Leu, A_8 is Trp, A_9 is Arg, A_1_0 is Ala, A_1_1 is Asp, A
_1_2 is Arg, A_1_3 is Asn, A_1_4 is Gly, A_1_5 is Lys, A_1_6 is Ala, A
_1_7 is Tyr. A_1_8 is Ser, A_1_9 is Pro, A_2_0 is Lys, A_2_1 is Ala, A
_2_2 is Lys, A_2_3 is Gln, A_2_4 is Gly, A_2_5 is Asp, A_2_6 is Gln, A
The recombinant lymphotoxin derivative according to claim 1 or 2, wherein _2_7 is Ser, A_2_8 is Pro, A_2_9 is Ser, A_3_0 is Thr, and A_3_1 is Phe. 4. The recombinant lymphotoxin derivative according to any one of claims 1 to 3, wherein the polypeptide linked to the NH_2 terminal side of the amino acid sequence consists of 1 to 28 amino acid residues. 5 cDN encoding a recombinant lymphotoxin derivative containing the amino acid sequence shown by the following primary structural formula in its molecule
A. [There is a gene sequence] (In the formula, A_1 to A_3_1 represent any amino acid) 6 A_1 is His, Asn, Leu, A_2 is He, Met, Gly, A_3 is Leu, Gln, His, Cys, Ile, P
ro, Val, Ser, Gly, A_4 is Pro, Ar
g, Leu, Gln, Val, A_5 is Ser, Phe, Cys, A_6 is Lys, Asn, Gln, Glu, Asp, A_7 is Leu, Ala, Gln, A_8 is Trp, Phe, Leu, A_9 is Arg, Leu, A_1_0 is Ala, Arg, Glu, A_1_1 is Asp, Asn, Ala, Arg, A_1_2 is Arg, Asn, Gly, A_1_3 is Asn, Arg, Asp, Ala, Ser.
, A_1_4 is Gly, Arg, Lys, Pro, Ala
, Ser, Thr, A_1_5 is Lys, Gly, Ala, Thr, Asn
, A_1_6 is Ala, Arg, Lys, Glu, Gln
, Ser, Gly, A_1_7 is Tyr, Lys, Arg, Cys, Gly
, A_1_8 is Ser, Arg, Lys, Phe, Thr
, Ala, A_1_9 is Pro, Lys, Ser, Thr, Gln
, A_2_0 is Lys, Asn, Gly, Thr, A_2_1 is Ala, Lys, Ser, Glu, A_2_2 is Lys, Asn, A_2_3 is Gln, Lys, Arg, Gly, A_2_4 is Gly, Asp, Ser, A_2_5 is Asp, Glu , Gln, A_2_6 is Gln, Arg, Pro, Ser, A_2_7 is Ser, Thr, Glu, Phe, Trp
, A_2_8 represents Pro, Thr, Trp, Tyr; A_2_9 represents Ser, Thr, Tyr; A_3_0 represents Thr, Val, Phe; and A_3_1 represents any one of Phe, Tyr. 7 A_1 is His, A_2 is Ile, A_3 is Gly
, A_4 is Pro or Val, As is Ser, A6 is L
ys, A_7 is Leu, A_8 is Trp, A_9 is Ar
g, A_1_0 is Ala, A_1_1 is Asp, A_1
_2 is Arg, A_1_3 is Asn, A_1_4 is Gl
y, A_1_5 is Lys, A_1_6 is Ala, A_1
_7 is Tyr, A_1_8 is Ser, A_1_9 is Pr
o, A_2_0 is Lys, A_2_1 is Ala, A_2
_2 is Lys, A_2_3 is Gln, A_2_4 is Gl
y, A_2_5 is Asp, A_2_6 is Gln, A_2
_7 is Ser, A_2_8 is Pro, A_2_9 is Se
The cDNA according to claim 5 or 6, wherein r, A_3_0 is Thr, and A_3_1 is Phe. 8. The cDNA according to any one of claims 5 to 7, wherein the polypeptide linked to the NH_2 terminal side of the amino acid sequence consists of 1 to 28 amino acid residues. 9 cDN encoding a recombinant lymphotoxin derivative containing the amino acid sequence shown by the following primary structural formula in its molecule
An expression plasmid obtained by containing A as a foreign gene and ligating it so that it can be controlled and expressed in a selected host. [There is a gene sequence] [There is a gene sequence] (In the formula, A_1 to A_3_1 represent any amino acid) 10 A_1 is His, Asn, Leu, A_2 is He, Met, Gly, A_3 is Leu, Gln, His, Cys, Ile, P
ro, Val, Ser, Gly, A_4 is Pro, Ar
g, Leu, Gln, Val, A_5 is Ser, Phe, Cys, A_6 is Lys, Asn, Gln, Glu, Asp, A
_7 is Leu, Ala, Gln, A_8 is Trp, Ph
e, Leu, A_9 is Arg, Leu, A_1_0 is Ala, Arg, Glu, A_1_1 is Asp, Asn, Ala, Arg, A_1_2 is Arg, Asn, Gly, A_1_3 is Asn, Arg, Asp, Ala, Ser.
