JPH02231083A - Recombinant natural killer cell-activating factor - Google Patents

Abstract

PURPOSE:To obtain natural killer cell-activating factor having special amino acid sequence. CONSTITUTION:Natural substance of natural killer cell-activating factor is purified by antibody-column affinity-chromatography and sequence of amino acid part in the natural substance is determined. Next, desired cDNA clone is prepared using cDNA library made from mRNA of human T-cell hybridoma according to specified one amino acid sequence. Then, amino acid sequence of natural killer cell-activating factor (NKAF) is determined as the formula from base sequence of resultant cDNA clone and manifestation of recombinant NKAF is performed, thus activity of the recombinant NKAF is confirmed.

Description

Detailed Description of the Invention [Field of Industrial Application] The present invention relates to genetic recombination technology related to the invention and production of a novel polypeptide that enhances the activity of lysing human tumor cells by natural killer cells (NK cells), and the peptide containing the same. related to medicines.

Therefore, the present invention can be utilized in the field of pharmaceuticals.

[Prior art and problems to be solved by the invention] It is known that natural killer cells (abbreviated as NK cells) exist as cells that act destructively on certain types of cancer cells.
There is interest in lymphokines that affect the activity of these cells.

For example, interleukin-2 and interferon have been shown to induce increased NK cell activity.
Herberman, R.B., et al., I
mmunol. Rev. , 44. 13 (1979
); Vase, B. M. , et al., J.
Immunol, 130, 768 (1983
): DOfullZig. W. ．． et al. , J
．． Immunol. , 130 1970 (1983
)).

NK cells, as a non-specific biological defense system, play important roles such as providing initial protection against cancer cells, suppressing cancer cell metastasis, resisting viral infections, and regulating blood cell proliferation in the bone marrow. [Katsuo Kumagai, Kyogo Ito, Japanese Clinical Research, Spring Special Issue, 42, 859 (1984)]
.

In particular, the important role of NK cells in the body's defense response against cancer suggests that nude mice, which lack T cells but have high NK activity (the activity of NK cells to destroy cancer cells), have spontaneous cancers and chemical reactions. The frequency of carcinogenesis caused by carcinogenic agents is not necessarily high.1: Rygaard J. , et
al. , Immunol. Rev,,28. 43
(1975); Stutman D. , et
al., Science, 183. 534 (19
74)] and beige mice that have T cells but genetically low NK activity [Kazuo Shimamura, Kenichi Tamaki, Experimental Medicine.
2. 398 (1984); James B. ,T
almadge, et al. , Nature,
284. 622 (1980)) and mice in which NK activity was artificially reduced [Kazuo Shimamura, Kenichi Tamaki, Jikken Igaku, 2, 398 (1984)], the metastasis of transplanted cancers is accelerated.

Shitara et al. have reported that NK cell enhancing factors different from interleukin-2 are produced and released from thymocytes in mice (Sitara.K., 0, Ichim
ura, T. Mitsuno and T. Osaw
a, J. Immunol. , 134. 1039 (
1985)].

Some of the present inventors assumed the existence of lymphokines that activate NK cells, and established several cell lines for lymphokine-producing human T cell hybridomas.
The existence of lymphokines such as IF (macrophage migration inhibitory factor) and MAF (macrophage activating factor) has been clarified [Kobayashi, Y. et al. , Asad
a, M,, }Iiguchi, M, and Osaw
a, T,, J. Immunol. , 128. 27
14 (1982); Asada, M. , High
uchi, M. , Kobayashi, Y., and
Osawa, T., Cell, Immunol. ，
77, 150 (1983): Higuchi,
M., Asada, M., Kobayashi, Y. a
ndOsawa, T. , Cell, Immunol
．． , 78. 257 (1983)).

In particular, if human T cells are treated with keyhole limpet hemocyanin and a human T cell hybridoma is obtained using this as a starting cell, the hybridoma will contain a completely novel NK cell activator (hereinafter referred to as NK cell hybridoma) that is different from known lymphokines.
It was discovered that the present invention produces AF (abbreviated as AF), and was previously disclosed as an invention in JP-A No. 61-97224. In addition, in the invention of JP-A-61-97224, the obtained NKAF itself is a natural product, and the amino acid sequence as a peptide was not clear.

By the way, in order for NKAF to be industrialized as a medicine, the amino acid sequence as a peptide needs to be clarified and it needs to be mass-produced as a recombinant product using genetic recombination technology.

The present inventor undertook research with the aim of isolating and identifying NKAF that enhances the activity of NK cells, and obtaining its gene.

That is, first, as a first means, the NKAF natural product of JP-A No. 61-97224 is purified and its partial amino acid sequence is specified, and as a second step, the NKAF natural product of JP-A-61-97224 is purified based on the sequence. A designated cDNA clone was extracted from a cDNA library created from the mRNA of a human T cell hybridoma in 2 2 4, and finally
The objective of the present invention was to obtain a KAF recombinant.

[Means to solve the problem]

As a first step, the present inventors solved the above-mentioned problem by using antibody lumen affinity chromatography.
The AF natural product was purified and its amino acid partial sequence was identified.

Next, based on the single identified amino acid sequence (KR-21), we determined the mR of human T cell hybridoma (C-108).
Select a given cD from a cDNA library created from NA.
I picked up the NA clone. Next, from the base sequence of the obtained cDNA clone, pNK8308, the amino acid sequence of NKAF was identified as described below, and the recombinant NK
AF was expressed and its activity was confirmed.

