JPH02308793A - Alpha-antigen of mycobacterium kansaii origin - Google Patents

Abstract

PURPOSE:To obtain the title antigen using a transformant by making a culture in a medium of a transformant produced by transformation by specific recombinant DNA and by collecting the aimed alpha-antigen produced. CONSTITUTION:A transformant produced by transformation by recombinant DNA containing the gene coding alpha-antigen of Mycobacterium Kansasii origin having an amino acid sequence of the formula is put to culture in a medium, and the alpha-antigen produced is collected, thus obtaining the objective alpha-antigen. To make a phenotypic expression of the base sequence in cloned alpha-antigen gene, a combination of phenotypic expression vector and host cell from a wide range of prokaryotes or eukaryotes can be used; however, normally it is preferable that an option where the host cell is from a prokaryote be used. For the phenotypic expression vector, it is preferable that a vector capable of controlling replicon adaptable to the above-mentioned host cell be used and the host cell contain promoter necessary for manifestation of the protein inherent in itself or have been improved so as to contain the promoter.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to Mycobacterium kansasii (Myc-o.
tuberculin active protein α antigen (hereinafter referred to as α antigen) derived from Bacteriuo+ Kansasii).
Cultivating a transformant transformed with a gene encoding an antigen and a monthly replacement DNA incorporating the gene,
The present invention relates to a production method for producing the target α-antigen derived from Mycobacterium kansasii, a signal peptide of the α-antigen, a gene encoding the signal peptide, and a promoter of the α-antigen.

[Conventional technology]

Mycobacterium kansasii belongs to the atypical mycobacteria group of slow-growing mycobacteria, like Mycobacterium tuberculosis and BCG bacteria. The number of patients with infections caused by acid-fast bacteria (hereinafter referred to as AM disease) is increasing, but unlike tuberculosis, it is highly resistant to drugs, so anti-tuberculosis drugs are not effective, and it has become a difficult-to-treat infectious disease. In addition, as with tuberculosis, differential diagnosis with lung cancer is difficult based on X-ray images alone, and there is a risk of the two being mixed together.

By the way, α-antigen has been developed by U.S. et al. (Am, Rev, Re5p
ir.

Dis, 92.9 (1965)) was the first to receive the award for tuberculin-reactive protein, which was isolated and purified from the culture supernatant of Mycobacterium tuberculosis, and is a cross-reactive protein widely distributed in other atypical mycobacteria. reacting a+
It has been found that antigenic determinants specific to each bacterial species exist (Am, Rev
, Re5pir, Dts, +130, 647 (1984
), 1bid, 132.173 (1985)).

Therefore, if alpha antigens derived from each species can be obtained in pure form from various atypical mycobacteria, EL using antigen-antibody reactions can be used to differentially diagnose each atypical mycobacterial disease.
It is considered possible to develop diagnostic agents using the ISA method. However, in reality, there are approximately 300 types of proteins secreted by mycobacteria, and it is extremely difficult to purify and obtain large quantities of α-antigen from these proteins.It is therefore difficult to produce α-antigen using genetic engineering techniques. desired.

With the aim of developing a diagnostic agent for tuberculosis, we have already cloned the gene encoding the alpha antigen derived from the BCG bacterium, and have used E. coli transformed with recombinant DNA using this gene to detect the alpha antigen derived from the BCG bacterium. have been successfully produced (J, Bacteriol.

170, 3847 (1988)).

Furthermore, it is believed that the gene encoding the α-antigen, which has antigenic determinants specific to each bacterial species, will be extremely useful as a marker-attached carrier protein gene for recombinant live vaccines using the BCG secretion expression system in the future. It will be done.

The purpose of the present invention is to obtain α-α derived from Mycobacterium kansasii.
A gene encoding an antigen, a recombinant D containing the gene
The present invention provides a method for producing α-antigen derived from Mycobacterium kansasii using a transformant using NA, and a targeted α-antigen polypeptide derived from Mycobacterium kansasii.

[Means to solve the problem]

As a result of repeated research to solve the above-mentioned problems, the present inventors have discovered that the α-antigen gene of Mycobacterium kansasii can be isolated using the already cloned α-antigen gene derived from BCG bacteria as a probe. By separating the gene, determining its nucleotide sequence, and then inserting the gene into an appropriate expression vector, it was possible to produce a large amount of α antigen protein that reacts with anti-α antibodies in E. coli.