, A_1_4 is Gly, Arg, Lys, Pro, Ala
, Ser, Thr, A_1_5 is Lys, Gly, Ala, Thr, Asn
, A_1_6 is Ala, Arg, Lys, Glu, Gln
, Ser, Gly, A_1_7 is Tyr, Lys, Arg, Cys, Gly
, A_1_8 is Ser, Arg, Lys, Phe, Thr
, Ala, A_1_9 is Pro, Lys, Ser, Thr, Gln
, A_2_0 is Lys, Asn, Gly, Thr, A_2_1 is Ala, Lys, Ser, Glu, A_2_2 is Lys, Asn, A_2_3 is Gln, Lys, Arg, Gly, A_2_4 is Gly, Asp, Ser, A_2_5 is Asp, Glu , Gln, A_2_6 is Gln, Arg, Pro, Ser, A_2_7 is Ser, Thr, Glu, Phe, Trp
, A_2_8 represents Pro, Thr, Trp, Tyr; A_2_9 represents Ser, Thr, Tyr; A_3_0 represents Thr, Val, Phe; and A_3_1 represents any one of Phe, Tyr. 11 A_1 is His, A_2 is Ile, A_3 is Gl
y, A_4 is Pro or Val, A_5 is Ser, A_
6 is Lys, A_7 is Leu, A_8 is Trp, A_9
is Arg, A_1_0 is Ala, A_1_1 is Asp,
A_1_2 is Arg, A_1_3 is Asn, A_1_4
is Gly, A_1_5 is Lys, A_1_6 is Ala,
A_1_7 is Tyr, A_1_8 is Ser, A_1_9
is Pro, A_2_0 is Lys, A_2_1 is Ala,
A_2_2 is Lys, A_2_3 is Gln, A_2_4
is Gly, A_2_5 is Asp, A_2_6 is Gln,
A_2_7 is Ser, A_2_8 is Pro, A_2_9
The expression plasmid according to claim 9 or 10, wherein is Ser, A_3_0 is Thr, and A_3_1 is Phe. 12. The expression plasmid according to any one of claims 9 to 11, wherein the polypeptide linked to the NH_2 terminal side of the amino acid sequence consists of 1 to 28 amino acid residues. 13. The expression plasmid of claim 9, wherein the expression plasmid is identified by: pEH3000, pUCLT3011, pMLT501
1, pMLT5001A, pUG5004, pEH50
73, pEH5118, pEH5123, pEH515
3, pEH5177, pEH5071-1, pEH50
71-2, pEH5071-7, pEH5071-13
, pEH5071-19, pEH5071-24, pE
H5096, pLRM3002, pLRM3003, p
LRM3004, pLRM3005, pLRM3007
, pLRM3008, pLRM3010, pLRM30
13, pLRM3027, pLRM2003, pLRM
2011, pLRM2019, pLRM2042, pL
RM2044, pBRD5037, pBRD7037,
pBRD7071, pBRD8037, pBRD807
1 14 cD encoding a recombinant lymphotoxin derivative containing the amino acid sequence shown by the following primary structural formula in its molecule
A host that is transformed with an expression plasmid containing NA as a foreign gene and ligated to enable control and expression within the selected host. [There is a gene sequence] [There is a gene sequence] (In the formula, A_1 to A_3_1 represent any amino acid) 15 A_1 is His, Asn, Leu, A_2 is He, Met, Gly, A_3 is Leu, Gln, His, Cys, Ile, P
ro, Val, Ser, Gly, A_4 is Pro, Ar
g, Leu, Gln, Val, A_5 is Ser, Phe, Cys, A_6 is Lys, Asn, Gln, Glu, Asp, A_7 is Leu, Ala, Gln, A_8 is Trp, Phe, Leu, A_9 is Arg, Leu, A_1_0 is Ala, Arg, Glu, A_1_1 is Asp, Asn, Ala, Arg, A_1_2 is Arg, Asn, Gly, A_1_3 is Asn, Arg, Asp, Ala, Ser.