Based on the above findings, further studies were conducted and the present invention was completed.

The details of the present invention will be explained below.

〔composition〕

The recombinant NKAF of the present invention contains, for example, an amino acid sequence represented by the following primary structural formula (hereinafter referred to as the amino acid sequence according to the present invention) in its molecule.

LeuH isLeuArgSerG 1uThrSe
rThrPheG 1uThrProLeu9n ^1aValG1uSerlleSerValProA
spMetValAspLysAsnLeuThrCy
sProG1uG1uG1uAspThrVaILys
VaIVaIGlyq0 TyrArg I 1eG 1nCysSerVa I
SerA 1aLeuAsnG 1nG 1 yG I
nValTrplleGlyG1yArglleThr
G1ySerG1yArgCysArgArgPheG
1nTrpValAspG1ySerArgTrpAs
nPheA1aTyrTrpA1aAlaHisG1n
ProTrpSerArgG1yG1yl{iscys
Val1qn The final target substance of the present invention can be produced by genetic recombination technology.

Therefore, cDNA1 encoding the recombinant NκAF of the present invention
Any expression plasmid obtained by containing DNA as a foreign gene and ligated to enable control and expression in a selected host is an intermediate material necessary for the production of the final target substance of the present invention. Both inventions can be integrated in the sense that they solve the same problem.

In addition, hosts transformed by the expression plasmid may also be c
Like DNA and expression plasmids, they can go together as an invention. E. coli, yeast, and animal cells such as BHK cells and CHD cells are used as hosts.

XLI-Bl is one of the E. coli strains that possesses cDNA.
Those identified and displayed by ue/pNK 8308B can be mentioned. This will be shown in Example 1 below and has been deposited with the Institute of Fine Technology.

The accession number is FεRM P-10161 (FERM BP
-2468).

The recombinant NKAF of the present invention, which is the final target substance, has antitumor activity as shown by the experimental examples described below.

Therefore, just as natural NKAF becomes an essential active ingredient of a pharmaceutical composition and can be provided for medical purposes utilizing its activity, the recombinant NKAF of the present invention can also be used as a pharmaceutical for therapeutic purposes utilizing its activity. It can be an essential active ingredient of the composition.

In this case, the pharmaceutical composition is mainly an injection;
Administered intravenously.

In order to manufacture it as an injection, it may be carried out according to the conventional method when making a trace amount of physiologically active substance into an injection.

Therefore, for example, the recombinant NKAF of the present invention alone or together with appropriate excipients and solubilizers is made into an aqueous solution, sterile-filtered, filled, and lyophilized, and an aqueous solution for dissolution is added to prepare a ready-to-use injection. do it.

〔Method〕

A method for producing and measuring natural NKAP will be explained.

1. Production of purified natural NKAF In producing recombinant NKAF, first, natural NKAF is
Purification and structural analysis were performed as follows.

Human T cell hybridoma KC that produces natural NKAF
Various methods such as ion exchange chromatography, gel filtration chromatography, affinity chromatography, high performance liquid chromatography, etc. Natural NκAF can be purified by

By determining the N-terminal amino acid sequence of this purified NKAF and the amino acid sequence of the purified NKAF fragment peptide enzymatically digested with tribucin, cDNA cloning becomes possible.

The enhancement effect of NKAF on NK cell activity was measured using plastic non-adherent human peripheral blood lymphocytes (abbreviated as plastic non-adherent PBL) in human cancer cell line K-
The activity of destroying 562 cells (NK activity) can be measured as an indicator. That is, RPMI-1640 medium containing 10% fetal bovine serum (10% FCS-RPMI-
1640) was diluted 2 times serially into a 96-well microplate, and then added to 1 x 10 s of plastic non-adhesive PBL/50 μl at 37°C.
Cultured for 6 hours. K-56 labeled with SICr
Add IXIO' cells/100 μl of the 2-cell solution, and further culture at 37° C. for 4 hours.

Separately, 100 μl of 10% FCS-RPMI-1640 medium was prepared as a control, cultured for 16 hours, and S
Add 100 μl of ICr-labeled κ-562 cell solution and culture for an additional 4 hours. Next, 100 μl is taken from this and free sICr is measured.

The activity of NKAF can be defined as IU as the activity showing 50% enhancement of the maximum enhancement effect under these conditions.

C-a However, in the formula, b is the free Cr (cpm) related to the sample.
, a indicates free Cr (cpm) for the control, and C indicates total Cr in K-562 cell fluid (10'/mi') labeled with SICr.
(cpm). Note that the average value of three measurements is determined.

An example of the production of natural NKAF is shown below.

■ Purification of natural NKAF human T cell hybridoma KC8-1-10 C-10
8 strains in an IH glass jar at 10% FCS-RPM
[-1-2xlO' cells/m in -1640 medium
It was grown to 1.

After culturing, the cells were collected by centrifugation, washed with RDF medium, and then suspended in RDF medium to give IXIO'cells/rITl.

Continuous culture was performed in a glass jar at 37°C for 14 to 20 days.

The supernatant was continuously exchanged at a rate of 10 l/day, and the culture supernatant containing NκAF was purified by the following method.

