JPH02227081A - New plasmid and production of nadh oxidase using the same - Google Patents

Abstract

PURPOSE:To obtain an NADH oxidase by synthesizing a plasmid holding a DNA region containing an NADH oxidase structure gene, a regulator gone region containing a promoter, etc., capable of controlling the expression of structure gene, etc. CONSTITUTION:A microorganism belonging to Escherichia coli K.12 is transformed with a plasmid containing (a) a DNA region containing an NADH oxidase structure gene, (b) a regulator gene DNA region containing a promoter and operator capable of controlling the expression of the above structure gene and (c) a DNA region containing a gene managing the autonomous proliferation of ColEI-type plasmid. The transformed microorganism is cultured in a culture medium and the objective NADH oxidase is separated from the cultured product. Plasmid pNOX-1 is a preferable example of the above plasmid.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to a novel plasmid carrying an NADH oxidase structural gene and a method for producing NADH oxidase using a microorganism transformed with the plasmid.

NADH oxidase is a useful enzyme that oxidizes cyclic nicotinamide adenine dinucleotide (hereinafter abbreviated as NADH) using molecular oxygen and regenerates nicotinamide adenine dinucleotide (hereinafter abbreviated as NAD).

NA regenerated by the NADH oxidase of the present invention
D is a useful substance that acts as a coenzyme for various dehydrogenase reactions performed in vivo. Many of these dehydrogenases that use NAD as a coenzyme are suitably used in the production of industrially useful optically active compounds, reaction intermediates, and the like.

Conventional technology As an NADH oxidase that oxidizes NADH using molecular fermentation cold as an electron acceptor, Lactobacillus spp.
plantarum (L actobacillus plan)
tarum) [Agricultural and Biological Chemistry]
ral and B iological Che++
+1stry) Volume 25, Page 876, 1961], Streptococcus faecalis (S strep
tococcus faecalis) [Journal on Biological Chemistry (J
Our own of B iological Che
mi! At'y), Volume 237, Page 2647, 1
962], Acholeplasma laidralai (A ch
oleplasma laidlawii) [European Journal of B
iochemistry), vol. 120, p. 329, 1981], Bacillus megaterium (B a
cillus + megateriu + m) [Journal on Biochemistry (J our
nalof Biochemistry, Volume 98, Page 1433, 1985], Leuconostoc mesenteroides
senteroides) [Journal of Biochemistry (Journal of
Biochemistry), Volume 97, Page 1279, 1985].

However, the NADH oxidase known by these techniques is difficult to prepare in large quantities because it is difficult to culture the microorganism (such as Acholeplasma lidlelarii), the enzyme is difficult to collect because it is present in the intracellular fraction, and it is difficult to collect the enzyme from bacteria. They have disadvantages such as difficulty in increasing the content in the body (Bacillus megaterium, etc.), poor thermal stability and cannot be expected to maintain their activity over a long period of time (Leuconostoc, mesenteroides, etc.). Not suitable for commercial production.

Problems to be Solved by the Invention As a result of a wide search for NADH oxidase source microorganisms suitable for industrial production, the present inventors found that they have an optimal growth pH in an alkaline region and can survive in the presence or absence of oxygen. species of anaerobic bacteria produce N with excellent temperature stability.
He discovered that the microorganism produces ADH oxidase, and proposed a method for industrially producing NADH oxidase by culturing the microorganism in a medium (see Japanese Patent Application No. 63-257374; hereinafter, the above microorganism is referred to as an "alkaliphilic stimulant"). (sometimes referred to as anaerobic NADH oxidase-producing bacteria)
.

As a result of intensive investigation into a method for producing NADH oxidase more efficiently, the present inventors discovered that NADH
A DNA region (a) containing the oxidase structural gene is extracted and combined with a DNA region (b) containing a promoter and operator capable of controlling the expression of the structural gene and ColE.
DNA containing the gene that governs the autonomous replication ability of the 1-line plasmid
A microorganism, for example, Escherichia coli K, which is ligated to a plasmid vector having region (c) and transformed with the plasmid.
-12 series microorganisms can be cultured in a growth medium to efficiently increase NA.
The inventors discovered that DH oxidase can be produced and completed the present invention.