The present invention relates to the alpha antigen of tuberculin active protein having the following amino acid sequence:

In addition, the present invention produces the target α antigen derived from Mycobacterium kansasii by culturing a transformant transformed with a gene encoding the protein α antigen and an All 10 plasmid vector incorporating the if gene. Of the α-antigen derived from Mycobacterium kansasii, which is characterized by the ability to stimulate! ! ! ! Regarding the law.

Furthermore, the present invention relates to a signal peptide of the protein α antigen, a signal peptide having the following amino acid sequence, a gene encoding these signal peptides, and a promoter of Mycobacterium kansasii α antigen.

The present invention will be explained in detail below.

Mycobacterium kansasii chromosomal DNA may be prepared by a conventional method. For example, chromosomal DNA can be prepared by the method of Benzu et al. (J, Bacteriol, 169.839 (1).
987)] by a cesium chloride/ethidium bromide density gradient centrifugation method.

The α-antigen gene was cloned using the method of Houzan (J, Mol.

A filter to which DNA fragments are bound can be prepared according to the method of J.D. Bol., 98.503 (1975)). For this filter, the dic translation method [J, Mo1. Bol,, 113.237 (19
A DNA fragment containing an α-antigen gene derived from Mycobacterium kansasii was obtained by hybridizing a DNA fragment containing an α-antigen gene derived from BCG bacteria labeled with an isotope, etc. by 77)) in a conventional manner. can be detected. This DNA fragment was fractionated by agarose gel electrophoresis, DE-81 paper method (J, B
acteriol, 171.3847 (1988)
), separation and concentration can be carried out by appropriately combining fractionation using ethanol precipitation, etc.

This DNA fragment was introduced into the pUc18 plasmid, and the method of Hanahan (J, Mo1.8io1., 166, 557
(1983)), for example, the E. coli strain 5109 strain was introduced into host cells, transformed, and selected (E. coli JM10 strain).
In the case of 9 strains, a DNA library can be prepared by testing them (ampicillin resistant, β-galactosidase activity negative strains).

This DNA library was subjected to colony hybridization using a 32Pg identification probe (Method).
s in Enzymology, 68.379 (1
979)) to screen the target clone.

To determine the base sequence of the α antigen gene, a cloned DNA fragment was prepared from the above clone, and the method of Messing et al. (N, A
, R., 9, 309 (1981)), and the entire nucleotide sequence of the α antigen gene can be determined.

Expression of the α-antigen gene was carried out using the α-antigen gene of Mycobacterium kansasii obtained above.
- To produce α-antigen derived from Kansasi, first, the substantial sequence of the cloned DNA is inserted into a suitable expression vector to produce a recombinant DNA molecule for α-antigen production.

This recombinant DNA molecule is then introduced into a suitable host cell and transformed to obtain a transformed strain. By culturing this transformed strain in a medium, a culture composition containing the α antigen can be obtained.

In the present invention, a combination of a wide range of prokaryotic or eukaryotic host cells and expression vectors can be used to express the substantial base sequence of the cloned α-antigen gene. Preferably, the method is carried out using prokaryotes as host cells. In addition, the expression vector includes a vector containing a replicon and a regulatory function compatible with the host cell, and a promoter necessary for the host cell to express its own protein, or a vector containing a promoter necessary for the host cell to express its own protein. Improved versions are preferred.

The host cell (hereinafter referred to as a transformant) containing the thus obtained recombinant DNA molecule for producing the α-antigen derived from Mycobacterium kansasii can be cultured aerobically in a liquid medium. As the medium, for example, in addition to a normal nutrient medium containing polypeptone, yeast extract, salt, glucose, etc., M9 minimal medium and the like can be used. Cultivation is preferably carried out at 30 to 40°C, and an appropriate inducer is used depending on the promoter used, for example, isopropyl-β in the case of fac promoter.
By adding -D-thiogalactoside to the medium, the efficiency of expression in transformants can be increased.

Note that the following abbreviations are used in the present invention.