Serum-free culture supernatant 200! ! Glass fiber filter paper GF/F
(Whatman Inc,) to remove cell debris, and then a Sepabeads SP-900 column (
Mitsubishi Kasei gel vol 2j! ), 25 I! /
Hydrophobic low-molecular substances such as phenol red were removed by elution at a flow rate of Next, pool the fractions that passed through the column,
After adjusting the conductivity of IQmM7ris-HCI buffer (pH 8) containing 0.2M NaCl, 0.2M N
aC1-containing 1 (lmM Tris-}ICI buffer (p
DEAE-Sepharose column (Pharmacia get vol 21) equilibrated with H8) at a flow rate of 12 l/h, and after washing the column with the same buffer,
Elution was performed with 1QmM Tris-HCI buffer (pH 8) containing 0.6M NaCl.

Elution fraction 4I with NKAF activity! Ultrafiltration membrane (Y
It was concentrated about 1000 times on M-Milk (Amicon). This concentrated fraction was collected at O.O. IM NH. The mixture was treated with a Sephadex G-75 gel filtration ram (Pharmacia, 50 φ x 900 mm) equilibrated with an aqueous HCO3 solution at a flow rate of 100 l/hr to remove high molecular substances such as nucleic acids, and the active fractions were pooled. Collect this active fraction (approximately 900 mj2)
After concentrating about 20 times on a YM-5 membrane, freeze-drying was performed.

This lyophilized product was mixed with O, LM CH, COONa buffer (1)85)/O. LM Ha2So. Buffer solution (p}
15) = 1/1 solution dissolved in 5rnl.

This solution was added to a preparative Phenyl-5PW-RP power ram (
Tosoh, 21.5φX150mm).

0.0 as an elution solvent. IM CHsCDDNA buffer (p
}15)/O. IM Na, SO4 buffer (pH 5.
0) = 1/1 as elution solvent A, A/CH.
Let CN = 1/1 be the elution solvent B.

Elution conditions were such that elution solvent B was linearly increased from 0% to 100% over 3 hours to elute NKAF.

That is, under these conditions, the main active fraction was eluted at a retention time of 100 to 110 minutes, and a portion was also eluted at 110 to 140 minutes.

It was confirmed by EIA that these active fractions react with the monoclonal antibody described below.

Therefore, the main active fraction eluted at a retention time of 100 to 110 minutes was collected and lyophilized to obtain partially purified natural NKAF.

■ Preparation of monoclonal antibody against natural NKAF and its column The partially purified natural NKAF obtained by the method in section (■) was used as an immunization antigen, mixed with Freund's complete adjuvant to prepare an emulsion, and 0.2 mi' per mouse was prepared. The mice were immunized by intraperitoneally administering each drug three times.

Next, this partially purified natural NκAF was administered to the mice through the tail vein, and 3 days later, the pancreas was removed.

Pancreatic cells obtained from this pancreas and mouse myeloma cell X63
-Ag 8, 6, 5. 3 (Flow Lab)
and 45% polyethylene glycol-3350 (Si
gma).

Below, the usual method CG. Galfr'e and C
．． Milstein, et al., Method
s in Bnzymology, 73. 3 (19
The fused cells were grown according to 81)).

Two types of fused cells that produce antibodies that absorb NKAF activity1
9-8-7. 29-C-8 was selected.

The obtained fused cells were intraperitoneally transplanted into mice that had been intraperitoneally administered with 0.5 mf of pristane (Aldrich) more than one week before, and the accumulated ascites was collected.

Two types of monoclonal antibodies (29-C-8.
) are all IgG. Met.

Next, protein A-agarose (Rebrigen) was used to purify it, and this was purified using Promcyan-activated Sepharose 4B.
(Pharmacia) to create an immobilized monoclonal antibody gel.

2. Structural analysis of highly purified natural NKAF (SephadexG-75
The active fraction was subjected to affinity chromatography using a gel immobilized with the monoclonal antibody prepared in section (■), and the active fraction was collected (see Figure 1).

This product is highly purified natural NKAP, and its specific activity was approximately 1 x lO'U/mg protein.

The following properties were analyzed using this product.

■ Amino acid composition analysis After drying the desalted natural NKAF at the bottom of a small test tube for hydrolysis, place it upright in a glass vial, inject 500 μl of 6N}IC1 into the bottom of the vial, reduce the pressure of the entire vial, and heat at 110°C. Hydrochloric acid hydrolysis was carried out for 24 hours. This NK
AF hydrochloric acid hydrolyzate was analyzed using an amino acid analyzer (Beckman
The amino acid content was measured using System 6300 Amino Acid Analyzer.

The results are shown in Table 1.

Table 1 Amino Acid Analysis ■ Sugar Composition Analysis The neutral sugar content was determined by the orcinol sulfuric acid method and was approximately 120 μg/mg protein. Further, the uronic acid content was determined by the carbazole sulfuric acid method and was approximately 300 μg/mg protein.

Next, a sugar composition analysis was performed, and the results were as shown in Table 2.

From the above results, it was confirmed that this is a glycoprotein containing a large amount of 0-glycoside type sugar chains (mucopolysaccharides and mucin type sugar chains).