, A_1_4 is Gly, Arg, Lys, Pro, Ala
, Ser, Thr, A_1_5 is Lys, Gly, Ala, Thr, Asn
, A_1_6 is Ala, Arg, Lys, Glu, Gln
, Ser, Gly, A_1_7 is Tyr, Lys, Arg, Cys, Gly
, A_1_8 is Ser, Arg, Lys, Phe, Thr
, Ala, A_1_9 is Pro, Lys, Ser, Thr, Gln
, A_2_0 is Lys, Asn, Gly, Thr, A_2_1 is Ala, Lys, Ser, Glu, A_2_2 is Lys, Asn, A_2_3 is Gln, Lys, Arg, Gly, A_2_4 is Gly, Asp, Ser, A_2_5 is Asp, Glu , Gln, A_2_6 is Gln, Arg, Pro, Ser, A_2_7 is Ser, Thr, Glu, Phe, Trp
, A_2_8 represents Pro, Thr, Trp, Tyr; A_2_9 represents Ser, Thr, Tyr; A_3_0 represents Thr, Val, Phe; and A_3_1 represents any one of Phe, Tyr. 16 A_1 is His, A_2 is Ile, A_3 is Gl
y, A_4 is Pro or Val, A_5 is Ser, A_
6 is Lys, A_7 is Leu, A_8 is Trp, A_9
is Arg, A_1_0 is Ala, A_1_1 is Asp,
A_1_2 is Arg, A_1_3 is Asn, A_1_4
is Gly, A_1_5 is Lys, A_1_6 is Ala,
A_1_7 is Tyr, A_1_8 is Ser, A_1_9
is Pro, A_2_0 is Lys, A_2_1 is Ala,
A_2_2 is Lys, A_2_3 is Gln, A_2_4
is Gly, A_2_5 is Asp, A_2_6 is Gln,
A_2_7 is Ser, A_2_8 is Pro, A_2_9
The host according to claim 14 or 15, wherein is Ser, A_3_0 is Thr, and A_3_1 is Phe. 17. The host according to any one of claims 14 to 16, wherein the polypeptide linked to the NH_2 terminal side of the amino acid sequence consists of 1 to 28 amino acid residues. 18. The host according to claim 14, wherein the expression plasmid is identified by: pEH3000, pUCLT3011, pMLT501
1, pMLT5001A, pUG5004, pEH50
73, pEH5118, pEH5123, pEH515
3, pEH5177, pEH5071-1, pEH50
71-2, pEH5071-7, pEH5071-13
, pEH5071-19, pEH5071-24, pE
H5096, pLRM3002, pLRM3003, p
LRM3004, pLRM3005, pLRM3007
, pLRM3008, pLRM3010, pLRM30
13, pLRM3027, pLRM2003, pLRM
2011, pLRM2019, pLRM2042, pL
RM2044, pBRD5037, pBRD7037,
pBRD7071, pBRD8037, pBRD807
1 19 A pharmaceutical composition containing as an active ingredient a recombinant lymphotoxin derivative whose molecule contains an amino acid sequence represented by the following primary structural formula. [There is a gene sequence] [There is a gene sequence] (In the formula, A_1 to A_3_1 represent any amino acid) 20 A_1 is His, Asn, Leu, A_2 is He, Met, Gly, A_3 is Leu, Gln, His, Cys, Ile, P
ro, Val, Ser, Gly, A_4 is Pro, Ar
g, Leu, Gln, Val, A_5 is Ser, Phe, Cys, A_6 is Lys, Asn, Gln, Glu, Asp, A_7 is Leu, Ala, Gln, A_8 is Trp, Phe, Leu, A_9 is Arg, Leu, A_1_0 is Ala, Arg, Glu, A_1_1 is Asp, Asn, Ala, Arg, A_1_2 is Arg, Asn, Gly, A_1_3 is Asn, Arg, Asp, Ala, Ser.
, A_1_4 is Gly, Arg, Lys, Pro, Ala
, Ser, Thr, A_1_5 is Lys, Gly, Ala, Thr, Asn
, A_1_6 is Ala, Arg, Lys, Glu, Gln
, Ser, Gly, A_1_7 is Tyr, Lys, Arg, Cys, Gly
, A_1_8 is Ser, Arg, Lys, Phe, Thr
, Ala, A_1_9 is Pro, Lys, Ser, Thr, Gln
, A_2_0 is Lys, Asn, Gly, Thr, A_2_1 is Ala, Lys, Ser, Glu, A_2_2 is Lys, Asn, A_2_3 is Gln, Lys, Arg, Gly, A_2_4 is Gly, Asp, Ser, A_2_5 is Asp, Glu , Gln, A_2_6 is Gln, Arg, Pro, Ser, A_2_7 is Ser, Thr, Glu, Phe, Trp
, A_2_8 is Pro, Thr, Trp, Tyr; A_2_9 is Ser, Thr, Tyr; A_3_0 is Thr, Val, Phe; and A_3_1 is Phe, Tyr. . 21 A_1 is His, A_2 is Ile, A_3 is Gl
y, A_4 is Pro or Val, A_5 is Ser, A_
6 is Lys, A_7 is Leu, A_8 is Trp, A_9
is Arg, A_1_0 is Ala, A_1_1 is Asp,
A_1_2 is Arg, A_1_3 is Asn, A_1_4
is Gly, A_1_5 is Lys, A_1_6 is Ala,
A_1_7 is Tyr, A_1_8 is Ser, A_1_9
is Pro, A_2_0 is Lys, A_2_1 is Ala,
A_2_2 is Lys, A_2_3 is Gln, A_2_4
is Gly, A_2_5 is Asp, A_2_6 is Gln,
A_2_7 is Ser, A_2_8 is Pro, A_2_9
The pharmaceutical composition according to claim 19 or 20, wherein is Ser, A_3_0 is Thr, and A_3_1 is Phe. 22. The pharmaceutical composition according to any one of claims 19 to 21, wherein the polypeptide linked to the NH_2 terminal side of the amino acid sequence consists of 1 to 28 amino acid residues. 23. The pharmaceutical composition according to any one of claims 19 to 22, which is an antitumor agent.