Thus, according to the present invention, the DNA region (a) containing the NADH oxidase structural gene, the regulatory gene DNA region (b) containing the promoter and operator capable of controlling the expression of the structural gene, and the autonomous replication of the Co11El system plasmid. A plasmid is provided, which is characterized in that it carries a DNA region (c) containing a gene that governs this ability.

Further, according to the present invention, a microorganism transformed with the plasmid of the present invention, preferably E. coli and 112 series microorganisms, is cultured in a growth medium, and the NAD
A method for producing NADH oxidase is provided, which comprises collecting H oxidase.

Hereinafter, the structure of the plasmid newly created in the present invention, its preparation method, and the method for producing NADH oxidase using a microorganism transformed with the plasmid will be explained in more detail.

The plasmid of the present invention has, as an essential DNA region, at least a DNA region (a )” (hereinafter, this may be abbreviated as “N region”), and a regulatory gene DNA region (b) containing a promoter and operator capable of controlling the expression of the rNADH oxidase structural gene” (hereinafter, this may be referred to as “P region”). (sometimes abbreviated as ")" and the DNA region (c) containing the gene that controls the autonomous replication ability of rcoQEI-based plasmids.
J (hereinafter, this may be abbreviated as "S area").

First, the microorganisms that are the source of DNA in the N region are:
Any strain may be used as long as it belongs to alkaliphilic facultative anaerobic bacteria and has the ability to produce NADH oxidase, and may also be a mutant strain thereof. Preferred specific examples of strains having these properties include, for example, Agricultural and Biological Chemistry (Agricultural and Biological Chemistry).
For example, the Ep01 strain described in vol. 51, pages 2271 to 2275 (1987) of J. Chemistry). This strain has been submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology with microbial accession number 100.
No. 96 (FE RMP-10096).

The N region DNA can be prepared by cutting out the chromosome of the above-mentioned microorganism with an appropriate restriction enzyme, such as AQu Is Hind m. Particularly preferably used N region DNA is the alkaliphilic facultative anaerobic NADH oxidase producing bacterium FERM P-
The chromosome 10096 was digested with restriction enzyme A (2ul and/or H
The length obtained by cutting with indI[ is approximately 1.
A 6 kb DNA fragment is mentioned. The lengths of the cut fragments obtained when the DNA fragments were cut with various restriction enzymes are shown in Table 1 below.

Furthermore, a restriction enzyme cleavage map of the DNA fragment is shown in FIG. In addition, the plasmids and DNA shown in this specification
The length of the fragment is a value measured by agarose gel electrophoresis.

Restriction enzyme ward 1 [n@ Length of cleavage fragment Cl2al
l Approximately 0.4kb, approximately 1.2kbD
raI l about 0.3 kb, about 1.3
kb) 1incll l approx. θ, 7k
b, about 0.9 kb Next, as the P region, for example, the "-35 region" of the trp promoter derived from the tryptophan operon and the lactose operon and QacUV-
By fusing the "-10 region" of the 5 promoter [deBoer, H, et al., Proc.
Natl.

Acad, Sci, USA, 80.21 (1983
): Ru5se1. D., R., & Bennett, G.
, N. Gene 20.

231 (1982) Reference J constructed regulatory gene DN
A (hereinafter abbreviated as P tac) is preferably used. P tac is suppressed by the lactose repressor, but in Escherichia coli JMI09 (2acIo hosts), the suppression is relieved by the addition of isoglovir β-D-thiogalactopyranoside (hereinafter abbreviated as IPTG). Ptac can be a fragment of a Ptac-containing DNA fragment derived from plasmid pDR540 (manufactured by Pharmacia) or an isolated Ptac.
In addition to being able to use c fragment (manufactured by Pharmacia),
A commonly used DNA synthesizer (BBckman S
It is also possible to use DNA synthesized by the system (system l PINs).