Table 2 Sugar composition analysis ■ Snake! Quantification of Nκ8F by 8 Of the two monoclonal antibodies, 29-C-8 was used as a well.
Add coat L and NKAF after washing to L, react for 1 hour at room temperature, wash, and add the other monoclonal antibody 19-8.
Add biotinylated -7 and react for 1 hour at room temperature, then wash. Next, add ^vidin-peroxidase and react for 30 minutes at room temperature, then wash. Add the substrate orthophenylenediamine solution and allow color development at room temperature. IN after 15 minutes
}Stop the reaction with ICI and read 00492 with a plate reader.
The absorbance was measured. The calibration curve is shown in FIG.

■ Removal of sugar chains Since NKAF has many sugars, we investigated methods for removing sugar chains for amino acid sequence analysis.

Analysis was performed using SOS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) silver staining method and Wes
This was performed using the tern-1 mm munoblotting method. That is, desalted purified NKAF was treated with sialidase, 0
- Treated with glycanase, chondroitinase, and heparitinase, and examined whether sugars were cleaved by SOS-PAGE. did.

With heparitinase, there was no change before and after the reaction, and with sialidase and 0-glycanase, the main band became lower in molecular weight, but the smear did not disappear. When chondroitinase was used, the smear disappeared and a main band appeared at 35KO. This band is Western Immunoblo
It was confirmed that the antibody reacted with anti-NKAF monoclonal antibody and rabbit anti-NKAF antibody by tting. Furthermore, the activity was maintained by chondroitinase treatment.

After desalted purified NKAF was subjected to reductive lupoxamide methylation, it was treated with 100mM Tr containing 0.5U of chondroitinase.
is-HCI (pH 8), 30mM CHsCOON
The chondroitin sulfate was cleaved by dissolving it in A and reacting at 37°C for 60 minutes.

This reaction product was analyzed by reverse phase HPLC (column was VydacC4
, 0.1% TF^ (trifluoroacetic acid) as a solvent /
CH. CH in CN system. CN linearly from 0% to 100% 3
1 in 0 minutes. (Flow rate of 5rnl/min) (Figure 3
reference).

Fr. on the chromatogram in FIG. 1 and Fr, 2 SOS
- When PAGB was performed, as shown in FIG. 4, Fr,1 became a 35κD monoband, and Fr,2 became a smear band of 35κD or higher. Fr, 2 in 50mM Tris-HCI (pH 9) containing 6M guanidine hydrochloride
1: When dissolved and subjected to reverse phase 11PLc, Fr. 1, so Fr. 2 is Fr. It is estimated that this is an aggregation of 1.

(2) N-terminal amino acid sequence analysis N-terminal amino acid sequence analysis was performed using Fr, 1 in Figure 3, and the N-terminal 28 residues starting from leucine were determined as shown in the following formula.

Leu-His-Leu-Arg-Ser-Glu
-Thr-XXX-XXX-Phe-Glu-XXX-
Pro-Leu-Gly-Ala-Lys-Thr-L
eu-Pro-Glu-Asp-Glu-Glu-Th
r-Pro-Glu-Gln8, 9. For the 12th residue, no amino acid appears, and the S attached to the 〇-glycoside type sugar
Et or Thr.

■ Peptide mapping of natural NKAF enzymatically digested with trypsin Fr. 1 was dissolved in 0.1 M ammonium bicarbonate (p}18) containing 2 M urea, trypsin was added, and 3
The reaction was carried out at 7°C for 16 hours, and after the reaction, reverse phase HPLC (column: Vydac C4, solvent: 0.1% TF^/C
H. CH in CN system. CN was purified linearly from 0% to 60% in 1 hour at a flow rate of 1.5 mi'/min.

The resulting 21 peptide fragments were subjected to amino acid analysis and amino acid sequence analysis (see Table 3).

The amino acid sequences of each peptide were all identified on the cDNA sequence of recombinant NκAF described below (see FIGS. 5 and 6).

■ C-terminal amino acid sequence tribucin cleavage peptide with 0. 0.02M calcium chloride. The non-adsorbed fraction was collected on an anhydrotribucin agarose column equilibrated with 05M sodium carbonate (p}15), and the C-terminal peptide fragment was separated under the reversed-phase HPLC conditions described above (see FIG. 7).

Amino acid sequence analysis revealed that ^rg-eu-P
It was determined to be ro-Phe-1 1e-Cys-Ser-Tyr, which matched the amino acid sequence of KR-17.

〔Example〕

Based on the amino acid sequence of the tryptic ice-thawed fragment of the purified natural NKAF sample described above, the base sequence of mRNA encoding NKAF is estimated, and a DNA oligomer corresponding to it is synthesized. Next, a cDNA library derived from C-108 cell mRNA was screened by hybridization using this oligomer as a probe to select a cDNA clone having a sequence encoding NKAF.

The invention will be explained in further detail by the following examples.

Example 1 (1) mRNAO isolation RPMI-1640 medium, PIIIM (Poke1 lead Mitogen manufactured by GIBCO) 4 μi/
1.2 x 109 cells of KC8-1-10 C-108 strain stimulated for 8 hours at one time were collected and incubated with method C of Chirgwin et al.
Chirgwin, et al. , Bio-che
mistry, 18. 5294 (1979)] was used to extract RNA.

5. Add 3 volumes of extract to 1 volume. 7M C. CI-0. 1M
Layer it on the EDTA solution and place it in an ultracentrifuge (SRP 2).
8 SA rotor (Hitachi) and centrifuged at 2600 rpm for 36 hours at 25°C, RNA was recovered as a pellet.