A: adenine, C: cytosine, Gnigeanine, T: thymine, kb: kilobase, bp: base pair, DNA: deoxyribonucleic acid, ATP: adenosine triphosphate, dCTP: deoxycytidine triphosphate, EDTA: ethylenediaminetetraacetic acid , DEAE Nidiethylaminoethyl, SDS
Sodium nidodecyl sulfate, SSC: 0.15M
Sodium chloride, 0.015 m Sodium citrate (p
H7,0), Ala: alanine, Leu: leucine, A
rg: arginine, Lys: lysine, Asn: asparagine, Met: methionine, Asp: aspartic acid, Phe: phenylalanine, Cys nidistine, P
ro nibroline, Gin: glutamine, Ser: serine, Glu: glutamic acid, Thr: threonine, Gly
Nigericin, Trp: tryptophan, His: histidine, Tyr: tyrosine, Ile: isoleucine, V
al: valine, I-PTG: isobrobyl-β-D-thiogalactoside, X-gal: 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside [Example] The present invention will be carried out below. This will be explained more specifically using an example.

Example 1 (1) Preparation of Mycobacterium kansasii chromosomal DNA Mycobacterium kansasii ATCC12478 strain was cultured in two-tone medium (composition: 0.4% asparagine, 0 citric acid).
．． 2%, sodium citrate 0.2%, potassium phosphate 0.05%, magnesium sulfate 0.05%, ferrous ammonium citrate o,oos%, glycerin 6%) 1N
The cells were cultured at 37° C., and the cells in the logarithmic growth phase were collected by centrifugation.

The obtained bacterial cells were dissolved in 10mM Tris-HCl (pH 8.0).
, 1mM EDTA buffer (hereinafter abbreviated as TE).

) 5-, add lysozyme 5■ and incubate at 37°C.
The ink was incubated for 5 minutes and then added with 10% SD.
After adding 0.5 m of S aqueous solution, phenol:chloroform:isoamyl alcohol (mixing ratio 25:24:1)
) was extracted three times with 6 m of a mixed solution, 10 m of ethanol was added to the resulting aqueous layer, and the precipitated DNA was wound around a glass rod. This DNA was dissolved in T E 6.611, and 7 g of cesium chloride and 0.0 g of ethidium bromide (5 μ/d) aqueous solution were added.
．． 7m was added and dissolved.

The solution was placed in a centrifuge tube (Quick Seal Tube, manufactured by Beckman, USA) and heated at 60.00 rpm for 6 hours.
After centrifugation for a time, a chromosomal DNA band was collected from the top of the centrifuge tube. This DNA solution was dialyzed against TE,
Desalted and purified Mycobacterium kansasii chromosomal DNA
I got it.

(2) Preparation of probe Plasmid pP-1 (J, Bacteriol
,, 170.3847 (198B) ) 20 g was completely digested with restriction enzymes Pstl and XhoI. This is 1%
After fractionation by agarose gel electrophoresis, the DE-81 paper method (J, Bacteriol, ).

170, 3847 (1988)), PsLI-Xhol fragments of 490 bp and 310 bp were collected, extracted twice with phenol and twice with chloroform, and precipitated by adding 2.5 times the volume of ethanol. After drying this precipitate under reduced pressure, it was decomposed in TE2OJll portions for t8, and the 12m [
10 of “Nic Transleisure Run Kit” (manufactured by Takara Shuzo)
4Ill of double concentration buffer, IJll of enzyme solution and [α
-32p) dCTP (manufactured by Amajam, 3,000Ci
10+! nol) 10. A reaction mixture containing m and distilled water 13111 was reacted at 15°C for 2 hours.

After the reaction was completed, the mixture was extracted once with phenol, and then the aqueous layer was collected. To this, add calf thymus DNA solution (1/mN) 3
011! , 3M sodium acetate 10I11 was added, ethanol was added, the resulting precipitate was collected, and TE Loo
J1! 3gp-labeled probe (probe A:
490bp fragment, probe B: 310bp fragment)
used as

(3) Southern hybridization test (1) above
3 g of the chromosomal DNA obtained was completely digested with the restriction enzyme KpnI and fractionated by 0.8% agarose gel electrophoresis. This gel was shaken for 40 minutes in a 1.5M sodium chloride-0.5M sodium hydroxide solution, and then 3M sodium chloride and 0.5M lys-hydrochloric acid buffer (pH 7,
0) for 1 hour.