Furthermore, the S-region DNA includes a DNA fragment containing a gene that controls the autonomous replication of ColE1-based plasmids whose copy number is 20 to 30 per cell chromosome, and a typical example thereof is plasmid pBR322 (manufactured by Takara Shuzo). was cleaved with restriction enzymes EcoRI, Bindl [[, etc.
Mention may be made of DNA fragments having a length of 3 kb.

The plasmid newly created in the present invention contains the three essential DNAs of the N region, P region, and S region described above.
However, it can also contain other DNA regions that carry other genetic information, such as a DNA region that contains an ampicillin resistance gene that is an antibiotic resistance marker, a DNA region that contains a kanamycin resistance gene, etc.

Specific examples of plasmids provided by the present invention include:
Plasmid pNOX-1 can be mentioned which consists essentially of three regions: N region, P region and S region. This novel plasmid pNOX-1 can be prepared, for example, by the method shown below.

As a source of the N region, the aforementioned alkalophilic facultative anaerobic NADI (oxidase producing bacterium FERM P-
10096 cultures are used.

As a nitrogen source that is a nutrient source for a medium that can be used for culturing NADH oxidase-producing bacteria, for example, inorganic nitrogen compounds such as ammonia, ammonium sulfate, ammonium chloride, ammonium nitrate, etc. can be used alone or in combination. Further, as the inorganic metal salt, for example, potassium hydrogen phosphate, potassium dihydrogen phosphate, potassium chloride, magnesium sulfate, manganese sulfate, ferrous sulfate, etc. are used. In addition to the inorganic nutrient sources mentioned above, natural nutrient sources such as cornstarch liquor, yeast extract, peptone, etc. may be added. Furthermore, as a carbon source, for example, glucose, xylose, mannose, fructose, aldose, sucrose, cellobiose, xylan, etc. can be added to the medium.

When culturing the above-mentioned NADH oxidase-producing bacteria in a medium having the above composition, the appropriate culture temperature is usually about 20 to about 50°C, preferably about 35 to about 45°C. In addition, the pH of the culture medium is not strictly limited as long as it is in the alkaline range of approximately pH 7.5 or higher, but is generally 8 to 1005, preferably 8.5 to 1000.
A range of 0 is advantageous. The pH of the medium is conveniently adjusted to within the optimum range by adding an alkali such as sodium hydroxide, potassium hydroxide, or sodium ammonia carbonate to the medium. Culture time is usually 3-2
The time can be about 4 hours, preferably about 5 to 20 hours. Cultivation can be carried out under aerobic conditions such as aeration and shaking, or may be carried out under anoxic and anaerobic conditions.

When culturing under anaerobic conditions, use an oxygen-incompatible gas atmosphere such as nitrogen gas, helium gas, argon gas, or a mixture thereof from which oxygen has been removed using a reduced steel column, or reduce the redox potential of the culture medium. Techniques commonly used when culturing facultative anaerobic bacteria, such as adding reducing agents such as titanium (■) citric acid and dithionite to facilitate the growth of anaerobic bacteria [e.g., Yamazato, Uda, Kodama, Moriji, , “Microorganism Isolation Method J R&D Planning (published in 1986) 246-
274, etc., any condition can be applied as long as it is effective in the alkaline region where the growth of this fungus is optimal and does not adversely affect the growth of this fungus.

Furthermore, it is not necessary to perform all stages of culturing up to the acquisition of specimens under only one condition, anaerobic or aerobic. It is also a preferable method to culture in a combination of intermediate conditions by changing to anaerobic conditions.

The cells thus cultured are collected and disrupted by commonly used means such as ultrasonication or homogenization, and then the chromosome D is isolated by a commonly used method known per se.
NA can be extracted.

The extracted chromosomal DNA is treated with a suitable restriction enzyme, such as A
An N region with a length of 1.6 kb can be obtained by cutting with Qul and further cutting with the restriction enzyme Hindll or directly with the restriction enzyme Hindll.