The obtained RNA was added to 10mM Tris-HCI buffer (
pH 7.4), ethanol was added, and the mixture was left at -70°C for 1 hour. Next, RN^ precipitated by centrifugation was
It was dissolved in 0mM Tris-HCI (pH 7.4), and 0.5M KCI was further added.

This was applied to an oligo(dT) cellulose force ram (20 mmφ x 150 mm) equilibrated using the same buffer solution,
After thorough washing with 0.5M KCI and 10mM Tris-HCI, remove mRNA with 1QmM Tris-HCI aqueous solution.
was eluted.

500μg of C-108 cell-derived mRNA at 50mM
Tris-HCI (pH 7.4), 0.2M Na
C1, 15ml of a solution containing 1mM BDTA and forming a 10% to 28% sucrose concentration gradient! and centrifuged at 2600 rpm at 20° C. for 16 hours using an ultracentrifuge (SRP 280-tar, Hitachi).

Next, the mixture was fractionated into 500 μβ portions, and ethanol was added to each fraction to precipitate mRNA.

Each fraction of mRNA was dissolved in sterile water, and the mRNA concentration was 1 μg.
/ml! It was prepared as follows.

From about 2kb to Q. Fractions mainly containing mRNAs up to 5 kb in size were collected and subjected to cDNA synthesis reaction.

(2) Creation of CD N A library b. Gu
The method of Gubler et al.
, Gene, 25, 263 (1983)].

That is, using 1 μg of purified mRNA, Amersham
cDNA synthesis kit (code number RPN 1256)
)'E-used.

Nihonchin cDNA was purified by gel filtration using a Sepharose CL-6B column, and then purified using the modification enzyme BcoR.
Methylated using I methylase. Methylated c
A BcoRI linker (pGGAATTCC) was attached to the DNA, and the DNA was cut with εcoRI to create EcoRI sticky ends. This cDNA was subjected to gel filtration using a Sepharose CL-6B column to remove excess BcoRI linker.

This purified cDNA was combined with λgt 11 that had been cut with BcoRI and treated with phosphatase (molar ratio 0.8:
1), packaged into phage particles and 8XIO'
cD consisting of ~1.4 XIO' independent clones
Obtained NA library.

This phage was plated on 10 plates with a diameter of 15 cm, and the phage was multiplied to 1×10”pfu/m
j! Phage solution 160mf! I got it.

Approximately 90% of the library had inserts, and 8 out of 10 randomly selected clones had inserts of 300 bp to
It contained inserts up to 2 kbp. The average size of the inserts was 1.2 kbp.

(3) Preparation of DNA probe Tryptic hydrolyzed fragment of natural NKAF KR-21
(W-N-F-A-Y-X-^-A-H-Q-P-W
-S-R) (7) 7 A probe corresponding to the sequence of the first 12 residues starting from tryptophan and ending with tryptophan among the 7 mi/acid sequences was prepared.

Unidentified residues in the middle of this sequence (indicated by
It was assumed that That is, assuming that this residue has a sugar compound attached to it, it would be Set or Thr, but as the amino acid composition analysis showed that Thr was not present, a probe was prepared assuming that it was Ser.

On the other hand, consideration of codon usage frequency of human genes (R.
Lathe, J. Mol, Biol. , 183.
1 (1985)), the sequence of mRNA encoding KR-21 was deduced, and a DNA hybridization probe PKR-21 consisting of 36 nucleotides complementary thereto was designed.

The sequence of PKR-21 is 5' CCATGGCTGGTGGGGCAGCAGAG
TAGGCAAGTTCCA 3', and its synthesis was performed using an automatic DNA synthesizer (AppliedElosyst).
ems). This probe was phosphorylated using γ-1''P-ATP and T4 polynucleotide kinase according to a conventional method to introduce a label.

(4) Identification of cDNA clone containing NKAF coding sequence λgt11 cDNA library approximately 160. 0
00 recombinant phages were screened by DNA hybridization method using 32p-labeled PKR-21 probe.

Approximately 16,000 recombinant plaques were generated on each of 10 10×14 cm square plates, and then processed using a conventional method (T.Man).
iatis, et al, “Molecular
Cloning'320-321p. Cold S
Pring Laboratories (
(1982)), the DNA was transferred onto a nitrocellulose membrane and denatured and immobilized.

These membranes have 6 x SSC (1 x SSC=1
50mM NaCl. 15mM sodium citrate<
pH7)), 50mM sodium phosphate (pH7)
, 5 x Denhardt's (100 x Denh
ardt's = 2% bovine serum albumin, 2% polyvinylpyrrolidone-2% ficoll), and prehybridized for 2 hours at 58°C in a 100 μg/calf thymus DNA solution.

Then 32p in 6X SSC, 50mM sodium phosphate (pH 7), 5X Denhardt's
-Label PKR-21 Blow. Hybridize with 6 x SSC-50 at 58°C for about 12 hours.
2 x 10 min washes with mM sodium phosphate at room temperature, 5
Two washes for 30 minutes at 8°C and one wash for 45 minutes at 65°C.
After 2 cycles, PKR-2 was detected by autoradiography.
A clone hybridizing with 1 was detected.

Approximately 30 separate plaques hybridized with PKR-21. Among these, each cD from 4 clones
Excise NA with 8coRI and create plasmid vector pB
ILIescript @ KS, M13” (Str
pNκ83
02, pNK 8303, pNK 8306, pNκ8
308 (FERM P-10161 (FER) deposited with FER
MOF-2468)) was obtained.