Finally, it was shaken for 30 minutes in 200x concentrated SSC.

This gel was soaked with a nylon membrane filter (Gene 5c-r, manufactured by NEN, USA) in 200 times concentrated SSC.
een Plus) was placed on the plate to adsorb the DNA. The filter was washed with 2x SSC and then 1x at room temperature.
It was air-dried for 1 hour and further dried at 37° C. for 16 hours.

Use this filter as a hybridization solution.
5x concentration of Denhardt (0.5% Ficoll 4
0.0.5% polyvinylpyrrolidone, 0.5% bovine serum albumin), 5x SSC, 0.1% SDS solution and calf thymus DNA 10x/ad) for 6 hours at 65°C. , the above hybridization thinning solution 1
3t p 8iJ probe 2 obtained in (2) at 0d
0d was added, and the mixture was allowed to stand at 58°C for 16 hours. The filter was washed at room temperature in 2x 5sco, t% SDS solution.
After washing with shaking for 0 minutes, washing was repeated four times at 60° C. for 20 minutes in a 0.1x SSC solution. After washing, the filter was dried at room temperature and subjected to autoradiography, and the results shown in lanes 2 and 5 of FIG. 1 were obtained. Lane 2 was obtained using probe A and lane 5 using probe B.

On the other hand, lanes 1.3.4 were prepared by digesting chromosomal DNA using BamHI and Pstl instead of KpnIO.
．． 6, lanes 1 and 3 used probe A, lane 1 was obtained by digestion with Bas+HI and lane 3 was obtained by digestion with Pstl. In addition, probe B was used in lanes 4 and 6, lane 4 was obtained by digestion with BamHI, and lane 6 was obtained by digestion with Pstl.

(4) Creation of DNA library ■ Preparation of Kpnr DNA fragment In order to clone the 5,5 kbp Kpn I fragment detected in the previous section, Mycobacterium kansasii,
After chromosomal DNA20x was completely digested with KpnI, it was fractionated by 0.8% agarose gel electrophoresis.

Example 1 DNA fragments ranging from approximately 5.0 to 6.3 kbp
- Collected using the DE-81 paper method in the same manner as (2),
After treatment with phenol and chloroform twice each,
Ethanol precipitation was performed. After drying the precipitate under reduced pressure, TE20
111 to prepare a Kpnl DNA fragment solution.

■Processing of cloning vector pUc18 Plasmid p
Uc18 (manufactured by Takara Shuzo) 4■ was completely digested using 2c units of Kpnl, extracted once each with phenol and chloroform, and precipitated with ethanol. After drying this precipitate under reduced pressure, it was added to a 50mM Tris-HCl buffer. y
-(pH8,4) 194Jl! 1.5 units of alkaline phosphatase (E, Co11C75) was added, and the mixture was reacted at 65°C for 1 hour. Furthermore, after adding 1.5 units of alkaline phosphatase and reacting at 65°C for 1 hour, phenol and chloroform were added for 2 hours.
Extraction was performed several times, and ethanol was added to the aqueous layer to precipitate the DNA. This precipitate was dissolved in TE 40111 and 0.1
Eyebrow/Il! A vector DNA solution was prepared.

■ Creation of recombinant DNA and DNA library (4) - ■ 1! Green Kpnl fragment solution 4J! ! ,(
4) Vector DNA solution 2I11 prepared in -〇 and DN
A solution 38j1 of A ligation kit (manufactured by Takara Shuzo)
! , B solution 6p1 was reacted at 16°C for 30 minutes, and the reaction mixture 20I11 was transformed into fE, coli JM1
09 strains of competent cells (manufactured by Takara Shuzo) 100t1! In addition, it was left to stand at 0°C for 40 minutes, then at 42°C for 90 seconds, and then at 0°C for 5 minutes. This mixture contains 1% Batato tryptone, 0.5% yeast extract, and 0.0% sodium chloride.
L-broth medium 50 consisting of 5% glucose and 0.1% glucose
After adding 0Al, the mixture was left standing at 37°C for 1 hour. A portion of this culture solution was taken, and ampicillin 50trg/I, 0.1mM
IPTG, containing 0.004% X-gal,
The cells were spread on L-agar plate medium (1.5% agar added to L-broth medium) and cultured at 37°C for about 16 hours to obtain white colonies that were ampicillin resistant and did not retain β-galactosidase activity. , used for DNA library creation.