The DNA fragment cleaved with the above restriction enzymes AffuI and/or Hindl is cloned into a cloning vector such as a plasmid or λ phage.

For example, use this DNA fragment as an expression cloning vector p
H of p L -lambda (manufactured by Pharmacia)
Pa! It can be introduced into the site. In this case, Hpa
Since only the fragment cut with the restriction enzyme AffuI can be introduced into the xM position in its original form, the restriction enzyme Hindl[
[When cut with [, a linker is attached or the cut site is made blunt-ended, and then it can be introduced into the above-mentioned Hpa1 site.

After transforming the plasmid into which the above DNA fragment has been introduced into a suitable host E. coli, such as Escherichia coli strain N4830, expression is induced by heat induction at 42°C for 3 minutes, and the expression of the target protein is determined by immunization using an NADH oxidase-specific antibody. A desired clone can be easily obtained by confirmation using methods such as screening. Moreover, the above DNA fragment can also be ligated to other expression vectors.

In addition, as a supply source for the S region, the above-mentioned Co12E1
It is most preferable to use the representative plasmid pBR322 (manufactured by Takara Shuzo) as the plasmid.

Further, as the P region, it is preferable to use the above-mentioned P tac. It is preferable to synthesize DNA so that P tac has arbitrary restriction enzyme recognition sites at both ends. At this time, considering integration into plasmid pBR322, EcoR summer cleavage site is placed on the 5' side and HindDI is placed on the 3' side.
It is desirable to have a cutting site.

The P tac fragment prepared as above was treated with restriction enzymes EcoRI and Hindn [
R322 (S region) and treated with T4 DNA ligase, the above P tac
Plasmids incorporating the fragments can be created. This plasmid was then cleaved with HindnI,
Together with the DNA fragment (N region) containing the NADH oxidase structural gene excised with HindI, T4D
A suitable host is transformed by the action of NA ligase, and the desired plasmid can be obtained from the presence or absence of expression of NADH oxidase. The present inventors used the thus prepared target plasmid as plasmid pNOX.
Name it -1.

The sensitivity of the restriction enzyme of plasmid pNOX-1 (number of recognition sites) and the length of the fragment cut by the restriction enzyme (k b)
are shown in Table 2 below. Furthermore, a restriction enzyme cleavage map of this plasmid is shown in FIG.

Table 2 Supervision! 1 Number of recognition sites Length of cleavage fragment EcoR
I l Approximately 5.9kbCQa
I l about 5.9kbBamH
I 1 approximately 5.9kbPst
I 1 approximately 5.9kbHin
d m 2 approximately 4.3kb, approximately 1
．． Next, the transformation of a host microorganism with the novel plasmid of the present invention and the method for producing NADH oxidase using the microorganism will be described.

As the host bacteria that can be used for transformation with the plasmid of the present invention, Escherichia coli (Escherichia coli) is preferable.
Among them, Escherichia coli K-12 strain is particularly preferred.

In addition, the plasmid of the present invention can be introduced into these host bacteria using methods known per se, such as M, M ande.
l, A, Hζga; J, Mo1. B iol, 53
, 159 (1970) and the like.

By culturing the host fungus transformed in this manner by a method known per se, NADH oxidase can be sufficiently produced and accumulated within the microbial cell.

Since the microbial cells thus cultured contain NADH oxidase, the obtained microbial cells can be disrupted by commonly used means such as ultrasonication, enzyme treatment, homogenization, etc., and a cell-free extraction can be obtained. The solution can be separated and purified using known separation and purification methods such as salting out, ion-exchange chromatography, and gel filtration [for example, Biochemical Experiment Course Vol. 1, "Chemistry of Proteins I Separation and Purification," edited by the Japanese Biochemical Society, published by Tokyo Kagaku Doujin, 1. NADH oxidase can be collected by subjecting the sample to "Basic Experimental Methods for Proteins and Enzymes," published by Nankodo, pages 1 to 379, edited by Takeshi Horio and Nipei Yamashita].