A part of the base sequence of these cDNA inserts was
eoxy chain ter + nination method [
A. Smith, Method in Bnzymol
, 65, 560; F. Sanger et al.
,, Proc, Nath. Acad. Sci. ，
74. 5463 (1977)), all of which encode the amino acid sequence of NKAF.
It was found that there were 8 cDNs of various lengths including .

Their restriction enzyme cleavage maps are shown in FIG.

Among these, the longest cDNA (pNK 8308) has a sequence of 850 bp excluding poly(A), and contains a 666 bp open reading frame that starts from the start codon and encodes <222 amino acid residues without interruption. (ORF) exists (see Figure 9). In this GRF, the peptide sequence of κR-21 is from 164w to l.
ff? It was identified as a fragment leading to R. However, in KR-21, the unidentified X was not S but W.

All other tryptic ice-melting peptide sequences are in this O
It was confirmed that this cDNA was derived from mRNA encoding NKAF.

The N-terminal amino acid sequence of the NκAF purified sample is LL-2H.
-3L4R... However, the polypeptide encoded by this pNK 8308 cDNA has an additional 16 highly hydrophobic sequence in front of this N-terminal sequence. Shown.

This is a signal sequence for secreting NKAF to the outside of the cell, and is cleaved during secretion to initiate maturation from the IL.
It is thought that re NKAF occurs.

Example 2 Expression of cDNA by COS7 cells pcD vector (Okayama, H. and P.B.
erg,,Mol. Cell, Biol. , 3
．． 280 (1983)) has the DNA replication origin and early promoter of the SV40 virus, and by integrating cDNA downstream of this promoter, the SV40 T
Antigen-producing cell line COS7 [Y,Gl
Utzman, Cell, 23. 175 (1
981)), amplification of this recombinant plasmid occurs and strong transient expression of cDNA occurs.

Full-Length cDNA clone pN
B including all coding regions from K 8308 B
gl I[-Xho I fragment was excised and Xho I
+ pcDV 1 vector cleaved with Hind m [”F
．． Sanger et al. , Proc. Nath
, Acad, 9ci,, 74. 5463 (19
77)], was ligated with the old ndII[-Bam I fragment of pL1 to create pNK 8602 (
(See Figure 10).

This operation integrated the cDNA downstream of the promoter in the correct orientation.

Prepare plasmid DNA of pNκ8602 and DEAE
-deXtren method (T, Yokota et al1
Proc, Natl. Acad, Sci., 82
．． 68 (1985)), the transformed cells transfected into COS7 cells produced NκAF in the culture supernatant from about 1 day later, and continued to produce NκAF for about 5 days (see Table 4).

In addition, as a medium, either OojA supplemented with 5% FCS or serum-free HL-1 medium could be used (see Table 5).

Table 5 NKAF in the culture supernatant of C[lS7 cells transfected with pNK8602 (cultured for 6 days) Quantification by BIA using monoclonal antibodies Example 3 Expression of NKAF in clear mammalian cell lines Obtained in Example 1 pNK8602 and pSV,-dhfr (S.S.
ubraman5 R. Mulligan, P. Be
rg, Mol. Cell, Biol, Yu. 854
(1981)) with Electro poration
method (Bio-Rad, Gene Pulser ■0.
4kV/0.4cm. 500pF. 10-15ms
ec, twice) or the calcium phosphate method (ptIa
B) IK cells (ATCC, CRL 1632 t) using Rmacia, Kit Cell Phect
K-tsl3, co-transfer to Dainippon Pharmaceutical)
ction L, methotrexate (MTX) 250
A MTX-resistant clone was obtained by nM selection.

These clones have approximately 100-1.000 ng/mf
f rNKAF was produced in the culture medium (see Table 6). -dhfr and pSV
2-neo (P.J.Southern & P.Be
rg, J, Mol. Appl, Gent, 1.
327 (1982)], as well as the calcium phosphate method (Kao, F.T., and T.T., Puck,
Proc, Nath. Acad, Sci. , 60.
Cl{0-Kl
co-tran to cells (ATCC CCL 61)
A neo-resistant clone was obtained by selecting with G-418 of sfection L/, lmg/1.

Next, this clone was further cultured in a medium containing 5 μM MTX to obtain a clone producing about 30 to 400 ng/1 of rNKAF (see Table 7).

Example 4 Expression of NKAF by large intestine 1. Preparation of expression plasmid ON8, which encodes the mature protein by removing the signal sequence from NKAF cDNA, was prepared, and this was inserted into the P of λ phage.
Vector pBR 3 is inserted between the L promoter and the rrnB terminator in the large intestine to maintain a stable high copy number.
22 Expression plasmid pNκ80 bound to d-rop
01 was constructed.

1) Construction of pBRD 5001 (see Figure 11) pB
RD 5001 is lymphotoxin expression plasmid pTT
A part of the vector of 5001 (Japanese patent application No. 62-272034) was converted into pBR 322 d-rap (Japanese patent application No. 62-272
034) is expected to be able to stably maintain a high plasmid copy number. This expression hector is p
It has the trc promoter and rrnB terminator derived from KK 233-2 (Pharmacia).