(5) Selection of clones having the α-antigen gene derived from Mycobacterium kansasii Regarding the DNA library of (4)-■ above, in order to select a transformed strain containing the α-antigen gene, the 32P prepared in (2) above was used. A colony hybridization test using labeled probes was performed. That is, a nylon membrane filter (manufactured by NEN, USA, C1olny/Pl)
The transformed bacteria of the DNA library prepared in (4)-■ above was cultured on aqueous 5-cleaner), the filter was treated with alkaline according to the usual method, neutralized with LM) Lys-HCl buffer (pH 7,5), and 1M Tris. −
It was treated with hydrochloric acid buffer (pH 7.5) and 1.5M sodium chloride. Next, a DNA binding filter was prepared by immersing it in twice the concentration of SSC and then drying it at room temperature for 30 minutes and at 37°C for 18 hours.

This filter was subjected to the same operation as the Southern hybridization described in (3) above to select transformants having recombinant DNA molecules containing a base sequence that strongly binds to the probe. Obtained a colony. Plasmid DNA was extracted and purified from this transformed strain, and designated as pKA-52.

(6) Base sequencing of cloned DNA When pKA-52 was cut with various restriction enzymes and analyzed by Southern hybridization in the same manner as in (3) above, it was found that the α antigen gene was found on the 2.0 kbp HLnc II fragment. Therefore, we isolated and purified the 2.0 kbp Hinc U fragment in the same manner as in the preparation of the probe DNA fragment in (2), and subcloned it into the Hinc II site of the vector pUc1B using the dideoxy method. Base sequencing method (Pro, N, A, S, USA, 74.
5463 (1977)), the base sequence was determined. The results are shown in FIG.

Example 2 Mycobacterium kansasii was cultured in a medium, and the α antigen secreted into the medium was purified by various column operations and electrophoresis. When the amino acid sequence near the N-terminus of this purified α antigen was determined by Edman degradation, it completely matched the amino acid sequence deduced from base numbers 390 to 410 of the base sequence shown in FIG. From this result, the DNA fragment cloned in Example 1 contains the α antigen gene, and TTC at positions 390 to 392 corresponds to the N-terminal amino acid I Ph.
It was revealed that TGA 247 corresponds to a stop codon.

In other words, the gene encoding the α-antigen mature polypeptide, that is, the structural gene of α-antigen, corresponds to numbers 390 to 1244 (underlined part in the figure), and the base sequence from 270 to 389 is necessary for secretion of α-antigen. encodes a signal peptide.

The number of amino acid residues translated from the base sequence encoding the α antigen polypeptide was 285, and its calculated molecular weight was 30.644, and the amino acid sequence is shown in FIG.

Also, TCGACA numbers 199-204 and 223-228
The sequence TAAGTT is the promoter of the α-antigen derived from Mycobacterium kansasii and is considered to be an important region for secretory expression together with the signal peptide.

Example 3 (1) Expression of α antigen derived from Mycobacterium kansasii in bacteria Expression vector pKK233-2 (Sweden,
(manufactured by Pharmacia), ptlc18 (manufactured by Takara Shuzo) and chemically synthesized oligonucleotides to produce α-antigen.

The strategy for constructing the α antigen expression vector is shown in FIG. Details will be explained below.

(2) Preparation of chemically synthesized oligonucleotides The following chemically synthesized oligonucleotides were synthesized with reference to the base sequence shown in Figure 2.

Chemically synthesized oligonucleotide: 5' CATGTTCTCTCGTCCTGGTCT
GCCGGTTGAAATACCACCAG3' Chemically synthesized oligonucleotide 2: 5' GCACCTGGTGGTATTCAACCGG
Two oligonucleotides consisting of CAGACCAGGACGACGAGAA3' were each synthesized using an automatic DNA synthesizer (Model 370A, Applied Biosystems, USA).
After synthesis, protective groups other than the dimethoxytrityl group were removed, and reverse phase medium pressure column chromatography (conditions: 0
18-Silica gel.

Purification was performed using a column using a concentration gradient solution consisting of acetonitrile in 100 mM triethylamine acetate buffer (pH 7,0) as a mobile phase.