The culture of the above-mentioned transformed bacterium varies depending on the type of host bacterium, but in general, it can be carried out using commonly used synthetic or natural media. As a carbon source, various carbohydrates can be used, such as glucose, glycerol, 7-lactose, sucrose, and molasses. Further, as the nitrogen source, natural organic nitrogen sources such as tryptone, yeast extract, corn steep liquor, and casein hydrolyzate can be used. Many natural organic nitrogen sources can serve as carbon sources as well as nitrogen sources. In addition, IPTG is added to the medium at a concentration of usually 0.1mM or more, preferably about 0.5mM to 5mM, during the mid-logarithmic growth phase after the start of culture, and NAD
Preferably, inducible expression of H oxidase is performed.

Cultivation can be carried out under aerobic conditions such as shaking culture or submerged culture with aeration. The culture temperature is generally 20~
The temperature is 50° C., and it is desirable to maintain the pH of the medium in the vicinity of neutral or slightly alkaline. The culture period is usually about 10 to 40 hours.

Next, according to Examples, preparation of the plasmid of the present invention and NA
The production of DH oxidase will be explained in more detail.

Example 1 Creation of Niblasmid pNOX-1 A) Alkaliphilic facultative anaerobic NADH oxidase producing bacterium FERM
For the preparation of P-10096 chromosomal DNA, 41g of HPO, 2gsMgSO of ammonia nitrate,
・7H, 0200mg, Mn5Oa'7Hz0 5mg
%F e SOa・7HzO5mgxCaCI21・
2 HzO700m gs yeast extract 3 gs polypebut 2300mg, xylan 10g and resazurin 1m
Dissolve g in 900ml of distilled water, 1oOa for each 90i
It was dispensed into +ff volume serum bottles. After degassing by boiling and passing through a reduced copper column to aerate the prepared oxygen-free nitrogen gas, cover with a butyl rubber stopper and seal with an aluminum cap at 120° CI5.
I did some sterilization.

To this medium was added lQmQ sterilized 10% aqueous sodium carbonate solution (pH 1O, 6) at 120°C for 15 minutes, and the pH of the medium was adjusted to 10. Furthermore, as a reducing agent, Science Vol. 194, 1165-1166
A, J, B, Zehnder & K. on page.

A titanium (I[[) citric acid solution prepared according to the method of Wuhrmann et al. was added to a final concentration of 0.13 mM. This medium was inoculated with the alkaliphilic facultative anaerobic bacterium EpO1 strain (Feikoken Bacteria No. 10096), and
A seed culture solution was obtained by statically culturing at 0° C. for 20 hours.

Dispense 450d of a medium with the same composition into a 500+FF serum bottle, except that xylan log was changed to glucose log, perform the same operation, sterilize at 120°C for 15 minutes, and add 10% sodium carbonate aqueous solution 50*Q.

Titanium(III) citric acid solution to a final concentration of 0.13
Add to make it mM. Said seed culture solution 10rnQ
was inoculated and statically cultured at 40°C for 124 hours.

After culturing, 100mff1 of the culture solution was added to IO, OOOX.
After centrifugation for 20 minutes, the resulting bacterial cells were suspended in 50 ml of Lys buffer (pH 8,0) and 50 ml of OmM, EDTA/2Na solution. After adding it for 5 minutes, add 1
Add 61112 0% sodium dodecyl sulfate solution,
It was kept warm at 65°C for 30 minutes. Add 5M N to this lysate.
Add 15 ml of aCff solution, cool at 0 °C for 1 hour, and centrifuge the entire volume (12,000 × g).

60 minutes, 4°0) Collect both L and upper grooves, add twice the volume of ethanol, mix, and centrifuge (5, OQOXg
, 10 min, 4°C). The resulting precipitate was diluted to 10mM
Tris buffer (pH 7,5) 1mM EDTA
・DNA is dissolved in 2Na solution, treated with phenol (removal of protein) and treated with RNA degrading enzyme.
I got it.