2) Construction of pPL9-5001 (see Figure 12) Next, a plasmid was constructed in which a portion of the promoter of pBRD 5001 was converted into the PL promoter of λ phage. p
BCO
It was cut with R I and Hpa I, and a 470 bp fragment containing 0% PL protein was fractionated. This was cut with {IfleIII} and a fragment of approximately 265 bp containing the promoter was separated, and the following synthetic SO sequence DNA fragment 5゜TT88CAACTAAAGGAGG8
3゜3゜ AATTGTTGATTCCTCCTCT
AG 5゜totomoni, BcoR I toBgl It
The cleaved pUG131 plasmid (puc 13
(Fanolemacia) po Iy 1 inker part M 13 tg 131 (Amersham) polyl
Blasmid replaced with inker part (patent application 1986-
272034) ) to obtain pPL9. pBR
D50 (11 was cut with ECQR I and Bgl I to remove the approximately 300 bp fragment containing the trc promoter, and pPL9 was cut with BcoR I and Bgl II to obtain the (PL promoter + SIll) fragment (about 280 bp).
p) was inserted to obtain pPL9-5001.

3) Construction of pBRD 702 (see Figures 13 and 14) The base sequence encoding 28is3Leu of NKAF cDNA was mutagenized in vitro.
CAT. : Converted from TA to CACTTA.

This introduced a new Afln cleavage site.

By excising this mutant NKAF cDNA with ^fl[, an NKAF cDNA fragment containing no signal sequence was obtained. A synthetic DNA linker having a Bgl II cleavage sequence, an initiation codon, and a 'Leu'His sequence was inserted in front of this fragment, and pB8 7084 (Japanese Patent Application No. 63-253
302) to the vector fragment (BglII-Sal I) (see Figure 13). In the obtained pENK 702, NKAP cDNA without a signal sequence is connected downstream of the trc promoter via the Bgl m site. Next, Bgl II-PVU I of pBRD5001
Vector fragment and Bgl II-Pvu of pENK702
By joining the I NKAF cDNA fragment, p
To obtain BRD 702, see Figure 14).

4) Construction of pNK8001 (see Figure 15) pPL
9-5001 was cut with Bgl II, then Hind
It was partially cut with I[I and separated by agarose gel electrophoresis to separate the vector fragment containing the promoter and terminator.

On the other hand, pBRD 702 was cut with BglII and old ndI to separate the NKAF cDNA fragment, and the above vector fragment was ligated to obtain pNK 8 (101). Promoter-mature NKAF cDNA-rr
An expression plasmid with an nB terminator was constructed. The following expression experiment was conducted using pNK8001.

2. Expression of NKAF in E. coli ε. coli
N 4840 Cl 857 has a high temperature sensitive lambda repressor mutation, and by shifting the temperature to high temperature, P
Induction of the L promoter occurs.

pNK 8001 and its equivalent lymphotoxin expression plasmid pPL9-5001 were transformed into N4840 strain to obtain ambicillin-resistant transformants at 30°C.

These transformants were cultured with shaking in LB medium at 32°C for 00s. . = approximately 0.2 (t
ime D) The temperature was shifted to 42°C and the culture continued.

Culture fluid was sampled at each time point after the shift and subjected to analysis.

10 bacterial cells equivalent to 0Dsoa (if OD = 1, 10 mL of culture medium
mji minutes) was collected by centrifugation and mixed with 0.4rd disruption buffer (0.2M Tris pH=7.6.0.2M N
aCl, 0. OIM Mg・acetate}. 0. O
IM 2-mercabutoethanol, 5% glycerol)
After suspending in
Measured by IA.

The results are shown in the table below. Production of NKAF is pNK800
1, and its expression was induced by temperature shift. Production peaked 3-5 hours after shift.

pNK8001 3 5 26 33
19 ng/ml Example 5 Yeast (Saccharomyces cerevisi)
Expression of NKAF in ae) 1. Preparation of secretion expression vector DNA encoding the mature protein from NKAP cDN^ without the signal sequence was inserted into the GALT promoter. at
It is inserted downstream of the pha-prepro signal sequence and binds to Yap 13, which has a replication origin of 2 μm.
Secretory expression vector pYNκ1902 was obtained.

1) Construction of pTN 1071 (Figure 16) pTN 1
071 is the GAL7 promoter (JP-A-60-248
181) and synthetic GLIGO #01 and alpha-prepro signal sequence (Her
skow itzet al,, Cell, 30
．． 933-943. 1982) was inserted into pUc12. This vector is native
Since the start codon ATG is located at the same location as GAL7, a high transcription amount can be expected.

2) Construction of pYNκ1902 (Figure 17) pTN1
εcoR I-HindIII fragment of 071 and Bgl II-Xba I75 of pNK 8308
Synthetic OLIGO #02 to M13 mpl9 (Messinget al,,
Gene, 33. 103-119. 198
5) II, coRI. It was inserted into the XbaI site (pM 1901).

Using this phage as a template, synthetic O
In vitro mutag using LIGO #03
enesis (pM 1902). As a result, DNA encoding the mature protein of NKAF was added immediately after the alpha-prepro signal sequence.

At the same time, the AflII site could be inserted without changing the amino acid sequence. This pM 1902 was cut with Ram}II, and the fragment was extracted with Bamtl of YBp 13.
(The pYNK 1902 that was created by inserting it into the site
It is. Since this plasmid has the GAL7 promoter, high transcriptional expression can be expected only when there is no glucose in the medium and galactose is present.
a-prepro signal sequence into the medium
Secretion of KAF can be expected.