The dimethoxytrityl group was then removed using 80% acetic acid, followed by reverse phase HPLC (conditions: YMCPACKAM
-3140D S column with 100 m as the mobile phase.
M) Liethylamine acetate buffer y-(pH 7,0
) using a concentration gradient solution consisting of acetonitrile) and lyophilized.

(25 Opmol each of synthetic oligonucleotides 1 and 2 obtained by
M) Lys-HCl buffer (pH 7,5), 10mM
Magnesium chloride, 10mM dithiothreitol, 1m
The mixture was reacted with 15 units of polynucleotide kinase in MATP for 1 hour at 37°C. 50 pmol of each of the reaction mixtures of synthetic oligonucleotides 1 and 2 were mixed, heated at 70°C for 5 minutes, and annealed with gradual cooling to obtain the base sequence 5'-CATGTTCTCTCGTCCTGGTCT.
GCCGGTTGAATAACCACCAG-3'3'
-AAGAGAGCAGGACCAGACGGCCΔ8CTTATGGTGGTCCACG-5'' was obtained.

This adapter is derived from Mycobacterium kansasii.
Supplementing the gene corresponding to the N-terminal Phe' to Gln of the antigen, a B containing part of the α antigen gene is inserted into the Ncol site located downstream of the trc promoter of ρKK233-2.
It has sticky ends for insertion of the an I-Xho I fragment.

■ Treatment of expression vectors pKK233-2 and pUc18 Completely digest pK233-2.10 with restriction enzymes EcoRI and Hind■, and generate an EcoRI-Hindll fragment of approximately 300 bp in the same manner as in Example 1-(2). Isolate and dissolve in TEIO μl. This DNA fragment is t
rc promoter, Iac operator, SD sequence, A
TG start codon and Ncol, Pstr, Hindl
ll, contains the cloning site.

Next, pUc18.5t1g was similarly treated with EcoRI and H
It is produced by digestion with ind■. 2.6kbp EcoR
The r l-1indlll fragment was isolated and TE20IJ
Dissolve in 1. II of each were ligated using a DNA ligation kit in the same manner as in Example 1 (4)-0 to obtain plasmid pUcK10. This plasmid is pKK
It contains the replication initiation region of pUc18, which has a higher number of copies than 233-2.

Digest ρυCKIO151Ig with PstI and incubate at 65°C.
After heat treatment for 5 minutes to inactivate the enzyme, ethanol precipitation is performed. The precipitate was mixed with 9 tll of distilled water and 10x concentrated planting buffer (DNA Planting Kit,
Made by Takara Shuzo) lIl! was added to dissolve, heated at 70°C for 5 minutes, and then left to stand at 37°C for 3 minutes. Add T4 DNA to this solution.
Volime'rase IJ1! After reacting at 37°C for 5 minutes, add DNA dilution buffer 39Ii1 and stir vigorously. After treatment with phenol and chloroform once, ethanol precipitation is performed. Pour the precipitate into 20μ of DNA dilution buffer! 14 and the XhoI linker (2
, 5 pmol/111) 2 Jll in Example 1 (4)
The plasmid pUCK20, in which the PstI site of pUCKlo was converted to the Xhol site, was obtained by ligation using a DNA ligation kit in the same manner as in -■.

■ Preparation of recombinant DNA and transformants Example 1-(6
) plasmid pKA1120 (2,0kb
>10 μ each containing the p Hinc m fragment were digested with XhoI, HindI [[ and Banl5
Xhol Hindll! Fragment and 0.5kbp Ba
The nI-XhoI fragment was isolated and dissolved in 20m portions of TE.

Next, pUcK205i prepared in
The 2.9 kbp DNA fragment was similarly isolated and dissolved in Telojll. 1ill and the 1,1kbp XhoI Hindn [fragment solution 2
I! ! were ligated using a DNA ligation kit in the same manner as in Example 1 (4)-2 to obtain 100 plasmids pUc containing the C-terminal side of the α antigen gene. 1 for this ptlc
0020IIg as Ncol and Xh.

The 4.0 kbp DNA fragment was similarly isolated and dissolved in TE15pZ. 1 μl of that and 0.5k of the above
Approximately 40 pm of annealing mixture of bp Ball1-Xhol fragment solution 2d and synthetic adapter prepared in ①
ol was similarly ligated using a DNA ligation kit,
A direct expression vector pUcK201 was obtained.