B) DNA containing the NADH oxidase structural gene
Preparation of Fragments 50 μg of the chromosomal DNA prepared in (A) above was digested by reaction at 30° C. for 1 hour using the restriction enzyme AQu II O units to prepare a solution of the Affu I digest of the chromosomal DNA. The Al2uI digest solution was separated by agarose gel electrophoresis, and the gel containing DNA fragments with a length of 1 to 4 kb was cut out, and the gel was separated using a conventional method [B, Vogelst
ein & D, G iL L espie, P
roe.

NatJ, Acad, Sci, USA, vo17
6, pp. 615-619 (1979)] and purified by a method of adsorbing the DNA fragments to glass powder.

Plasmid pPL-lam was added to this AQuI digest solution.
bda (manufactured by Pharmacia) lPg with restriction enzyme Hpa
Mix the cleavage product solution obtained by reacting at 30°C for 1 hour using 50mM Tris buffer (pH
7,6), 10mM dithiothreitol, lmM A
TP, l OmM MgCQ* and T4 ligase l u
Each component of nit was added (the concentration of each component is the final concentration) and allowed to react at 16° C. for 15 hours to bind.

Using this purified liquid, the conventional method [M, MandeLA, H
iga.

J, Mo1. Biol,, vol153. pi59
(1970)] according to Escherichia Colli (E.
Transform the N4830 strain (5cher ich i and 1i) and add L medium (tryptone 1Og, yeast extract 5g
, N a C (15 gs glucose Ig and distilled water l
Q, pH 7,2) with ampicillin at 50 μg/1tt (
The cells were added to a concentration of 1°C and plated on a medium solidified with 1.5% agar (hereinafter referred to as LA medium), and cultured at 30°C for 20 hours to form colonies. A nitrocellulose membrane was placed on the medium and heat induction was applied at 42°C for 3 hours.

After lysing the colony on the membrane filter and blocking non-specific binding of membrane with bovine serum albumin, immunoscreening was performed using an anti-NADH oxidase antibody prepared by immunizing a rabbit with purified NADH oxidase as a primary antibody. Ta. Menplan further ho
a conjugated with rse-radish peroxidase
After treatment with nti-rabbit IgG, the target colonies were selected by color development with hydrogen peroxide-3,3-diaminobenzidine or hydrogen peroxide-4-chloro-1-naphthol. Transformants were obtained at a ratio of 5XIO-'.

The five strains obtained were cultured in LA liquid medium at 30°C for 20 hours, then heat-induced at 42°C for 3 hours, and then centrifuged (1
2,00 rpm, 20 minutes). After suspending 1 g of the bacterial cells in 2+m (1 part Tris buffer (p) 17.8),
Oxygen electrodes (Y allow springs I
The strain with the highest oxygen absorption during N and ADHa conversion was selected using the following method (manufactured by Nstrument, Inc.). From this stock,
Alkaline-3DS method [T, Maniatis, E
, F., Fritsch, J., Sambr.
ook, “Mo1ecular Cloning” (1
982) pp90-91], the plasmid was extracted with the restriction enzyme EcoRI, and the molecular weight was determined by agarose gel electrophoresis.
It was found that approximately 2 and Okb DNA fragments were inserted into ambda.

Since the Hpal recognition site used for pPL-lambda insertion cannot be used due to blunt-end ligation, we searched for other restriction enzyme cleavage recognition sites. It was found that the extracted plasmid could be excised as a 1.6 kb DNA fragment, and the HindIII cleavage product of the extracted plasmid was separated by agarose gel electrophoresis, and a 1.6 kb DNA fragment was extracted from the gel using the Nal-glass powder method described above. Prepared.

C) Synthesis of Ptac Promoter Pt having the base sequence shown below
ac using a DNA synthesizer (Sys manufactured by Beckman)
temlPlug).