2. Expression of NκAF in yeast pYNK 1902 was expressed using the Lithium method (Ito at
al. , J. Bacteriol,, 153.
163-168. (1983), yeast εHA
-IC and EHF-2C (Table ■) were transformed. The obtained transformant was cultured with shaking at 25°C in a selective medium without leucine, the C source was changed from glucose to galactose, the temperature was raised to 34°C, shaking culture was continued, and sampling was performed at appropriate times. . The sample was separated into bacterial cells and medium supernatant by centrifugation. Bacterial cells are in PBS and glass b
The supernatant obtained by adding Eads and disrupting with volteX, and the medium supernatant was directly diluted and subjected to εIA using a polyclonal antibody and a monoclonal antibody against natural NKAF (Table ■). Although NKAF exists within the bacterial body, it was also secreted and expressed in the medium supernatant.

Table I Zero och2 (Japanese Unexamined Patent Publication No. 63-309180) is a temperature-sensitive mutation that makes it impossible to add mannose.

〔Effect of the invention〕

The effects of the present invention will be explained using experimental examples.

Experimental example 1 1. Antitumor activity of natural NKAF Plastic non-adhesive PBL and NKAF at 10% F[:
K-56 was cultured in S-RPMI-1640 medium at 37°C for 2.5 and 16 hours and labeled with SICr.
2. The cytotoxic activity against Molt-4 or Daudi cells was measured, and the enhancing effect of NKAF was determined from this, and the results shown in Tables 8 and 9 were obtained. However, the enhancement effect of the control was set as 100%.

1491- table NK activity enhancing effect of natural NKAF BXP, 1 8XP, 2 Control NK activity Shown as 100%.

EXP. 1 control NK activity 67% EXP. 2 control NK activity was 40%. Tables 8 and 9 show that natural NKAF includes recombinant interleukin-2 (r-IL-2. Shionogi & Co., Ltd.) and recombinant interferon-r (IFN-γ. CELLULAR PROD).
UCTSINC. ) showed the effect of enhancing NK activity.

In addition, plastic non-adherent PBL and mitomycin C
Mix with treated Raji cells and add 10% FCS-RPM
It was cultured in I-1640 medium at 37°C for 6 days, and then N
KAF was added and cultured for another day. In addition, SICr
MLTR (Mixed Ly
mphocyte Tumor Cell React
The activity of killer T cells induced by ion) was investigated.

The results are shown in Table 10.

It can be seen that NKAF enhances the activity of killer T cells induced by MLTR.

Table Experiment Example 2 Antitumor activity of recombinant NKAF BHK/pNK 8602 ・pSV2- dhfr clone supernatant NKAF activity was determined using human cancer cell line K-562.
The results shown in Table 11 were obtained when the cells were measured by enhancing NK cell activity using the cells as target cells.

When the control for the enhancing effect of NKAF was determined as 100%, the results shown in Table 12 were obtained.

Therefore, almost the same effect as natural NKAF was obtained.

Table 11 NKAF activity table of BHK/pNK 8602/pSVz-dhfr clone supernatant The NK activity of the control is shown as 100%.

[Brief explanation of the drawing]

Figure 1 is a chromatogram showing the results of purification of natural NκAF using a monoclonal antibody column, Figure 2 is a chromatogram showing the results of iEIA using a monoclonal antibody, Figure 3 is a chromatogram showing the results of purification by reverse-phase HPLC, and Figure 4 is SOS-PAGE. Figures 5 and 6 are diagrams showing the amino acid sequences of each peptide of NKAF, Figure 7 is a diagram showing the results of separation and identification of the C-terminal peptide, Figure 8 is a restriction enzyme cleavage map of the cDNA clone, Figure 9 shows p
Figure 10 shows the cDNA base sequence of NK8308 and the amino acid sequence of NKAF deduced from it.
Figure 11 is a diagram showing the construction process of pNK 8602(7)et using a vector. Figure 11 is a diagram showing the construction process of pBRD 5001.
Construction process diagram of PL9-5001, Figure 13 is pENK7
14 is a diagram of the construction process of pBRD 702, FIG. 15 is a diagram of the construction process of pNK 8001, FIG. 16 is a diagram of the construction process of pTN 1071, and FIG. 17 is a diagram of the construction process of pYNK 1902.

Claims (1)

[Claims] 1. Recombinant natural killer cell activator. 2. The recombinant natural killer cell activator according to claim 1, which has a peptide having the following amino acid sequence in the molecule. [There is a gene sequence. ] 3 cDNA encoding recombinant natural killer cell activator. 4. A cDNA encoding the recombinant natural killer cell activator according to claim 2. 5. The cDNA according to claim 4, comprising the base sequence shown by the following sequence. [There is a gene sequence. 6. An expression plasmid obtained by containing the cDNA according to claim 3 as a foreign gene and ligating it so as to enable control and expression in a selected host. 7. An expression plasmid obtained by containing the cDNA according to claim 4 as a foreign gene and ligating it in such a manner that it can be controlled and expressed in a selected host. 8. A host transformed with the plasmid according to claim 6. 9. A host transformed with the plasmid according to claim 7. 10. An antitumor agent containing a recombinant natural killer cell activator as an active ingredient. 11. An antitumor agent containing the recombinant natural killer cell activator according to claim 2 as an active ingredient.