This recombinant DNA was transformed into E. coli JM using standard methods.
It was transformed into strain I09. In this way, a transformant containing the &II recombinant DNA ptlcK201^JK
201 (Feikoken Bibori No. 10683) was obtained.

Now, ρuC 201 contains a gene encoding a mature α-antigen, and the transformant JK201 produces the α-antigen derived from Mycobacterium kansasii encoded by the base sequence shown in Table 1 below.

Table 1 ■ Production of alpha antigen by 201 in trait axis IA body ^J AJK
201 and lE containing ucKio, coli JH1
09 strain (abbreviated as JMIO9 (pUcKlO)) was injected into L-Floss 1-11i!5I11 (50I!g/l), respectively.
The cells were cultured overnight at 37°C with shaking in 111 ampicillin-containing medium. Add 0.5 d of this culture solution to a new broth and 50 d of broth medium.
(containing 50x/d ampicillin), and after shaking culture at 37°C for 4.5 hours, IPTO was added to a final concentration of 1 m
M and continued shaking at 30'C for an additional 5 hours. Collect bacterial cells from the resulting culture solution by centrifugation,
The bacterial cells were soaked in 10mM Tris-HCl buffer (pH 7,
0) Suspended in 3rd and sonicated (100 WIO
After centrifugation (1 minute), the supernatant was collected.

A small amount of this bacterial cell extract was prepared using Laemmli's method (Nature 2).
27, 680 (1970)), the results of analysis by 5DS-polyacrylamide gel electrophoresis and Western blotting are shown in Figure 5.As shown in the figure,
In the Western blotting method using anti-α-K (purified α-antigen derived from Mycobacterium kansasii) antibody, JM
109 (pUcKlo) (lane 3) shows no band, whereas AJK201 (lane 2) shows a positive band at a molecular weight of about 30,000, which is almost the same as α-K (lane 1). It was found that type α antigen was expressed.

〔Effect of the invention〕

The antigen protein derived from Mycobacterium kansasii provided by the present invention can be used as a diagnostic agent for Mycobacterium kansasiosis by antigen-antibody reaction (ELISA method).

In addition, the gene encoding the α-antigen of Mycobacterium kansasii provided by the present invention and the method for producing the α-antigen of Mycobacterium kansasii using genetic engineering techniques can be used to treat Mycobacterium kansasiosis and tuberculosis. It is important to provide large amounts of alpha antigen protein, which is useful in identifying lung cancer.

Furthermore, the gene encoding the α antigen of Mycobacterium kansasii provided by the present invention, the signal peptide 7, the gene encoding the same, and the promoter are B
It can be used as a carrier protein gene with a marker (specific antigenic determinant) for developing a recombinant BCG live vaccine using a secretion expression system of CG bacteria.

4. Brief description of aspects FIG. 1 shows Southern hybridization of probe ASB to the digested product of Mycobacterium kansasii chromosomal DNA with restriction enzymes BamHI, KpnI and PstI. Figure 2 shows the determined 1396 bp DNA base sequence. Figure 3 shows the amino acid sequence of α antigen, Figure 4 shows the mature α antigen expression vector pUcK.
201 is a diagram showing the construction of 201. Figure 5 shows JM109 (
FIG. 2 is a diagram showing the analysis of bacterial cell extracts of AJK201 (pUcKlo) and AJK201 by Western blotting.

Claims (6)

[Claims] (1) Tuberculin active protein α antigen amino acid sequence (I) with the following amino acid sequence; [Gene sequence is available] (2) The gene described in claim (1) shown by the base sequence below [there is a gene sequence] (3) A transformant transformed with a recombinant DNA containing a gene encoding an α antigen derived from Mycobacterium kansasii having the amino acid sequence according to claim (1) is cultured in a medium, and production is performed. A method for producing α-antigen derived from Mycobacterium kansasii, which comprises collecting α-antigen derived from (4) The transformant is Escheri hyacoli
α according to claim (3), which is
Antigen production method (5) Signal peptide of α antigen according to claim (1) having the following amino acid sequence [there is a gene sequence] (6) A gene encoding the signal peptide according to claim (5)