AATTCTGTTGACAATTAATCATCGG
CTCGTATAATGGACAACTGTTAATT
AGTAGCCGAGCATATTACTG YGG
A A TT GTG A GCGG A T A A
CA A TT TCACA CAGG A AAC
ACCTTAACACTCGCCCTATTGTTAAA
GTGTGTCCTT^CA TGTTCGA D) P tac and NA to plasmid pBR322
The plasmid pBR32211℃g containing the DNA fragment containing the DH oxidase structural gene was digested with the restriction enzyme EcoRI.
and Hindl [[(1 unit each) at 30°C,
The 1 and 6 kb DNA fragment lpg prepared in the previous section b) and 0.1 pg of the Ptac DNA fragment prepared in the previous section C) were mixed into the decomposition product solution obtained by reacting and cleaving for 1 hour, each at a final concentration of 50 mM. , l OmM.

l mM% l mRL l OmM, l uni
Add Tris buffer (7,6), dithiothreitol, ATP, MgCQ*, and T4 ligase so that
The mixture was reacted at 16° C. for 15 hours and bonded. This solution was used to grow Escherichia coli (E 5cherichi col).
i) K-12 strain JM109 strain was transformed according to a conventional method, spread on LA medium, and cultured at 37°C for 24 hours. Plasmids were extracted from the grown strains by the alkaline-5DS method, and the restriction enzyme EcoRI (5uni
ts) and CQa I (5 units), and the molecular weight was measured by agarose gel electrophoresis. As a result, a DNA fragment (1.6 kb) containing the NADH oxidase structural gene was found with different coordination at the Hindlll cleavage site. There was one of each ligated plasmid. Among the fragments generated by EcoRI and (12a I), a fragment with a length of approximately 1.2 kb was generated. The other plasmid was named pNOX-1. - The coli K-12 strain JM109 strain was named NYOI.This NYOI strain was sent to the Institute of Microbial Technology, Agency of Industrial Science and Technology, 1-1-3 Yatabe Higashi, Tsukuba City, Ibaraki Prefecture, on February 16, 1989. Accession number by date: Microtechnical Research Institute No. 10542
No. (FERM P-10542).

Example 2: Production of NADH oxidase M9S medium (5.8g Na1HPO4,3g1cH, po, 5
g NaCl2, IgNH,C (1°l distilled water, 0.
5% glycerol, 0.5% casamino acid, and 4 μg of cod thiamine hydrochloride) were dispensed into 500 mg Erlenmeyer flasks and sterilized at 120° C. for 15 minutes. Ampicillin was added to this medium at a concentration of 40 μg/rsQ, and Escherichia coli (E 5cherichi coli)
NYO1 strain and JM109 strain were each separately inoculated and cultured at 30°C for about 16 hours. This l:10
Inoculate 100 ml of fresh medium at a dilution rate of 0,
Culture was continued at ℃. Absorbance at 650 nm is approximately 1.0
When this reached, culture was continued with the addition of IPTG to a final concentration of 2mM. After about 4 hours, centrifuge (12,
00 rpm, 20 minutes), the collected bacteria were suspended in 1- Tris buffer, and disrupted by ultrasonication. Centrifugation (12,0
To minimize the influence of Escherichia coli NADH dehydegenase present in the membrane system, ultracentrifugation was performed at 100.000×g for 1 hour, and the supernatant was used as an enzyme solution.

The activity of this enzyme can be measured as follows. That is, after holding a reaction solution consisting of 1.9 ml of 50 mM potassium phosphate buffer and 0.0511 ff of enzyme solution at a specified temperature, 0.05 m<1 of 5 mM NADH was added to start the reaction, and the decrease in absorbance at 340 nm was observed. Measure. For the enzyme activity, 1 unit was defined as the amount of enzyme that oxidized 1 pmo of NADH per minute.

The activity of the enzyme solution obtained above was measured at 37° C. The results are shown in Table 3 below. As a control, the alkalophilic facultative anaerobic bacterium E, which is the source of the NADH oxidase gene,
The activity of an enzyme solution similarly prepared from cells of p01 (FERM P-10096) strain is also shown.

Table 3 As shown in the above table, when the strain transformed with the plasmid of the present invention (NYOI) is used, the specific activity increases nearly four times as compared to the parent strain (Epol) that is the gene source, and at the same time It has been revealed that the plasmid of the invention can efficiently induce and express NADH oxidase in Escherichia coli K-12 strain.

The novel plasmid of the present invention has a high copy number and IP
It has the characteristic that NADH oxidase can be efficiently expressed by adding an inducer such as TG.

Therefore, industrial production of NADH oxidase becomes possible by culturing microorganisms transformed with the plasmid of the present invention.

[Brief explanation of the drawing]

FIG. 1 is a restriction enzyme cleavage map of a DNA fragment having a length of approximately 1.6 kb containing the NADH oxidase structural gene obtained by the present invention, and FIG. 2 is a restriction enzyme cleavage map of the plasmid pNOX-1 obtained by the present invention. This is a restriction enzyme cleavage map of . Figure 1 Figure 2 Procedural amendment (revised May 28, 1990 3, person making the amendment Relationship to the case Patent applicant name (605) Mitsubishi Yuka Co., Ltd. 4, agent Address: 107 6, Amendment The "Detailed Description of the Invention" column of the subject specification and drawings (1) The term "ring element" on page 2, line 19 of the specification is corrected to "reduction." (2) Page 10, line 5 of the same specification. Correct the line "isopropyl β" to "isopropyl-β". (3) Delete "fragment of" before the word "or" in page 10, line 10 of the same. (4) Delete "fragment of" before the word "or". On page 18, line 18, the phrase "Used." is corrected to "can be used." (6) On page 12, line 4 of the same page, correct "-" to read r-J. ■ On page 19, line 19 of the same day "Maintain near alkaline" should be corrected to "maintain near alkaline, for example within the range of pH 8 to 9.5." (8) On page 20, line 5 of the same page, after "creating", ""Transformation of Escherichia furi using plasmids". (9) Add "Plasmid pBR
322 with a DNA fragment containing Ptac and NADH oxidase structural genes" was replaced with "Plasmid pNO
``Creation of X-1 and transformation of Escherichia coli with the plasmid.'' (RFJ No. 26ji' No. 15f?J: rpBR3221
Correct p2J to rpBR3221pIJ. ■ Delete "Yatabe" after "Tsukuba City" on the last line of page 27. 0 Figure 2 is corrected as shown in the attached sheet. Figure 2 and above Accession number change notification 7. Name of the new depositary institution May 28, 1990 8, New deposit number 9, Catalog of attached documents Document certifying the new deposit number 3, Person who performed the procedure Relationship with the case

Claims (1)

[Scope of Claims] 1. A DNA region (a) containing an NADH oxidase structural gene, and a regulatory gene DNA region (b) containing a promoter and operator capable of controlling the expression of the structural gene.
A plasmid characterized by possessing a DNA region (c) containing a gene that controls the ability of Col E1-based plasmids to autonomously reproduce. 2. The DNA region (a) containing the NADH oxidase structural gene is derived from a facultatively anaerobic NADH oxidase-producing bacterium with an alkaline optimum growth pH and has a length of about 1.
The plasmid according to claim 1, which is a 6 kb DNA fragment. 3. Regulatory gene DN containing a promoter and operator capable of controlling the expression of the NADH oxidase structural gene
The plasmid according to claim 1, wherein the A region (b) is derived from tryptophan operon and lactose operon. 4. The DNA region (c) containing the gene governing the autonomous replication ability of the Col E1-based plasmid is the plasmid pBR322.
The plasmid according to claim 1, which is a DNA fragment derived from 5. The plasmid according to claim 1, wherein the plasmid is plasmid pNOX-1. 6. A method for producing NADH oxidase, which comprises culturing an Escherichia coli K-12 microorganism transformed with the plasmid according to any one of claims 1 to 6 in a growth medium, and collecting NADH oxidase from the culture. Manufacturing method.